|
|
||||||||
Animal: RNA Viruses |
Laboratoire de Virologie Moléculaire, Tropicale et Transfusionnelle, Unité des Virus Emergents, Faculté de Médecine de Marseille, Université de la Méditerranée, 27 Boulevard Jean Moulin, 13385 Marseille cedex 05, France1
National Environment Research Council Institute of Virology and Environmental Microbiology, Oxford, UK2
Author for correspondence: Xavier de Lamballerie. Fax +334 91 32 44 95. e-mail xndl-virophdm{at}mail.gulliver.fr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The major factors that limit the quality of phylogenetic analysis with related but widely divergent viruses are the amount of genetic information obtained for each virus, the suitability of the genomic region selected for analysis and the availability of appropriate analytical methods. In the present phylogenetic study of the genus Flavivirus, we have attempted to overcome some of these limiting factors by determining the complete coding and polyprotein sequences of two representative NKV flaviviruses, Rio Bravo virus (RBV) and Apoi virus (APOIV). RBV (also known as US bat salivary gland virus or California bat salivary gland virus) was isolated from the salivary glands of Tadarida brasiliensis mexicana bats captured in California, New Mexico, Texas, USA and Sonora state, Mexico (Burns et al., 1957
; Johnson, 1957
; Constantine & Woodall, 1964
; Sulkin et al., 1966
; Karabatsos, 1995
). Later, the virus was isolated from Eptesicus fuscus and Molossus ater bats in California (Karabatsos, 1995
) and Trinidad (Price, 1978
), respectively. RBV establishes a chronic infection in bats (Constantine & Woodall, 1964
; Baer & Woodall, 1966
) and is supposed to be transmitted by some form of salivary contact (Price, 1978
). Seven cases of laboratory infection have been reported in man [probably implying aerosol transmission (Sulkin et al., 1962
, cited by Le Lay-Rogues & Chastel, 1986
; Office of Health and Safety, Centers for Disease Control and Prevention, 1997
)]. RBV was classified as a flavivirus on the basis of its biochemical and biophysical characteristics (Hendricks et al., 1988
) and on its serological reactivity to other members in this genus (de Madrid et al., 1974
; Varelas-Wesley & Calisher, 1982
; Gould et al., 1985
; Calisher et al., 1989
). Molecular evidence that RBV is a member of the genus Flavivirus was provided by genetic analysis of the partial polymerase gene sequence (Kuno et al., 1998
).
APOIV has been isolated in Japan from the spleen of apparently healthy rodents (Apodemus speciosus and Apodemus argentosus hokkaidi) (Karabatsos, 1995
). The basis for its classification as a flavivirus is the same as that for RBV. In several serological studies, RBV and APOIV were reported to be closely related (Varelas-Wesley & Calisher, 1982
).
We have also completed the sequence of St Louis encephalitis virus (SLEV), a major human pathogen, the primary transmission cycle of which involves Culex spp. and birds. The role other vectors from which the virus has been isolated, e.g. Aedes spp. (Karabatsos, 1995
; Monath & Tsai, 1987
) and Dermacentor variabilis ticks (McLean et al., 1985
), in virus transmission is still debated. SLEV has been isolated from a large variety of wild vertebrate species including birds, rodents and bats (Allen et al., 1970
; Sulkin & Allen, 1974
; Herbold et al., 1983
). It belongs to the Japanese encephalitis serogroup (Calisher et al., 1989
) and this is also supported by the results of molecular analyses in the envelope and NS5 genes (Marin et al., 1995
; Kuno et al., 1998
).
These molecular data, combined with complete ORF sequences from databases, provided the opportunity for a more robust analysis of the genetic relationships between flaviviruses within the three recognized groups, i.e. mosquito-borne, tick-borne and NKV. The phylogenetic trees were then compared with trees based on flavivirus sequences from specified subgenomic regions.
| Methods |
|---|
|
|
|---|
Virus strains.
Preparation of viral RNAs and cDNAs.
RNA was extracted from the infected cells for SLEV, and from the supernatant medium for RBV and APOIV, using a guanidinium thiocyanate-derived method (RNA Now; Ozyme). The RNA was reverse transcribed using random hexaprimers and MuMLV reverse transcriptase (both from Boehringer Mannheim) under standard conditions, in a final volume of 20 µl.
Genomic amplification.
Three sets of degenerate primers were designed in conserved regions of the viral genomes, using sequences from databases. The first set of primers [Env-S (sense) and Env-R (reverse)] was designed from the alignment of the envelope gene sequence of tick-borne viruses. The second set [NS3-S (sense) and NS3-R (reverse)] was designed from the alignment of the flavivirus NS3 gene sequence. The third set was designed from the 5' part of the NS5 gene [8079-S (sense) and MMG-R (reverse)]. These different degenerate primers were used in combination with specific primers designed either from the sequencing of our PCR products or from the partial NS5 sequences reported by Kuno et al. (1998)
as indicated in Table 1
.
|
|
Cloning and sequence determination of PCR products.In the case of RBV and APOIV, verifications of the sequences obtained from viral clones were made by direct sequencing of overlapping PCR products in the envelope, NS3 and NS5 regions. In the E gene, two PCR products were obtained using specific primers [TGCATCGCGGCTCTGATACG (sense) and GTATGTGTCTAGTGCGCATCC (reverse) for RBV and ATTGTGACCTTGATTGTGGC (sense) and TCCCACATCAATCATACATCC (reverse) for APOIV] in combination with degenerate primers A and B. In the NS3, two PCR products were obtained using specific primers [ATGCTTGGAATCAAAAAGTG (sense) and TTTTTGGTACATCAGTCTGGG (reverse) for RBV and ATCTTAGCCCTCAGACAGTG (sense) and CCCTTCATAGAGAAGCTGAAG (reverse) for APOIV] in combination with degenerate primers E and F. In the NS5, PCR products obtained with primer sets G and H on the one hand and 8 and 10 on the other were also directly sequenced on both strands.
Other sequences used.
Full-length coding sequences of the following viruses were retrieved from databases [abbreviations (used in Fig. 3
) and GenBank accession numbers are in parentheses]: dengue 1 (DEN1, M87512); dengue 2 (DEN2, AF038403); dengue 3 (DEN3, M93130); dengue 4 (DEN4, M14931); Kunjin (KUN, D00246); Japanese encephalitis (JE, M18370); mosquito cell fusing agent (MCFA, M91671); tick-borne encephalitis (TBE) virus strains Neudoerfl (NEU, U27495) and Hypr (HYPR, U39392); louping ill (LI, Y07863); Langat (LGT, M73835 and M86650); Powassan (POW, L06436); West Nile (WN, M12294); yellow fever (YF, X03700). For Murray Valley encephalitis (MVE, GNWVMV) virus only the amino acid sequence was available. Partial sequences of RBV, APOIV and SLEV were also used (see Table 2
).
|
|
Genetic analysis.
Phylogenetic analyses were performed with the help of the software program MEGA 1.01 (Kumar et al., 1993
). The JukesCantor and gamma distance (a=2) algorithms were used for the determination of genetic distances between nucleotide and amino acid sequences, respectively. Trees were constructed using the neighbour-joining method and either complete or partial sequences (in particular partial amino acid sequences corresponding to the different genes). All trees were constructed with and without the corresponding MCFA sequence. The robustness of the resulting groupings was tested by 500 bootstrap replications and trees were edited with the help of the Tree macro program (Charrel et al., 1999
). In addition, pairwise genetic distances (p-distance) between virus isolates were calculated.
| Results |
|---|
|
|
|---|
Comparison of sequences obtained by direct sequencing of PCR products (around 5500 nt for each viral genome or 50% of the complete ORF sequence) did not reveal any difference with the sequence obtained from virus clones.
The RBV ORF sequence was 10140 nt long (including the initial ATG and the terminal stop codon), and encoded a 3379 aa polyprotein. For APOIV, the complete ORF sequence was 10116 nt long, encoding a 3371 aa polyprotein. Based on similarity comparisons with the complete ORF sequences of other flaviviruses (Chambers et al., 1990
), the probable sites of cleavage of the viral polyproteins were determined and are presented in Table 3(a)
. The sizes of individual proteins arising from post-translational processing of the polyprotein are presented in Table 3(b)
.
|
Genetic analysis
Pairwise distances based on complete ORF sequences between the different virus isolates are presented in Fig. 2
. Different cut-off values were tested for the grouping of virus isolates. Values ranging from 0·328 to 0·471 for amino acid alignments (0·348 to 0·419 for nucleotide alignments) distinguished the arthropod-borne viruses according to their recognized serogroups (Calisher et al., 1989
), i.e. the tick-borne group, the Japanese encephalitis group, the dengue group and the yellow fever group. On this basis, and in agreement with the analysis of frequency distribution histograms (data not shown), RBV and APOIV could be assigned to two distinct NKV groups, since the genetic distance between the amino acid sequences of these viruses was 0·458 (0·392 for nucleotide alignments). This is shown in the top part of Fig. 2
where a cut-off value of 0·450 for amino acid alignments (0·380 for nucleotide alignments) was used. The pairwise genetic distances between viruses of each group (<0·5) are within the tolerable limits for phylogenetic analysis. In contrast, the distances between groups were often above 0·6 (0·7 for MCFA), thereby potentially reducing the bootstrap values of the phylogenetic studies. It is also worth noting that, on the basis of their genetic distances, RBV and APOIV were more closely related to the tick-borne than the mosquito-borne viruses.
|
Phylogenetic trees based on either complete genes or partial gene sequences, were also constructed. Alignments produced using standard programs and manually modified amino acid alignments produced similar results. In the majority of cases, trees resembling either the NS3 or NS5 tree, were observed as summarized in Table 4
, which presents the data obtained for a variety of trees constructed using different criteria. However, when amino acid sequences of either the E gene alone, or the entire structural region of the genome were used, and MCFA virus was included, a branching pattern was produced which was very different and not consistent with the serological relationships of the viruses. Moreover, if complete nucleotide sequences of the NS5 gene were used for the analysis with an unrooted tree, the branching pattern at the deepest node showed three equivalent branches corresponding to the tick-borne, mosquito-borne and NKV groups.
|
| Discussion |
|---|
|
|
|---|
The sequence determination of RBV and APOIV showed that the polyproteins of these viruses were the smallest described to date within the genus Flavivirus. In particular, the envelope and NS4A genes appeared to be markedly shorter than the corresponding genes of arthropod-borne flaviviruses. As expected, the complete SLEV polyprotein was very similar in size to those of other members of the Japanese encephalitis serogroup.
Within the viral polyproteins, proteolytic cleavage sites for the viral serine protease appeared to be highly conserved among all flaviviruses studied, including NKV viruses. The prM cleavage site sequence (Arg-X-Arg/Lys-Arg) (Rice, 1996
) was also conserved in all genomes studied. This cleavage may be mediated by the host enzyme furin or an enzyme of similar specificity (Stadler et al., 1997
; Steiner et al., 1992
). The putative sites of other proteolytic cleavages, supposed to be mediated by host signalases, were less conserved, except for the 2K/NS4B cleavage site. They were only determined on the basis of sequence alignment with previously determined cleavage site sequences (Chambers, 1990
).
The study of genetic distances between the full-length coding sequences or polyproteins globally confirmed previous groupings made on the basis of antigenic relationship or genetic analysis of envelope or NS5 sequences. The use of cut-off values discriminated the major serogroups (tick-borne, yellow fever, dengue and Japanese encephalitis groups) and indicated that RBV and APOIV virus do not belong to either of these groups. Using such cut-off values (0·450 and 0·380 for amino acid and nucleotide sequences, respectively), RBV and APOIV could be assigned to two distinct phylogenetic groups. This contradicts previous serological data which implied that they belong to the same antigenic complex (Calisher et al., 1989
). These findings suggest the existence of an important genetic diversity between NKV isolates. This was supported by the observation that the genetic distance between RBV and APOIV was comparable to that between dengue and Japanese encephalitis virus.
The genetic distances between the different groups are important, and with the exception of dengue and Japanese encephalitis groups on the one hand, and RBV and APOIV on the other, they were higher than 50%. This is not a favourable situation to analyse the phylogenetic relationships between these groups, and it was therefore not surprising to observe different branching patterns, depending on the genomic region analysed or the methodology used. The most frequently observed phylogenetic tree structure was that typically obtained using alignments which employed sequence data from the NS3 region. This supports the notion of a common ancestor for the tick-borne and NKV viruses, which is in agreement with the fact that, based on genetic distances, tick-borne viruses were found to be more closely related to RBV and APOIV viruses than mosquito-borne viruses. It is also worth noting that some members of the NKV group, such as Phnom-Penh bat virus and Carey Island virus, are serologically related to tick-borne viruses (Calisher et al., 1989
). Finally, it is interesting to note that a typical Asian tick-borne encephalitis virus strain was recently isolated from Apodemus speciosus (Takeda et al., 1999
), the natural host of APOIV.
An alternative phylogenetic tree structure was observed from sequence data based on the NS5 region, and is more typical of that reported by Kuno et al. (1998)
. In this branching pattern, the NKV group roots the tick- and mosquito-borne groups. The third phylogenetic branching pattern implied a single ancestor for the mosquito-borne, tick-borne and NKV groups. At this stage, despite the high bootstrap values, it is not possible to determine with certainty which profile is the correct one.
In attempts to resolve these difficulties, the phylogeny between complete ORF sequences was tested using different methods and, in all cases except one, the NS3 branching pattern was obtained, but the trees were supported by a bootstrap value which was less than 65%. Thus, a definitive conclusion cannot be made, but the results suggest that the NS3 region is appropriate for comparing the phylogenetic relationships of the flaviviruses. The presence of MCFA in the sequence alignments modified the branching pattern in some of the trees. This is presumably because the genetic distance between MCFA and the other viruses is very high (above 70%). It is therefore difficult to align this virus with the other flaviviruses, except in the NS3 and NS5 genes where there are several highly conserved regions. This was particularly evident when the envelope region was studied and MCFA virus was used to root the tree. The addition of RBV and APOIV sequences in the amino acid alignments resulted in an obviously incorrect phylogenetic tree. In contrast, removal of MCFA as a root created trees that closely resembled those constructed with sequence data from the NS3 gene. It is presumed that such anomalies will become less conspicuous as more sequence data of NKV viruses accumulate.
In contrast with the situation described above, genetic distances within each group, and between the dengue and Japanese encephalitis groups, were less than 50%. As a result of this, the associated branching patterns were very reproducible in all the subgenomic regions studied and were similar to the previously described patterns in the envelope and NS5 regions (Marin et al., 1995
; Kuno et al., 1998
).
Finally, although there is clearly a close relationship between the main vectors of virus transmission and the phylogenetic group to which the viruses are assigned, many flaviviruses have been isolated from arthropods other than the recognized major vector. This is the case for yellow fever virus, which is normally associated with Aedes spp. but has also been isolated from ticks (Monath & Heinz, 1996
); for Saboya virus, which has been isolated from Anopheles and from ticks (Butenko, 1996
); for SLEV and West Nile virus, which are normally associated with Culex spp. but have also occasionally been isolated from Aedes spp. and ticks (Monath & Tsai, 1987
). This broad invertebrate host range may reflect the progressive adaptation of viruses to their main vector, but also the conservation for some species of genetic characters inherited from a common ancestor and permitting the infection of a large range of vectors and hosts.
| References |
|---|
|
|
|---|
Baer, G. M. & Woodall, D. F. (1966). Bat salivary gland virus carrier state in a naturally infected Mexican free-tail bat.American Journal of Tropical Medicine and Hygiene 15, 769-771.
Burns, K. F., Farmacci, C. J. & Shelton, D. F. (1957). Virus of bats antigenically related to group B arthropod-borne encephalitis viruses. American Journal of Clinical Pathology 27, 257-264.[Medline]
Butenko, A. M. (1996). Arbovirus circulation in the Republic of Guinea. Meditsinskaia Parazitologiia I Parazitarnye Bolezni 2, 40-45.
Calisher, C. H., Karabatsos, N., Dalrymple, J. M., Shope, R. E., Porterfield, J. S., Westaway, E. G. & Brandt, W. E. (1989). Antigenic relationships between flaviviruses as determined by cross-neutralization tests with polyclonal antisera. Journal of General Virology 70, 37-43.
Cammisa-Parks, H., Cisar, L. A., Kane, A. & Stollar, V. (1992). The complete nucleotide sequence of cell fusing agent (CFA): homology between the nonstructural proteins encoded by CFA and the nonstructural proteins encoded by arthropod-borne flaviviruses. Virology 189, 511-524.[Medline]
Chambers, T. J., Hahn, C. S., Galler, R. & Rice, C. M. (1990). Flavivirus genome organization, expression, and replication. Annual Review of Microbiology 44, 649-688.[Medline]
Charrel, R. N., de Micco, P. & de Lamballerie, X. (1999). A convenient method to improve the graphical quality of phylogenetic trees computed by the MEGA program. BioTechniques 27, 702-704.[Medline]
Constantine, D. G. & Woodall, D. F. (1964). Latent infection of Rio Bravo virus in salivary glands of bats. Public Health Reports 79, 1033-1039.[Medline]
de Madrid, A. T. & Porterfield, J. S. (1974). The flaviviruses (group B arboviruses): a cross-neutralization study. Journal of General Virology 23, 91-96.
Gould, E. A., Buckley, A., Cammack, N., Barrett, A. D. T., Clegg, J. C. S., Ishak, R. & Varma, M. G. R. (1985). Examination of the immunological relationships between flaviviruses using yellow fever virus monoclonal antibodies. Journal of General Virology 66, 1369-1382.
Hendricks, D. A., Patick, A. K., Petti, L. M. & Hall, A. J. (1988). Biochemical and biophysical characteristics of Rio Bravo virus (Flaviviridae). Journal of General Virology 69, 337-347.
Herbold, J. R., Heuschele, W. P., Berry, R. L. & Parsons, M. A. (1983). Reservoir of St. Louis encephalitis virus in Ohio bats. American Journal of Veterinary Research 44, 1889-1893.[Medline]
Johnson, H. N. (1957). The Rio Bravo virus: virus identified with group B arthropod-borne viruses by hemagglutinationinhibition and complement-fixation tests.Proceedings of the Ninth Pacific Science Congress 17, 39.
Karabatsos, N. (1995). International Catalogue of Arboviruses including Certain Other Viruses of Vertebrates. San Antonio/Fort Collins: American Society of Tropical Medicine and Hygiene.
Kumar, S., Tamura, K. & Nei, M. (1993). Molecular Evolutionary Genetics Analysis, version 1.01. Pennsylvania State University.
Kuno, G., Chang, G. J., Tsuchiya, K. R., Karabatsos, N. & Cropp, C. B. (1998). Phylogeny of the genus Flavivirus. Journal of Virology 72, 73-83.
Le Lay-Rogues, G. & Chastel, C. (1986). Chiroptera viruses transmitted or not transmitted by arthropods. Medicine Tropicale 46, 389-395.
McLean, R. G., Francy, D. B., Monath, T. P., Calisher, C. H. & Trent, D. W. (1985). Isolation of St. Louis encephalitis virus from adult Dermacentor variabilis (Acari: Ixodidae). Journal of Medical Entomology 22, 232-233.[Medline]
Marin, M. S., Zanotto, P. M., Gritsun, T. S. & Gould, E. A. (1995). Phylogeny of TYU, SRE, and CFA virus: different evolutionary rates in the genus Flavivirus. Virology 206, 1133-1139.[Medline]
Monath, T. P. & Tsai, T. F. (1987). St. Louis encephalitis: lessons from the last decade. American Journal of Tropical Medicine and Hygiene 37, 40-59.
Monath, T. P. & Heinz, F. X. (1996). Flaviviruses. In Fields Virology, pp. 961-1034. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Office of Health and Safety, Centers for Disease Control and Prevention (1997). Biosafety in Microbiological and Biomedical Laboratories, Section VII. http://www.cdc.gov/od/ohs/biosfty/bmbl/sect7f.htm.
Price, J. L. (1978). Isolation of Rio Bravo and a hitherto undescribed agent, Tamana bat virus, from insectivorous bats in Trinidad, with serological evidence of infection in bats and man. American Journal of Tropical Medicine and Hygiene 27, 153-161.
Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology, pp. 931-959. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Stadler, K., Allison, S. L., Schalich, J. & Heinz, F. X. (1997). Proteolytic activation of tick-borne encephalitis virus by furin. Journal of Virology 71, 8475-8481.
Steiner, D. F., Smeekens, S. P., Ohagie, S. & Chan, S. J. (1992). The new enzymology of precursor processing endoproteases. Journal of Biological Chemistry 267, 23435-23438.
Sulkin, S. E. & Allen, R. (1974). Virus infections in bats. Monographs in Virology 8, 1-103.[Medline]
Sulkin, S. E., Burns, K. F., Shelton, D. F. & Wallis, S. (1962). Bat salivary gland virus: infections of man and monkey. Texas Reports on Biology and Medicine 20, 113-127.[Medline]
Sulkin, S. E., Sims, R. A. & Allen, R. (1966). Isolation of St. Louis encephalitis virus from bats (Tadarida b. mexicana) in Texas.Science 152, 223-225.
Takeda, T., Ito, T., Osada, M., Takahashi, K. & Takashima, I. (1999). Isolation of tick-borne encephalitis virus from wild rodents and a seroepizootiologic survey in Hokkaido, Japan. American Journal of Tropical Medicine and Hygiene 60, 287-291.[Abstract]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Varelas-Wesley, I. & Calisher, C. H. (1982). Antigenic relationships of flaviviruses with undetermined arthropod-borne status. American Journal of Tropical Medicine and Hygiene 31, 1273-84.
Weiller, G. F. (1999). TransAlign, version 1.0. Research School of Biological Sciences, Canberra, Australia.
Zanotto, P. M., Gould, E. A., Gao, G. F., Harvey, P. H. & Holmes, E. C. (1996). Population dynamics of flaviviruses revealed by molecular phylogenies. Proceedings of the National Academy of Sciences, USA 93, 548-553.
Received 10 August 1999;
accepted 15 November 1999.
This article has been cited by other articles:
![]() |
G. Grard, G. Moureau, R. N. Charrel, E. C. Holmes, E. A. Gould, and X. de Lamballerie Genomics and evolution of Aedes-borne flaviviruses J. Gen. Virol., January 1, 2010; 91(1): 87 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Junglen, A. Kopp, A. Kurth, G. Pauli, H. Ellerbrok, and F. H. Leendertz A New Flavivirus and a New Vector: Characterization of a Novel Flavivirus Isolated from Uranotaenia Mosquitoes from a Tropical Rain Forest J. Virol., May 1, 2009; 83(9): 4462 - 4468. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zuo, O. W. Liew, G. Chen, P. C. J. Chong, S. H. Lee, K. Chen, H. Jiang, C. M. Puah, and W. Zhu Mechanism of NS2B-Mediated Activation of NS3pro in Dengue Virus: Molecular Dynamics Simulations and Bioassays J. Virol., January 15, 2009; 83(2): 1060 - 1070. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Farfan-Ale, M. A. Lorono-Pino, J. E. Garcia-Rejon, E. Hovav, A. M. Powers, M. Lin, K. S. Dorman, K. B. Platt, L. C. Bartholomay, V. Soto, et al. Detection of RNA from a Novel West Nile-like Virus and High Prevalence of an Insect-specific Flavivirus in Mosquitoes in the Yucatan Peninsula of Mexico Am J Trop Med Hyg, January 1, 2009; 80(1): 85 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. A. Medeiros, M. R. T. Nunes, P. F. C. Vasconcelos, G.-J. J. Chang, and G. Kuno Complete genome characterization of Rocio virus (Flavivirus: Flaviviridae), a Brazilian flavivirus isolated from a fatal case of encephalitis during an epidemic in Sao Paulo state J. Gen. Virol., August 1, 2007; 88(8): 2237 - 2246. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Grard, J.-J. Lemasson, M. Sylla, A. Dubot, S. Cook, J.-F. Molez, X. Pourrut, R. Charrel, J.-P. Gonzalez, U. Munderloh, et al. Ngoye virus: a novel evolutionary lineage within the genus Flavivirus. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3273 - 3277. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cook, S. N. Bennett, E. C. Holmes, R. De Chesse, G. Moureau, and X. de Lamballerie Isolation of a new strain of the flavivirus cell fusing agent virus in a natural mosquito population from Puerto Rico. J. Gen. Virol., April 1, 2006; 87(Pt 4): 735 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Niyomrattanakit, P. Winoyanuwattikun, S. Chanprapaph, C. Angsuthanasombat, S. Panyim, and G. Katzenmeier Identification of Residues in the Dengue Virus Type 2 NS2B Cofactor That Are Critical for NS3 Protease Activation J. Virol., December 15, 2004; 78(24): 13708 - 13716. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Mutebi, R. C. A. Rijnbrand, H. Wang, K. D. Ryman, E. Wang, L. D. Fulop, R. Titball, and A. D. T. Barrett Genetic Relationships and Evolution of Genotypes of Yellow Fever Virus and Other Members of the Yellow Fever Virus Group within the Flavivirus Genus Based on the 3' Noncoding Region J. Virol., September 15, 2004; 78(18): 9652 - 9665. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kumar, P. Sulochana, G. Nirmala, M. Haridattatreya, and V. Satchidanandam Conserved amino acids 193-324 of non-structural protein 3 are a dominant source of peptide determinants for CD4+ and CD8+ T cells in a healthy Japanese encephalitis virus-endemic cohort J. Gen. Virol., May 1, 2004; 85(5): 1131 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. de Lamballerie, S. Crochu, F. Billoir, J. Neyts, P. de Micco, E. C. Holmes, and E. A. Gould Genome sequence analysis of Tamana bat virus and its relationship with the genus Flavivirus J. Gen. Virol., October 1, 2002; 83(10): 2443 - 2454. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Charlier, P. Leyssen, C. W. A. Pleij, P. Lemey, F. Billoir, K. Van Laethem, A.-M. Vandamme, E. De Clercq, X. de Lamballerie, and J. Neyts Complete genome sequence of Montana Myotis leukoencephalitis virus, phylogenetic analysis and comparative study of the 3' untranslated region of flaviviruses with no known vector J. Gen. Virol., August 1, 2002; 83(8): 1875 - 1885. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Gaunt, A. A. Sall, X. d. Lamballerie, A. K. I. Falconar, T. I. Dzhivanian, and E. A. Gould Phylogenetic relationships of flaviviruses correlate with their epidemiology, disease association and biogeography J. Gen. Virol., August 1, 2001; 82(8): 1867 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Attoui, J. M. Stirling, U. G. Munderloh, F. Billoir, S. M. Brookes, J. N. Burroughs, P. de Micco, P. P. C. Mertens, and X. de Lamballerie Complete sequence characterization of the genome of the St Croix River virus, a new orbivirus isolated from cells of Ixodes scapularis J. Gen. Virol., April 1, 2001; 82(4): 795 - 804. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |