|
|
||||||||
Animal: DNA Viruses |
Institute of Molecular Pathology, Protein Laboratory, Panum Institute, Blegdamsvej 3C, Bldg 6.2, DK-2200 Copenhagen N, Denmark1
Department of Growth and Reproduction, Rigshospitalet, Copenhagen, Denmark2
Author for correspondence: Bodil Norrild. Fax +45 35 36 01 16. e-mail bono{at}biobase.dk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The E6 protein binds to and degrades the p53 tumour-suppressor protein through a ubiquitin-dependent pathway and, thus, interferes with both cell cycle control and the apoptotic pathway (Scheffner et al., 1990
, 1993
). The E7 protein exhibits multiple functions, such as proteinprotein interactions with retinoblastoma protein (pRb), other pocket proteins and the cyclin-dependent kinase cdk2 (Dyson et al., 1989
, 1992
; Tommasino et al., 1993
) and with proteins regulating transcription, such as the TATA box-binding protein (TBP) (Massimi et al., 1996
; Phillips & Vousden, 1997
) and the AP1 transcription factors (Antinore et al., 1996
). The E7 protein decreases the transcriptional activity of p53 (Massimi et al., 1997
), although p53 accumulates in E7-expressing cells (Jones et al., 1997
).
E7 binding to pRb leads to the release of the transcription factor E2F (Dyson et al., 1989
), which influences the expression of the genes b-myb, smooth-muscle
-actin and p14ARF (Lam et al., 1994
; Morris et al., 1993
; Nishida et al., 1995
; Bates et al., 1998
).
E7 also functions in a pRb/E2F-independent manner, as E7 mutants are defective in binding pRb but retain immortalizing potential in primary human keratinocytes (Edmonds & Vousden, 1989
). Mutations in the N-terminal end, as well as in the zinc-binding cysteine motif in the C-terminal end, of the E7 protein abolished both the immortalizing and transforming properties (Jewers et al., 1992
; Vousden, 1993
). Although the E7 proteins from high-risk and low-risk HPV types are similar, they bind pRb with different affinities, and only the high risk-type E7 causes immortalization and transformation of infected cells (Schmitt et al., 1994
). pRb/E2F-independent transformation by E7 has also only been demonstrated for the high-risk HPV types (Zwerschke et al., 1996
).
To identify genes regulated by E7 protein expression, differential-display (DD) PCR was conducted on cells where the HPV-16 E7 gene was under inducible control regulated by tetracycline (Tet). We show for the first time that the transcription of the cellular genes encoding the calcium-binding protein S100P and the ADP/ATP carrier protein are regulated in an E7 protein-dependent manner.
| Methods |
|---|
|
|
|---|
Cell culture.
Plasmid constructs.
An HPV-16 fragment from positions 505875 of the HPV genome, including the E7 ORF covering positions 562858, was inserted into the Tet-responsive vector pUHD 10-3 (Gossen & Bujard, 1992
) to give the plasmid pUHD/E7. pUHD 15-1 contained the Tet transactivator (Gossen & Bujard, 1992
). pBabe hygro contained the hygromycin phosphotransferase gene under the control of the SV40 promoter (Morgenstern & Land, 1990
).
Transfection.
MCF7Tet cells (106) were resuspended in 50 µl PBS and mixed with 10 µl PBS containing 10 µg pUHD/E7 and 1 µg pBabe hygro DNA. This mixture was incubated for 10 min on ice in a Gene Pulser cuvette (Bio-Rad). The cells were electroporated at 320 V and 25 µF and immediately resuspended in 4 ml pre-heated DMEM supplemented with geneticin and Tet. The medium was changed after 24 h, and the cells were transferred after a further 48 h to 10 cm dishes with DMEM supplemented with geneticin, hygromycin and Tet for the selection of resistant cell clones.
Purification of RNA.
MCF7E7Tet cells were grown in two different batches of serum (A and B). For each batch, a series was made in which Tet was removed from the cells for 0, 24, 48 and 72 h. Total cellular RNA was purified by using Ultraspec (BioTexc) as described by the manufacturer. Contaminating DNA was removed by DNase treatment as described by Jørgensen et al. (1999)
and RNA was quantified by GeneQuant.
Differential-display (DD) RTPCR.
Differential display (Liang & Pardee, 1992
) was performed as described previously (Jørgensen et al., 1999
). In brief, cDNA synthesis was performed on 1 µg total RNA with HT11V, three different primers with the general sequence AAGCTTTTTTTTTTTV, where V is A, C or G, resulting in three cDNA populations. Each reaction was performed at 42 °C for 1 h in 20 µl of 130 mM TrisHCl, pH 8·3, 5 mM MgCl2, 20 mM KCl, 625 µM dNTP, 10 U AMV reverse transcriptase (Stratagene) and 0·5 µg HT11V primer. The reaction was stopped by the addition of 80 µl 0·1% Triton X-100 followed by heating to 95 °C for 1 min and the cDNA samples were stored at -80 °C. An aliquot of 1 µl was used for each competitive PCR.
Competitive PCR was performed by using approximately 100 different random or targetted upstream primers in combination with the three downstream HT11V primers used for cDNA synthesis. Most of the upstream primers applied were 13-mers, each including six or seven G or C residues. The reactions were performed in 10 µl of (final concentrations) 12 mM TrisHCl, pH 8·3, 50 mM KCl, 1·9 mM MgCl2, 0·1% Triton X-100, 0·005% gelatin, 14 µM dNTP, 1 µCi
-35S-dATP ([35S]dATP
S; Amersham Pharmacia Biotech), 10 pmol each of upstream and downstream primers and 1 U AmpliTaq (Perkin-Elmer). The cycle conditions were: one cycle of 2 min at 95 °C; 40 cycles of 30 s at 95 °C, 1 min at 40 °C and 1 min at 72 °C; and one final cycle of 5 min at 72 °C. After PCR, 10 µl loading buffer (8% Ficoll 400, 10 mM EDTA, 10 mM NaOH, 0·1225% bromophenol blue, 0·1225% xylene cyanol in formamide) was added and the samples were denatured for 2 min at 96 °C before they were loaded onto a 5% polyacrylamide sequencing gel.
Reamplification of differentially expressed bands.
Differentially expressed bands were excised from the dried gels and the DNA was recovered by shaking the sample in 50 µl TE buffer (10 mM TrisHCl, pH 7·5, 0·1 mM EDTA) at 95 °C for 15 min. Five µl was used for PCR amplification in a total volume of 27 µl of (final concentrations) 10 mM TrisHCl, pH 8·3, 50 mM KCl, 1·8 mM MgCl2, 0·1% Triton X-100, 0·005% gelatin, 70 µM each of dATP, dCTP, dGTP and dTTP, 2·5 U AmpliTaq (Perkin-Elmer), 10 pmol upstream primer and 10 pmol extended downstream primer (T7HT11V; TAATACGACTCACTATAGGGAAGCTTTTTTTTTTTV). Cycle conditions were as described for competitive PCR above, except that the annealing temperature was 42 °C. Reamplified DDRTPCR fragments were purified from 2% agarose gels. Bands were identified by sequencing the reamplified bands. Sequencing reactions were performed as cycle sequencing (Voss et al., 1997
) by using the ThermoSequenase enzyme (Amersham Pharmacia Biotech) and a T7 promoter-complementary primer (TAATACGACTCACTATAGGGAA) that matches all fragments amplified with the extended T7HT11V primers. Sequencing reactions were performed as described by Amersham Pharmacia Biotech. The sequences were compared with sequences stored in the GenBank and EBI databases by using the FASTA program (UWGCG program package).
Northern blotting.
The hybridization probes were made from the purified differentially displayed fragments (S100P, ADP/ATP carrier protein and
-actin). Random-primed labelling was performed as described by Sambrook et al. (1989)
by using 20100 ng DNA fragment and 0·75 µg of a random 8-mer oligonucleotide. The reaction was performed in 20 µl containing 50 mM TrisHCl, pH 7·5, 5 mM MgCl2, 10 mM
-mercaptoethanol, 250 µM of dCTP, dGTP and dTTP, 4050 µCi [
-32P]dATP (Amersham Pharmacia Biotech) and 7·5 U Klenow enzyme (Amersham Pharmacia Biotech) at room temperature. After 1 h, 80 µl TE buffer (10 mM TrisHCl, pH 7·5, 1 mM EDTA) was added and the samples were extracted once with phenolchloroform, precipitated and dissolved in hybridization buffer. Prehybridization, hybridization and washing were done as described by Sambrook et al. (1989
). The low-stringency wash corresponded to washing at 65 °C in 1xSSC, 0·1% SDS and 0·5 mM EDTA. The high-stringency wash was in 0·1xSSC, 0·1% SDS and 0·5 mM EDTA at 65 °C. The filters were exposed to Kodak Biomax MS film.
Western blot analysis.
Cell extracts were prepared from both MCF7Tet and MCF7E7Tet cells before induction and after 24, 48 or 72 h induction. Total cell lysates were prepared by adding Laemmli sample buffer directly to the cell culture flask and scraping off the cells (Laemmli, 1970
). The samples were loaded on a 15% SDSPAGE gel after boiling for 10 min and transferred to a PVDF membrane by semi-dry electroblotting for 1 h at 15 V. The membranes were incubated in PBS with 0·1% (v/v) Tween and 5% (w/v) skimmed milk for 1 h at room temperature.
Immunodetection of the E7 protein was done by incubation with a 1:50 dilution of mouse anti-E7 monoclonal antibody (MAb) (Triton) followed by a 1:100 dilution of biotinylated anti-mouse immunoglobulin (DAKO). Immunodetection of S100P was done by incubation with a 1:250 dilution of mouse anti-S100P MAb (Transduction Laboratories) followed by a 1:100 dilution of biotinylated anti-mouse immunoglobulin. Both immunoblots were developed by addition of ECL detection reagent (Amersham) according to the instructions given by the manufacturer and exposed to Hyperfilm ECL (Amersham).
| Results |
|---|
|
|
|---|
|
Northern blot analysis of two independent mRNA preparations showed that E7 mRNA was induced to a maximum level after 24 h of induction and confirmed that the E7 gene was under stringent control (Fig. 1c
). The higher molecular mass band that hybridized with the E7 probe under the stringent conditions used was present in both uninduced and induced MCF7E7Tet cells. It represents a cellular protein that was not characterized further. The presence of equivalent quantities of RNA loaded in each lane was controlled by hybridization with an actin probe.
E7 expression regulates the transcription of the S100P and ADP/ATP carrier protein genes
cDNAs identified by DDRTPCR that were down- or up-regulated by E7 protein expression in MCF7E7Tet cells are shown in Fig. 2
. The down-regulated band was sequenced and identified as the S100P gene. An up-regulated band was identified as the ADP/ATP carrier protein gene. Both cDNAs were amplified by PCR with specific primers (S100P, HT11C/GH06; ADP/ATP-carrier protein, HT11C/GH12) and cloned into a pUC19 vector. The cloned cDNAs were used as probes in Northern blot analysis, which confirmed that the mRNA for the S100P protein was down-regulated after 48 h. The gene for the ADP/ATP carrier protein was up-regulated at 24 h, followed by a decrease in the mRNA after 48 h of induction (Fig. 3
). Western blot analysis of 40 µg total protein from cell lysates prepared from MCF7E7Tet cells uninduced and induced for 24 h showed that S100P protein was down-regulated in the E7-expressing cells (Fig. 4
).
|
|
|
| Discussion |
|---|
|
|
|---|
Expression of S100P mRNA was down-regulated by E7 protein induction. S100P belongs to the S100 super-family of calcium-binding proteins. Members of this family have been associated with cell differentiation and malignancy, when the proteins are most often up-regulated (Schäfer & Heizmann, 1996
; Grigorian et al., 1996
), with chemotaxis (Newton & Hogg, 1998
; Jinquan et al., 1996
) and with the cell cytoskeleton and motility (Donato, 1991
). The genes are often clustered on chromosome 1, but S100P was mapped to chromosome 4 by Schäfer et al. (1995)
. The best-characterized S100 gene is A4 (CAPL, mts-1), which is involved in metastasis and cell motility (Grigorian et al., 1996
; Takenaga et al., 1994
). In mammary carcinoma cells, the S100A2 gene (CaN19) is down-regulated (Lee et al., 1992
). These authors observed that the gene was expressed abundantly not only in normal mammary keratinocytes, but also in an HPV-immortalized cell line, which is in contrast to our finding that S100P was down-regulated in cells that produced HPV-16 E7 protein. The biological function and cellular localization of S100P are not known, but the gene was first isolated and cloned from placenta by Becker et al. (1992)
, who expressed S100P as a homodimer. The amino acid sequence of S100P is most closely related to S100 A1 (
) and B (
), whereas S100A2 is less related (Schäfer & Heizmann, 1995; Lee et al., 1992
). The only other reports on S100P describe S100P as being regulated in prostate cancer cells in an androgen-dependent fashion, which needs to be confirmed, and being up-regulated in doxorubicin-resistant colon carcinoma cell lines (Averboukh et al., 1996
; Bertram et al., 1998
).
The importance of the second E7-regulated gene, the ADP/ATP carrier protein gene, for control of cell growth is also unknown. Marzo et al. (1998)
reported that the ADP/ATP carrier protein interacts with Bax and mediates permeabilization of the mitochondria as a first step in the apoptotic pathway. As the S100 proteins have also been described to promote apoptosis (Hu & Van Eldik, 1996
; Mariggió et al., 1994
), the differential regulation of S100P and the ADP/ATP carrier protein could be important for HPV-16 E7 protein-induced cell cycle progression. However, we have not been able to show E7-induced apoptosis by FACS analysis or any changes in the levels of Bax, Bcl-2 or Bcl-x mRNA after MCF7E7Tet induction (data not shown). We are currently looking for biological functions of the S100P protein, and preliminary results have shown that it might be involved in the regulation of cell motility and neurite outgrowth (data not shown). It might also be involved in regulation of protein kinases, in analogy to observations on S100A12 (Heierhorst et al., 1996
), or in intracellular functions related to cell cycle control, as reported for S100A2 (Lee et al., 1992
) and for S100B through binding to p53 (Baudier et al., 1995
).
Genes that have been described previously as regulated by HPV-16 E7 were not identified in our study. b-myb (Lam et al., 1994
) and smooth-muscle
-actin (Nishida et al., 1995
) are both regulated by E2F complexes and their expression is linked to the cell cycle (Lam et al., 1995
). Cell cycle-dependent regulation can easily be overlooked by DDRTPCR of mRNA isolated from non-synchronized cells, as used in the present study.
In conclusion, our data demonstrate for the first time that the cellular genes for S100P and the ADP/ATP carrier protein are regulated in cells expressing the HPV-16 E7 oncoprotein. The contribution of these genes to the altered phenotype of transfected cells will be addressed in future studies.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Averboukh, L., Liang, P., Kantoff, P. W. & Pardee, A. B. (1996). Regulation of S100P expression by androgen. Prostate 29, 350-355.[Medline]
Bates, S., Phillips, A. C., Clark, P. A., Stott, F., Peters, G., Ludwig, R. L. & Vousden, K. H. (1998). p14ARF links the tumour suppressors RB and p53. Nature 395, 124-125.[Medline]
Baudier, J., Bergeret, E., Bertacchi, N., Weintraub, H., Gagnon, J. & Garin, J. (1995). Interactions of myogenic bHLH transcription factors with calcium-binding calmodulin and S100a (alpha alpha) proteins. Biochemistry 34, 7834-7846.[Medline]
Becker, T., Gerke, V., Kube, E. & Weber, K. (1992). S100P, a novel Ca2+-binding protein from human placenta. cDNA cloning, recombinant protein expression and Ca2+ binding properties. European Journal of Biochemistry 207, 541-547.[Medline]
Bertram, J., Palfner, K., Hiddemann, W. & Kneba, M. (1998). Elevated expression of S100P, CAPL and MAGE 3 in doxorubicin-resistant cell lines: comparison of mRNA differential display reverse transcription-polymerase chain reaction and subtractive suppressive hybridization for the analysis of differential gene expression. Anticancer Drugs 9, 311-317.[Medline]
Donato, R. (1991). Perspectives in S-100 protein biology. Cell Calcium 12, 713-726.[Medline]
Dyson, N., Howley, P. M., Münger, K. & Harlow, E. (1989). The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 243, 934-937.
Dyson, N., Guida, P., Münger, K. & Harlow, E. (1992). Homologous sequences in adenovirus E1A and human papillomavirus E7 proteins mediate interaction with the same set of cellular proteins. Journal of Virology 66, 6893-6902.
Edmonds, C. & Vousden, K. H. (1989). A point mutational analysis of human papillomavirus type 16 E7 protein. Journal of Virology 63, 2650-2656.
Gossen, M. & Bujard, H. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences, USA 89, 5547-5551.
Grigorian, M., Ambartsumian, N., Lykkesfeldt, A. E., Bastholm, L., Elling, F., Georgiev, G. & Lukanidin, E. (1996). Effect of mts1 (S100A4) expression on the progression of human breast cancer cells. International Journal of Cancer 67, 831-841.
Hawley-Nelson, P., Vousden, K. H., Hubbert, N. L., Lowy, D. R. & Schiller, J. T. (1989). HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO Journal 8, 3905-3910.[Medline]
Heierhorst, J., Kobe, B., Feil, S. C., Parker, M. W., Benian, G. M., Weiss, K. R. & Kemp, B. E. (1996). Ca2+/S100 regulation of giant protein kinases. Nature 380, 636-639.[Medline]
Hu, J. & Van Eldik, L. J. (1996). S100 beta induces apoptotic cell death in cultured astrocytes via a nitric oxide-dependent pathway. Biochimica et Biophysica Acta 1313, 239-245.[Medline]
Jewers, R. J., Hildebrandt, P., Ludlow, J. W., Kell, B. & McCance, D. J. (1992). Regions of human papillomavirus type 16 E7 oncoprotein required for immortalization of human keratinocytes. Journal of Virology 66, 1329-1335.
Jinquan, T., Vorum, H., Larsen, C. G., Madsen, P., Rasmussen, H. H., Gesser, B., Etzerodt, M., Honore, B., Celis, J. E. & Thestrup-Pedersen, K. (1996). Psoriasin: a novel chemotactic protein. Journal of Investigative Dermatology 107, 5-10.[Medline]
Jones, D. L., Thompson, D. A. & Münger, K. (1997). Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology 239, 97-107.[Medline]
Jørgensen, M., Bévort, M., Kledal, T. S., Hansen, B. V., Dalgaard, M. & Leffers, H. (1999). Differential display competitive polymerase chain reaction: an optimal tool for assaying gene expression. Electrophoresis 20, 230-240.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Lam, E. W., Morris, J. D., Davies, R., Crook, T., Watson, R. J. & Vousden, K. H. (1994). HPV16 E7 oncoprotein deregulates B-myb expression: correlation with targeting of p107/E2F complexes. EMBO Journal 13, 871-878.[Medline]
Lam, E. W., Bennett, J. D. & Watson, R. J. (1995). Cell-cycle regulation of human B-myb transcription. Gene 160, 277-281.[Medline]
Lee, S. W., Tomasetto, C., Swisshelm, K., Keyomarsi, K. & Sager, R. (1992). Down-regulation of a member of the S100 gene family in mammary carcinoma cells and reexpression by azadeoxycytidine treatment. Proceedings of the National Academy of Sciences, USA 89, 2504-2508.
Liang, P. & Pardee, A. B. (1992). Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967-971.
Mariggió, M. A., Fulle, S., Calissano, P., Nicoletti, I. & Fano, G. (1994). The brain protein S-100ab induces apoptosis in PC12 cells. Neuroscience 60, 29-35.[Medline]
Marzo, I., Brenner, C., Zamzami, N., Jurgensmeier, J. M., Susin, S. A., Vieira, H. L., Prevost, M. C., Xie, Z., Matsuyama, S., Reed, J. C. & Kroemer, G. (1998). Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis. Science 281, 2027-2031.
Massimi, P., Pim, D., Storey, A. & Banks, L. (1996). HPV-16 E7 and adenovirus E1a complex formation with TATA box binding protein is enhanced by casein kinase II phosphorylation. Oncogene 12, 2325-2330.[Medline]
Massimi, P., Pim, D. & Banks, L. (1997). Human papillomavirus type 16 E7 binds to the conserved carboxy-terminal region of the TATA box binding protein and this contributes to E7 transforming activity. Journal of General Virology 78, 2607-2613.[Abstract]
Morgenstern, J. P. & Land, H. (1990). Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Research 18, 3587-3596.
Morris, J. D., Crook, T., Bandara, L. R., Davies, R., LaThangue, N. B. & Vousden, K. H. (1993). Human papillomavirus type 16 E7 regulates E2F and contributes to mitogenic signalling. Oncogene 8, 893-898.[Medline]
Münger, K., Phelps, W. C., Bubb, V., Howley, P. M. & Schlegel, R. (1989). The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. Journal of Virology 63, 4417-4421.
Newton, R. A. & Hogg, N. (1998). The human S100 protein MRP-14 is a novel activator of the beta 2 integrin Mac-1 on neutrophils. Journal of Immunology 160, 1427-1435.
Nishida, M., Miyamoto, S., Kato, H., Miwa, T., Imamura, T., Miwa, K., Yasumoto, S., Barrett, J. C. & Wake, N. (1995). Transcriptional repression of smooth-muscle alpha-actin gene associated with human papillomavirus type 16 E7 expression. Molecular Carcinogenesis 13, 157-165.[Medline]
Phelps, W. C., Yee, C. L., Münger, K. & Howley, P. M. (1988). The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53, 539-547.[Medline]
Phillips, A. C. & Vousden, K. H. (1997). Analysis of the interaction between human papillomavirus type 16 E7 and the TATA-binding protein, TBP. Journal of General Virology 78, 905-909.[Abstract]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schäfer, B. W. & Heizmann, C. W. (1996). The S100 family of EF-hand calcium-binding proteins: functions and pathology. Trends in Biochemical Sciences 21, 134-140.[Medline]
Schäfer, B. W., Wicki, R., Engelkamp, D., Mattei, M. G. & Heizmann, C. W. (1995). Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics 25, 638-643.[Medline]
Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J. & Howley, P. M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-1136.[Medline]
Scheffner, M., Huibregtse, J. M., Vierstra, R. D. & Howley, P. M. (1993). The HPV-16 E6 and E6AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505.[Medline]
Schmitt, A., Harry, J. B., Rapp, B., Wettstein, F. O. & Iftner, T. (1994). Comparison of the properties of the E6 and E7 genes of low- and high-risk cutaneous papillomaviruses reveals strongly transforming and high Rb-binding activity for the E7 protein of the low-risk human papillomavirus type 1. Journal of Virology 68, 7051-7059.
Storey, A. & Banks, L. (1993). Human papillomavirus type 16 E6 gene cooperates with EJ-ras to immortalize primary mouse cells. Oncogene 8, 919-924.[Medline]
Takenaga, K., Nakamura, Y., Endo, H. & Sakiyama, S. (1994). Involvement of S100-related calcium-binding protein pEL98 (or mts1) in cell motility and tumor cell invasion. Japanese Journal of Cancer Research 85, 831-839.[Medline]
Tommasino, M., Adamczewski, J. P., Carlotti, F., Barth, C. F., Manetti, R., Contorni, M., Cavalieri, F., Hunt, T. & Crawford, L. (1993). HPV16 E7 protein associates with the protein kinase p33CDK2 and cyclin A. Oncogene 8, 195-202.[Medline]
Voss, H., Nentwich, U., Duthie, S., Wiemann, S., Benes, V., Zimmermann, J. & Ansorge, W. (1997). Automated cycle sequencing with Taquenase: protocols for internal labeling, dye primer and doublex simultaneous sequencing. Biotechniques 23, 312-318.[Medline]
Vousden, K. (1993). Interactions of human papillomavirus transforming proteins with the products of tumor suppressor genes. FASEB Journal 7, 872-879.[Abstract]
Wan, J. S., Sharp, S. J., Poirier, G. M., Wagaman, P. C., Chambers, J., Pyati, J., Hom, Y. L., Galindo, J. E., Huvar, A., Peterson, P. A., Jackson, M. R. & Erlander, M. G. (1996). Cloning differentially expressed mRNAs. Nature Biotechnology 14, 1685-1691.[Medline]
Zwerschke, W., Joswig, S. & Jansen-Dürr, P. (1996). Identification of domains required for transcriptional activation and protein dimerization in the human papillomavirus type-16 E7 protein. Oncogene 12, 213-220.[Medline]
Received 5 November 1999;
accepted 13 January 2000.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |