|
|
||||||||
Plant |
Virology Department, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK1
University of Aachen (RWTH), Institute for Molecular Genetics and Botany (Biologie I), Worringerweg 1, D-52074 Aachen, Germany2
Author for correspondence: Michael Taliansky. Fax +44 1382 562426. e-mail mtalia{at}scri.sari.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
|
Luteovirus particles or RNA cannot infect plants when mechanically inoculated, but this barrier can be overcome by Agrobacterium tumefaciens-mediated infection (agroinfection) (Leiser et al., 1992
; Commandeur & Martin, 1993
). Agroinfection experiments with mutants of Beet western yellows virus (BWYV) have established that deletion or truncation of portions of P5 does not result in diminished replication in protoplasts but impedes virus accumulation in systemically infected plants (Brault et al., 1995
; Ziegler-Graff et al., 1996
). Similar deletions in the genome of another luteovirus, Barley yellow dwarf virus-PAV (BYDV-PAV), have recently been shown to have the same effect (Chay et al., 1996
). These observations, and immuno-localization studies (Mutterer et al., 1999
), indicate that P5 may be involved in efficient systemic virus movement, but its role in this process is obscure.
To gain a better understanding of the mechanisms of luteovirus infection, we have attempted to use a strategy that has been exploited in a number of fields of biology, including plant virology. This is the use of the jellyfish green fluorescent protein (GFP) as a molecular reporter (Baulcombe et al., 1995
; Oparka et al., 1995
, 1996
). The GFP gene has been incorporated into plant virus genomes to monitor virus infections and to study (sub)cellular locations of virus proteins fused to GFP. Here we describe the successful insertion of cDNA encoding GFP into PLRV cDNA and test the utility of the recombinant virus for studies of aphid transmission and systemic movement of PLRV. In particular, this new experimental system has allowed the first direct visualization of the sites of establishment of luteovirus infection, and thus by inference their sites of entry into a host plant.
| Methods |
|---|
|
|
|---|
Plasmids and generation of recombinant cDNA constructs.
Inoculation of protoplasts.
Mesophyll protoplasts were prepared from leaves of N. benthamiana as described by Power & Chapman (1985)
. Approximately 106 protoplasts were electroporated with 1020 µg of plasmid DNA as described by Gal-On et al. (1994)
. Samples were collected after 72 h of incubation for detection of GFP fluorescence, ISEM, immunocapture-RTPCR, ELISA and immunoblot analysis.
Aphid transmission assay.
Virus particles in extracts of 2x105 N. benthamiana protoplasts infected with PLRV-GFP were used as a virus source in aphid transmission tests. Non-viruliferous Myzus persicae nymphs were allowed to feed on these extracts, prepared as described by Bruyère et al. (1997)
, through Parafilm membranes for 24 h. The aphids were then transferred to healthy N. clevelandii plants for 24 h inoculation access periods and then killed by fumigation. The presence of fluorescent cells was assayed by confocal laser scanning microscopy starting from the fifth day after transmission.
Agrobacterium-mediated infection of plants.
Agrobacterium tumefaciens (strain LBA 4404) carrying pBNUP110 or pBIN.PLRV-G was grown in YB broth with kanamycin (25 µg/ml) and rifampicin (100 µg/ml) for 48 h. The culture was centrifuged and resuspended in 1/10 to 1/20 vols of water and used for agroinfection. N. benthamiana and N. clevelandii plants at the three-to-four leaf stage were used for agroinfiltration (English et al., 1997
) or agroinoculation (Leiser et al., 1992
) as described above.
RNA and protein analysis.
CP accumulation was detected in samples of 106 protoplasts or 0·2 g of leaf tissues disrupted in 1 ml of PBS (pH 7·2) by ELISA, essentially as described by Barker & Solomon (1980)
. ELISA A405 values were obtained after 1 or 2 h incubation with substrate; values for both uninfected plants or protoplasts (negative control) were between 0·01 and 0·09. For immunoblot analysis, samples of protoplasts (5x104) or plant tissues (30 mg) were disrupted in 50 mM TrisHCl, pH 6·8 containing 10% (v/v) glycerol, 1% 2-mercaptoethanol and 2% SDS and kept at 95 °C for 5 min. Samples were then separated by electrophoresis in 7 or 12·5% SDSpolyacrylamide gels (Sambrook et al., 1989
). Proteins were transferred to nitrocellulose membrane Protran BA85 (Schleicher & Schuell) using a Trans-Blot Cell (Bio-Rad), and blots were treated with MAb SCR3 (diluted 1:1000), prepared against PLRV, and then with goat anti-mouse antibody conjugated to alkaline phosphatase (Sigma). For immunocapture of virus particles, extracts from infected protoplasts were incubated on ELISA plates pre-coated with polyclonal antibodies against PLRV CP. Virus RNA was isolated using the RNeasy Plant Mini Kit (Qiagen). RTPCR analysis was done by using random hexamers to prime first cDNA strand synthesis and two sets of primers for subsequent PCR amplification. PCR primers were (A) and (B) (described above), which are specific for sequences at each end of the GFP gene (set 1), or (C) 5' GATCAAGCTTCATTTCCTCCCTTGGAATG 3' and (D) 5' GATCGGATCCGAACCTAGAGTTTCCG 3', which are specific for ORF5 sequences between nt 5205 and 5742 (set 2). The amplified fragments were sequenced using an ABI Prism dRhodamine Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).
Immunosorbent electron microscopy and immunogold labelling of virions.
Virus particles extracted from PLRV-infected or PLRV-GFP-infected protoplasts were concentrated ten times using Microcon centrifugal filter devices (Millipore). Immunosorbent electron microscopy (ISEM) was done essentially as described by Roberts (1986)
, using a polyclonal antiserum prepared to PLRV or GFP. Immunogold labelling was optimized and performed as described by Pereira et al. (1994)
. Virus particles were treated for 16 h at 4 °C with GFP antibodies conjugated (by I. M. Roberts, Scottish Crop Research Institute) to colloidal gold beads of 10 nm diameter (GC-10, British BioCell International). After immunogold labelling, the particles were trapped by grids coated with antibodies against PLRV, stained using 2% uranyl acetate or 2% sodium phosphotungstate and photographed in a Philips CM 10 transmission electron microscope.
Detection of green fluorescence.
GFP fluorescence in protoplasts or plant tissues was viewed with a Bio-Rad MRC 1000 confocal laser scanning microscope, using methods that were described previously (Baulcombe et al., 1995
; Oparka et al., 1995
). The conditions used for confocal microscopy, excitation at 488 nm using a kryptonargon laser and 522 nm emission filter, allowed detection of GFP-mediated fluorescence with no significant autofluorescence.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
Agroinfiltration of both N. clevelandii and N. benthamiana plants with pBIN.PLRV-G resulted in the development of fluorescent foci in the infiltrated areas adjacent to the sites of infiltration. The foci were clearly visible by confocal laser scanning microscopy on or after the fifth day post-inoculation (Fig. 3f
, g
, h
). The fluorescent foci comprised different types of single cells or occasionally small groups of cells surrounding the infiltration sites. Fluorescence was detected in epidermal, mesophyll (approximately 80% of the cells were in epidermis and mesophyll) and phloem-associated cells (10% of the cells) (Fig. 3f
, g
, h
). However, in agroinoculated plants, most of the fluorescent cells (90%) were in phloem tissues, and the remainder were in mesophyll and epidermis. The intracellular distribution of the fluorescence was similar to that observed in plants infected by aphids. As in the aphid transmission experiments, the initially formed fluorescent foci did not increase in size. Moreover, fluorescent cells were only seen in the infiltrated areas, indicating that agroinfiltrated PLRV-GFP, as well as that transmitted by aphids, was unable to spread systemically. ISEM of the extracts obtained from leaf tissues around infiltration sites 1 week post-inoculation detected virus particles that were indistinguishable in appearance from those that accumulated in protoplasts infected with PLRV-GFP. The particles were trapped with antibodies against both PLRV or GFP, indicating that these particles contained GFP epitope(s) on their surfaces (data not shown). Immunoblot analysis of tissues in zones of primary infection detected two protein products that reacted with MAbs against PLRV CP. These corresponded to the major CP and readthrough protein with a molecular mass of approximately 97 kDa as predicted for the GFP gene fused with the readthrough portion of the P5 gene at the XhoI site (Fig. 1
and Fig. 4
, lane 4).
Thus, these data confirm the suggestion from the results of aphid transmission experiments (see above) that the GFP-tagged PLRV is able to replicate, to form virus particles and to express the GFP gene in primarily infected cells, but that it cannot spread systemically. However, as in the aphid transmission experiments, PLRV antigen, but not GFP fluorescence, was detected by ELISA in non-infiltrated leaves of some N. benthamiana (typical A405=0·49) and N. clevelandii (typical A405=0·69) plants 3 weeks after agroinfiltration with PLRV-GFP (Table 1
). RTPCR analysis and sequencing of the progeny viral RNA from systemically infected leaves detected only virus mutants of PLRV-GFP (Mut-4, Mut-5 and Mut-6) that had lost most of the GFP gene sequence (Fig. 6
).
| Discussion |
|---|
|
|
|---|
The chimeric PLRV-GFP was able not only to replicate and express the GFP, but also to form virus particles in protoplasts, or primarily infected cells, that could be transmitted by aphids. Immunoblot analysis of PLRV-GFP-infected protoplasts using antibodies against the PLRV CP detected two protein products that corresponded to the major CP and the P5GFP fusion of approximately 97 kDa (Fig. 4
, lane 3). Although our attempts to confirm these results using available antibodies against the GFP or P5 were unsuccessful, probably because of low antibody titres and/or the small amounts of the proteins that accumulated, these results indicate that the fusion protein (or at least, most of it) was not cleaved in vivo. Taken together with the ISEM and immunogold labelling data, these observations suggest that the P5 molecules are contained in the capsids of virus particles only (or mostly) in the form of a fusion with GFP. These observations add to earlier findings with other luteoviruses (Wang et al., 1995
; Bruyère et al., 1997
) that a carboxyl-terminal part of P5, which was not expressed in PLRV-GFP, is not essential for the aphid transmission. Moreover, they indicate that the fusion of P5 with GFP does not affect the ability of the aphids to transmit the virus particles, suggesting that GFP does not functionally mask putative P5 domain(s) involved in aphid transmission.
The findings that PLRV-GFP is transmitted by the aphid M. persicae, and that it replicates in primarily inoculated cells and expresses the GFP but cannot spread, show that PLRV-GFP could be used to visualize the cells initially infected during aphid transmission. This approach allowed us to detect the primarily inoculated cells in the vascular tissue (Fig. 2c
) and occasionally elsewhere, for example in trichomes (Fig. 2d
) or epidermal cells (Fig. 2e
). These results provide direct evidence that different types of leaf cells can be inoculated by aphids. However, we cannot rule out completely the possibility that these cells were infected by virus contaminating the aphid stylets rather than by circulating virus particles. Confocal laser scanning microscopy did not allow precise identification of the types of elongated phloem-associated cells (such as bundle sheath, vascular parenchyma, companion cells or sieve elements) that were infected. Nevertheless, these data represent first direct visualization of putative primary infection sites and demonstrate the possibility of studying factors involved in modulating the susceptibility of hosts or the efficacy of aphid vectors.
Aphid transmission and agroinfection experiments showed that, regardless of the mode of virus inoculation, the GFP-tagged PLRV described in this work was unable to spread from initially infected sites. Due to the phloem-limited character of PLRV infection, it was not surprising that PLRV-GFP did not spread from initial infection sites in mesophyll and epidermis. Previously, it was shown that another luteovirus, Tobacco necrotic dwarf virus, was able to replicate in single epidermal cells inoculated mechanically but could not move out of them (Imaizumi & Kubo, 1980
). The restriction of fluorescence to primary infection sites in phloem tissues apparently reflects the inability of the GFP-tagged PLRV to move even in those tissues that are sites of wild-type PLRV infection. It might be suggested that PLRV-GFP was delivered into incompetent phloem-associated cells unable to initiate a systemic infection. However, this is unlikely because the naturally occurring deletion mutants of PLRV-GFP spread systemically from the same primarily infected cells (Fig. 6
, Table 1
). The failure of PLRV-GFP to spread systemically suggests that the movement functions themselves may be diminished. P5 has been shown to play a role in the development of systemic infection (Brault et al., 1995
; Ziegler-Graff et al., 1996
; Chay et al., 1996
), facilitating intercellular luteovirus movement in vascular tissues (Mutterer et al., 1999
). Our results confirm this conclusion and suggest that some putative transport domain(s) in the P5 may be functionally disrupted by the fused GFP. If so, it can be assumed that different functional domains are involved in aphid transmission and systemic spread of PLRV. Another possible explanation is that P5 mediates virus movement indirectly by enhancing the stability of virions (Ziegler-Graff et al., 1996
) and that the P5GFP fusion protein does not possess this stabilizing activity. It is also possible that the increased size or changed secondary structure of the chimeric PLRV-GFP RNA itself inhibits systemic movement of the virus, for example by decreasing the stability of virus particles.
Although replication of the GFP-tagged PLRV was strictly limited to primary infection sites, naturally occurring deletion mutants of PLRV-GFP were detected outside these sites. No deletion mutants were detected in leaf zones (up to 3 cm in diameter) into which the infiltrated agrobacteria had spread, 6 days post-inoculation (Fig. 4
, lane 4), presumably because such mutations were rare and/or mutant sequences present in primary infected cells were in very low concentration. However, once such mutants formed during replication in primarily infected cells, they would probably acquire the ability to move systemically and then would accumulate throughout the plants. Thus, restoration of an ability to move would have an overwhelming selective advantage and any such mutants would rapidly out-compete the non-moving PLRV-GFP. All sequenced mutants lacked a significant part of or all of the GFP gene, and some also lacked part of ORF5 indicating that the deleted sequences (Fig. 6
) are not essential for the systemic movement of PLRV. With other systems, it has also been found that some foreign sequences tend to be eliminated from virus genomes by deletion (Chapman et al., 1992
; Culver et al., 1996
). Interestingly, infections with recombinant Tobacco etch virus (TEV) expressing foreign genes as fusions with nucleotide sequences encoding helper component-proteinase (HC-Pro) resulted in appearance of spontaneous deletion mutants (Dolja et al., 1993
, 1997
) which were similar to the PLRV-GFP mutants described in this work. Some of the TEV mutants lacked not only foreign nucleotide sequences but also parts of HC-Pro gene.
| Acknowledgments |
|---|
| Footnotes |
|---|
c On sabbatical leave from Agricultural Research Service, USDA and Department of Plant Pathology, Cornell University, Ithaca, NY 14853, USA. ![]()
| References |
|---|
|
|
|---|
Bahner, I., Lamb, J., Mayo, M. A. & Hay, R. T. (1990). Expression of the genome of potato leafroll virus: readthrough of the coat protein termination codon.Journal of General Virology 71, 2251-2256.
Barker, H. & Solomon, R. M. (1980). Evidence of simple genetic control in potato of ability to restrict potato leafroll virus concentrations in leaves.Theoretical and Applied Genetics 80, 192-199.
Baulcombe, D. C., Chapman, S. & Santa Cruz, S. (1995). Jellyfish green fluorescent protein as a reporter for virus infections.Plant Journal 7, 1045-1053.[Medline]
Brault, V., Van den Heuvel, J. M., Verbeek, M., Ziegler-Graff, V., Ruetenauer, A., Herrbach, E., Garaud, J. C., Guilley, H., Richards, K. & Jonard, G. (1995). Aphid transmission of beet western yellows luteovirus requires the minor capsid read-through protein P74.EMBO Journal 14, 650-659.[Medline]
Bruyère, A. V., Brault, V., Ziegler-Graff, V., Simonis, M. T., Van den Huevel, J. F. J. M., Richards, K., Guilley, H., Jonard, G. & Herrbach, E. (1997). Effects of mutations in the beet western yellows virus readthrough protein on its expression and packaging and on virus accumulation, symptoms, and aphid transmission.Virology 230, 323-334.[Medline]
Chapman, S., Kavanagh, T. & Baulcombe, D. C. (1992). Potato virus X as a vector for gene expression in plants.Plant Journal 2, 549-557.[Medline]
Chay, C. A., Gunasinge, U. B., Dinesh-Kumar, S. P., Miller, W. A. & Gray, S. M. (1996). Aphid transmission and systemic plant infection determinants of barley yellow dwarf luteovirus-PAV are contained in the coat protein readthrough domain and 17-kDa protein, respectively.Virology 219, 57-65.[Medline]
Commandeur, U. & Martin, R. (1993). Investigations into the molecular biology of potato leafroll luteovirus by means of agroinfection.Phytopathology 83, 1426.
Culver, J. N. (1996). Tobamovirus cross protection using a potexvirus vector.Virology 226, 228-235.[Medline]
Dolja, V. V., Herndon, K. L., Pirone, T. P. & Carrington, J. C. (1993). Spontaneous mutagenesis of a plant potyvirus genome after insertion of a foreign gene.Journal of Virology 67, 5968-5975.
Dolja, V. V., Hong, J., Keller, K. E., Martin, R. R. & Peremyslov, V. V. (1997). Suppression of potyvirus infection by coexpressed closterovirus protein.Virology 234, 243-252.[Medline]
English, J. J., Davenport, G. F., Elmayan, T., Vaucheret, H. & Baulcombe, D. C. (1997). Requirement of sense transcription for homology-dependent virus resistance and trans-inactivation.Plant Journal 12, 597-603.
Franco-Lara, L. F., McGeachy, K. D., Commandeur, U., Martin, R. R., Mayo, M. A. & Barker, H. (1999). Transformation of tobacco and potato with cDNA encoding the full-length genome of Potato leafroll virus: Evidence for a novel virus distribution and host effects on virus multiplication.Journal of General Virology 80, 2813-2822.
Gal-On, A., Kaplan, I. B., Roossink, M. J. & Palukaitis, P. (1994). The kinetics of infection of zucchini squash by cucumber mosaic virus indicate a function of RNA1 in virus movement.Virology 205, 280-289.[Medline]
Gildow, F. E. (1999). Luteovirus transmission and mechanisms regulating vector-specificity. In The Luteoviridae, pp. 88-112. Edited by H. G. Smith & H. Barker. Wallingford: CAB International.
Gildow, F. E., Reavy, B., Mayo, M. A., Woodford, T. & Duncan, G. H. (1997). Potato leafroll virus-like particles lacking readthrough protein are transmitted by Myzus persicae.Phytopathology 87, 33.[Medline]
Imaizumi, S. & Kubo, S. (1980). Detection of tobacco necrotic dwarf virus antigen in plant tissues by fluorescent antibody staining.Annals of the Phytopathological Society of Japan 46, 54-56.
Jolly, C. A. & Mayo, M. A. (1994). Changes in the amino acid sequence of the coat protein readthrough domain of potato leafroll luteovirus affect the formation of an epitope and aphid transmission.Virology 201, 182-185.[Medline]
Leiser, R.-M., Ziegler-Graff, V., Reutenauer, A., Herrbach, E., Lemaire, O., Guilley, H., Richard, K. & Jonard, G. (1992). Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus.Proceedings of the National Academy of Sciences, USA 89, 9136-9140.
Mayo, M. A. & Ziegler-Graff, V. (1996). Molecular biology of luteoviruses.Advances in Virus Research 46, 416-460.
Mutterer, J. D., Stussi-Garaud, C., Michler, P., Richards, K. E., Jonard, G. & Ziegler-Graff, V. (1999). Role of the beet western yellows virus readthrough protein in virus movement in Nicotiana clevelandii.Journal of General Virology 80, 2771-2778.
Oparka, K. J., Roberts, A. G., Prior, D. A. M., Chapman, S., Baulcombe, D. C. & Santa Cruz, S. (1995). Imaging the green fluorescent protein in plants viruses carry the torch.Protoplasma 189, 131-141.
Oparka, K. J., Boevink, P. & Santa Cruz, S. (1996). Studying of the movement of plant viruses using green fluorescent protein.Trends in Plant Science 1, 412-417.
Pereira, L. G., Torrance, L., Roberts, I. M. & Harrison, B. D. (1994). Antigenic structure of the coat protein of potato mop-top furovirus.Virology 203, 277-285.[Medline]
Power, J. B. & Chapman, J. V. (1985). Isolation, culture and genetic manipulation of plant protoplasts. In Plant Cell Culture, pp. 37-66. Edited by R. A. Dixon. Oxford: ICR Press.
Roberts, I. M. (1986). Immunoelectron microscopy of extracts of virus-infected plants, pp. 293357. In Electron Microscopy of Proteins. Edited by J. R. Harris & R. W. Horne. San Diego: Academic Press.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Tacke, E., Schmitz, J., Prüfer, D. & Rohde, W. (1993). Mutational analysis of the nucleic acid-binding 17 kDa phosphoprotein of potato leafroll luteovirus identifies an amphipatic
-helix as the domain for protein-protein interactions.Virology 197, 274-282.[Medline]
Van den Heuvel, J. F. J. M., Bruyere, A., Hogenhout, S. A., Ziegler-Graff, V., Brault, V., Verbeek, M., Van Der Wilk, F. & Richards, K. (1997). The N-terminal region of the luteovirus readthrough domain determines virus binding to Buchnera GroEL and is essential for virus persistence in the aphid.Journal of Virology 71, 7258-7265.[Abstract]
Wang, J. Y., Chay, C. A., Gildow, F. E. & Gray, S. M. (1995). Readthrough protein associated with virions of barley yellow dwarf luteovirus and its potential role in regulating the efficiency of aphid transmission.Virology 206, 954-962.[Medline]
Ziegler-Graff, V., Brault, V., Mutterer, D., Simonis, M.-T., Herrbach, E., Guilley, H., Richards, K. E. & Jonard, G. (1996). The coat protein of beet western yellows luteovirus is essential for systemic infection but the viral gene products P29 and P19 are dispensable for systemic infection and aphid transmission.Molecular PlantMicrobe Interactions 9, 501-510.
Received 8 October 1999;
accepted 19 November 1999.
This article has been cited by other articles:
![]() |
K. A. Peter, F. Gildow, P. Palukaitis, and S. M. Gray The C Terminus of the Polerovirus P5 Readthrough Domain Limits Virus Infection to the Phloem J. Virol., June 1, 2009; 83(11): 5419 - 5429. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. B. Kaplan, L. Lee, D. R. Ripoll, P. Palukaitis, F. Gildow, and S. M. Gray Point mutations in the potato leafroll virus major capsid protein alter virion stability and aphid transmission J. Gen. Virol., June 1, 2007; 88(6): 1821 - 1830. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Stephan and E. Maiss Biological properties of Beet mild yellowing virus derived from a full-length cDNA clone J. Gen. Virol., February 1, 2006; 87(2): 445 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Haupt, T. Stroganova, E. Ryabov, S. H. Kim, G. Fraser, G. Duncan, M. A. Mayo, H. Barker, and M. Taliansky Nucleolar localization of potato leafroll virus capsid proteins J. Gen. Virol., October 1, 2005; 86(10): 2891 - 2896. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lee, I. B. Kaplan, D. R. Ripoll, D. Liang, P. Palukaitis, and S. M. Gray A Surface Loop of the Potato Leafroll Virus Coat Protein Is Involved in Virion Assembly, Systemic Movement, and Aphid Transmission J. Virol., January 15, 2005; 79(2): 1207 - 1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mayo, E. Ryabov, G. Fraser, and M. Taliansky Mechanical transmission of Potato leafroll virus J. Gen. Virol., November 1, 2000; 81(11): 2791 - 2795. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |