J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schønning, B. H.
Right arrow Articles by Norrild, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schønning, B. H.
Right arrow Articles by Norrild, B.
Agricola
Right arrow Articles by Schønning, B. H.
Right arrow Articles by Norrild, B.
Journal of General Virology (2000), 81, 1009-1015.
© 2000 Society for General Microbiology


Animal: DNA Viruses

Human papillomavirus type 16 E7-regulated genes: regulation of S100P and ADP/ATP carrier protein genes identified by differential-display technology

Bolette Hellung Schønning1, Maja Bévort2, Sanne Mikkelsen1, Mia Andresen1, Peter Thomsen1, Henrik Leffers2 and Bodil Norrild1

Institute of Molecular Pathology, Protein Laboratory, Panum Institute, Blegdamsvej 3C, Bldg 6.2, DK-2200 Copenhagen N, Denmark1
Department of Growth and Reproduction, Rigshospitalet, Copenhagen, Denmark2

Author for correspondence: Bodil Norrild. Fax +45 35 36 01 16. e-mail bono{at}biobase.dk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human papillomavirus type 16 (HPV-16) is the dominant risk factor for the development of cervical cancer. The virus encodes three oncoproteins, of which the E7 oncoprotein is the major protein involved in cell immortalization and transformation. E7 is a multi-functional protein. It binds the retinoblastoma tumour-suppressor protein (pRb), which regulates progression through the G1 restriction point in the cell cycle. The E7 protein interacts with transcription-regulatory proteins such as the TATA box-binding protein and with proteins of the AP1 transcription factor family. To identify additional proteins regulated by E7, differential-display PCR was used to identify differentially expressed mRNAs in cells containing an inducible E7 protein. It is reported that E7 expression leads to regulation of the genes encoding the calcium-binding protein S100P and the mitochondrial ADP/ATP carrier protein. These data identify new functions of the E7 protein and thus expand the number of routes by which HPV-16 influences cell growth control, although the function of S100P has still to be elucidated.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human papillomavirus type 16 (HPV-16) is an oncogenic DNA virus that encodes six early and two late proteins, where the two early proteins E6 and E7 are major oncoproteins. They disturb the control of the cell cycle by their interaction with cellular proteins that are important for progression through the G1 restriction point. Both the E6 and E7 proteins are necessary for immortalization of human keratinocytes (Münger et al., 1989Down ; Hawley-Nelson et al., 1989Down ). However, both E6 and E7 alone are able to transform primary rodent cells in collaboration with activated Ras (Phelps et al., 1988Down ; Storey & Banks, 1993Down ).

The E6 protein binds to and degrades the p53 tumour-suppressor protein through a ubiquitin-dependent pathway and, thus, interferes with both cell cycle control and the apoptotic pathway (Scheffner et al., 1990Down , 1993Down ). The E7 protein exhibits multiple functions, such as protein–protein interactions with retinoblastoma protein (pRb), other pocket proteins and the cyclin-dependent kinase cdk2 (Dyson et al., 1989Down , 1992Down ; Tommasino et al., 1993Down ) and with proteins regulating transcription, such as the TATA box-binding protein (TBP) (Massimi et al., 1996Down ; Phillips & Vousden, 1997Down ) and the AP1 transcription factors (Antinore et al., 1996Down ). The E7 protein decreases the transcriptional activity of p53 (Massimi et al., 1997Down ), although p53 accumulates in E7-expressing cells (Jones et al., 1997Down ).

E7 binding to pRb leads to the release of the transcription factor E2F (Dyson et al., 1989Down ), which influences the expression of the genes b-myb, smooth-muscle {alpha}-actin and p14ARF (Lam et al., 1994Down ; Morris et al., 1993Down ; Nishida et al., 1995Down ; Bates et al., 1998Down ).

E7 also functions in a pRb/E2F-independent manner, as E7 mutants are defective in binding pRb but retain immortalizing potential in primary human keratinocytes (Edmonds & Vousden, 1989Down ). Mutations in the N-terminal end, as well as in the zinc-binding cysteine motif in the C-terminal end, of the E7 protein abolished both the immortalizing and transforming properties (Jewers et al., 1992Down ; Vousden, 1993Down ). Although the E7 proteins from high-risk and low-risk HPV types are similar, they bind pRb with different affinities, and only the high risk-type E7 causes immortalization and transformation of infected cells (Schmitt et al., 1994Down ). pRb/E2F-independent transformation by E7 has also only been demonstrated for the high-risk HPV types (Zwerschke et al., 1996Down ).

To identify genes regulated by E7 protein expression, differential-display (DD) PCR was conducted on cells where the HPV-16 E7 gene was under inducible control regulated by tetracycline (Tet). We show for the first time that the transcription of the cellular genes encoding the calcium-binding protein S100P and the ADP/ATP carrier protein are regulated in an E7 protein-dependent manner.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cell culture.
MCF7, a mammary adenocarcinoma cell line, was grown in Dulbecco’s modified Eagle’s medium supplemented with 10% foetal calf serum (FCS), 2 mM L-glutamine, 50 U/ml penicillin and 50 µg/ml streptomycin (all from Gibco BRL). This medium will be referred to as DMEM. MCF7Tet cells, containing the stably integrated Tet transactivator pUHD 15-1, were grown in DMEM supplemented with 500 µg/ml geneticin (Sigma) and 2 µg/ml Tet (Sigma). MCF7E7Tet cells, which are MCF7Tet cells containing stably integrated pUHD/E7, a Tet-responsive vector containing E7 (see below), were grown in DMEM supplemented with 500 µg/ml geneticin, 100 µg/ml hygromycin B (Boehringer Mannheim) and 2 µg/ml Tet. They were divided into two cultures containing different FCS batches, designated cultures A and B.

{blacksquare} Plasmid constructs.
An HPV-16 fragment from positions 505–875 of the HPV genome, including the E7 ORF covering positions 562–858, was inserted into the Tet-responsive vector pUHD 10-3 (Gossen & Bujard, 1992Down ) to give the plasmid pUHD/E7. pUHD 15-1 contained the Tet transactivator (Gossen & Bujard, 1992Down ). pBabe hygro contained the hygromycin phosphotransferase gene under the control of the SV40 promoter (Morgenstern & Land, 1990Down ).

{blacksquare} Transfection.
MCF7Tet cells (106) were resuspended in 50 µl PBS and mixed with 10 µl PBS containing 10 µg pUHD/E7 and 1 µg pBabe hygro DNA. This mixture was incubated for 10 min on ice in a Gene Pulser cuvette (Bio-Rad). The cells were electroporated at 320 V and 25 µF and immediately resuspended in 4 ml pre-heated DMEM supplemented with geneticin and Tet. The medium was changed after 24 h, and the cells were transferred after a further 48 h to 10 cm dishes with DMEM supplemented with geneticin, hygromycin and Tet for the selection of resistant cell clones.

{blacksquare} Purification of RNA.
MCF7E7Tet cells were grown in two different batches of serum (A and B). For each batch, a series was made in which Tet was removed from the cells for 0, 24, 48 and 72 h. Total cellular RNA was purified by using Ultraspec (BioTexc) as described by the manufacturer. Contaminating DNA was removed by DNase treatment as described by Jørgensen et al. (1999)Down and RNA was quantified by GeneQuant.

{blacksquare} Differential-display (DD) RT–PCR.
Differential display (Liang & Pardee, 1992Down ) was performed as described previously (Jørgensen et al., 1999Down ). In brief, cDNA synthesis was performed on 1 µg total RNA with HT11V, three different primers with the general sequence AAGCTTTTTTTTTTTV, where V is A, C or G, resulting in three cDNA populations. Each reaction was performed at 42 °C for 1 h in 20 µl of 130 mM Tris–HCl, pH 8·3, 5 mM MgCl2, 20 mM KCl, 625 µM dNTP, 10 U AMV reverse transcriptase (Stratagene) and 0·5 µg HT11V primer. The reaction was stopped by the addition of 80 µl 0·1% Triton X-100 followed by heating to 95 °C for 1 min and the cDNA samples were stored at -80 °C. An aliquot of 1 µl was used for each competitive PCR.

Competitive PCR was performed by using approximately 100 different random or targetted upstream primers in combination with the three downstream HT11V primers used for cDNA synthesis. Most of the upstream primers applied were 13-mers, each including six or seven G or C residues. The reactions were performed in 10 µl of (final concentrations) 12 mM Tris–HCl, pH 8·3, 50 mM KCl, 1·9 mM MgCl2, 0·1% Triton X-100, 0·005% gelatin, 14 µM dNTP, 1 µCi {alpha}-35S-dATP ([35S]dATP{alpha}S; Amersham Pharmacia Biotech), 10 pmol each of upstream and downstream primers and 1 U AmpliTaq (Perkin-Elmer). The cycle conditions were: one cycle of 2 min at 95 °C; 40 cycles of 30 s at 95 °C, 1 min at 40 °C and 1 min at 72 °C; and one final cycle of 5 min at 72 °C. After PCR, 10 µl loading buffer (8% Ficoll 400, 10 mM EDTA, 10 mM NaOH, 0·1225% bromophenol blue, 0·1225% xylene cyanol in formamide) was added and the samples were denatured for 2 min at 96 °C before they were loaded onto a 5% polyacrylamide sequencing gel.

{blacksquare} Reamplification of differentially expressed bands.
Differentially expressed bands were excised from the dried gels and the DNA was recovered by shaking the sample in 50 µl TE buffer (10 mM Tris–HCl, pH 7·5, 0·1 mM EDTA) at 95 °C for 15 min. Five µl was used for PCR amplification in a total volume of 27 µl of (final concentrations) 10 mM Tris–HCl, pH 8·3, 50 mM KCl, 1·8 mM MgCl2, 0·1% Triton X-100, 0·005% gelatin, 70 µM each of dATP, dCTP, dGTP and dTTP, 2·5 U AmpliTaq (Perkin-Elmer), 10 pmol upstream primer and 10 pmol extended downstream primer (T7HT11V; TAATACGACTCACTATAGGGAAGCTTTTTTTTTTTV). Cycle conditions were as described for competitive PCR above, except that the annealing temperature was 42 °C. Reamplified DDRT–PCR fragments were purified from 2% agarose gels. Bands were identified by sequencing the reamplified bands. Sequencing reactions were performed as cycle sequencing (Voss et al., 1997Down ) by using the ThermoSequenase enzyme (Amersham Pharmacia Biotech) and a T7 promoter-complementary primer (TAATACGACTCACTATAGGGAA) that matches all fragments amplified with the extended T7HT11V primers. Sequencing reactions were performed as described by Amersham Pharmacia Biotech. The sequences were compared with sequences stored in the GenBank and EBI databases by using the FASTA program (UWGCG program package).

{blacksquare} Northern blotting.
The hybridization probes were made from the purified differentially displayed fragments (S100P, ADP/ATP carrier protein and {beta}-actin). Random-primed labelling was performed as described by Sambrook et al. (1989)Down by using 20–100 ng DNA fragment and 0·75 µg of a random 8-mer oligonucleotide. The reaction was performed in 20 µl containing 50 mM Tris–HCl, pH 7·5, 5 mM MgCl2, 10 mM {beta}-mercaptoethanol, 250 µM of dCTP, dGTP and dTTP, 40–50 µCi [{alpha}-32P]dATP (Amersham Pharmacia Biotech) and 7·5 U Klenow enzyme (Amersham Pharmacia Biotech) at room temperature. After 1 h, 80 µl TE buffer (10 mM Tris–HCl, pH 7·5, 1 mM EDTA) was added and the samples were extracted once with phenol–chloroform, precipitated and dissolved in hybridization buffer. Prehybridization, hybridization and washing were done as described by Sambrook et al. (1989Down ). The low-stringency wash corresponded to washing at 65 °C in 1xSSC, 0·1% SDS and 0·5 mM EDTA. The high-stringency wash was in 0·1xSSC, 0·1% SDS and 0·5 mM EDTA at 65 °C. The filters were exposed to Kodak Biomax MS film.

{blacksquare} Western blot analysis.
Cell extracts were prepared from both MCF7Tet and MCF7E7Tet cells before induction and after 24, 48 or 72 h induction. Total cell lysates were prepared by adding Laemmli sample buffer directly to the cell culture flask and scraping off the cells (Laemmli, 1970Down ). The samples were loaded on a 15% SDS–PAGE gel after boiling for 10 min and transferred to a PVDF membrane by semi-dry electroblotting for 1 h at 15 V. The membranes were incubated in PBS with 0·1% (v/v) Tween and 5% (w/v) skimmed milk for 1 h at room temperature.

Immunodetection of the E7 protein was done by incubation with a 1:50 dilution of mouse anti-E7 monoclonal antibody (MAb) (Triton) followed by a 1:100 dilution of biotinylated anti-mouse immunoglobulin (DAKO). Immunodetection of S100P was done by incubation with a 1:250 dilution of mouse anti-S100P MAb (Transduction Laboratories) followed by a 1:100 dilution of biotinylated anti-mouse immunoglobulin. Both immunoblots were developed by addition of ECL detection reagent (Amersham) according to the instructions given by the manufacturer and exposed to Hyperfilm ECL (Amersham).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Inducible expression of HPV-16 E7 protein
The HPV-16 E7 gene was inserted into the pUHD 10-3 vector and transfected into the MCF7Tet cell line that was stably transfected with the Tet transactivator. To demonstrate inducible expression of the E7 protein, cells were subcloned and several clones were grown in the presence or absence of Tet. E7 protein expression was demonstrated by Western blot analysis. Clones that were leaky for expression of the E7 protein, i.e. they expressed detectable amounts of the protein in the presence of Tet, were discarded. A stable cell clone with a high level of E7 synthesized under stringent control was isolated and named MCF7E7Tet. The amount of E7 protein increased for up to 48 h after induction and then decreased. The level of E7 protein that was present at 72 h post-induction was thus similar to that measured after 24 h (Fig. 1aDown).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1. Induction of E7 protein and mRNA in MCF7E7Tet cells in the absence of Tet. (a) Western blot analysis of cell lysates made at time 0 and 24, 48 and 72 h after induction. The proteins were separated on a 10% polyacrylamide gel and transferred to a PVDF membrane. E7 protein was visualized after incubation with E7-specific MAbs (1:50), biotinylated rabbit anti-mouse immunoglobulin (1:100), ECL detection reagent and development on Hyperfilm ECL (Amersham). (b) PAGE of {alpha}-35S-dATP-labelled RNA amplified by differential display. The RNA was prepared from cells induced for the same times as in (a). The gels were developed after autoradiography. Two independent RNA preparations are analysed in the lanes marked 1 and 2. (c) Northern blot analyses of RNA extracts prepared from cells induced for 24 and 48 h. Two independent RNA preparations were analysed, as shown in lanes 1 and 2. The filter was hybridized with a randomly [{alpha}-32P]dATP-labelled E7 probe. In the lower panel, a labelled {beta}-actin probe was used as a control for the amount of RNA transferred to the filter.

 
DDRT–PCR analysis of differentially expressed genes
DDRT–PCR was conducted on total RNA isolated from cells in which E7 expression was either uninduced or had been induced for 24, 48 and 72 h in order to follow the kinetics of mRNA accumulation or degradation. DDRT–PCR was done on two preparations of mRNA isolated from MCF7E7Tet cells grown in media containing two different FCS batches. This was done in order to reduce the risk of isolating genes regulated by serum factors. A total of approximately 200 primer combinations was used and, since each primer combination displayed about 120 bands, this corresponds to visualization of at least 24000 bands, each representing an mRNA. Since there was probably some redundancy, this may correspond to 15000–20000 different mRNAs, which is probably about 50–70% of all the mRNAs that are expressed in the MCF7 cells (Wan et al., 1996Down ). Only mRNAs regulated in both experiments were isolated and studied further. As an internal control for the quality of the DDRT–PCR, E7 mRNA was identified with a target primer annealing to positions 606–618 in the E7 gene (Fig. 1bUp). Very few bands were affected by E7 expression and only six bands were excised from the gels for further analysis. Of these, only two were correctly regulated by E7.

Northern blot analysis of two independent mRNA preparations showed that E7 mRNA was induced to a maximum level after 24 h of induction and confirmed that the E7 gene was under stringent control (Fig. 1cUp). The higher molecular mass band that hybridized with the E7 probe under the stringent conditions used was present in both uninduced and induced MCF7E7Tet cells. It represents a cellular protein that was not characterized further. The presence of equivalent quantities of RNA loaded in each lane was controlled by hybridization with an actin probe.

E7 expression regulates the transcription of the S100P and ADP/ATP carrier protein genes
cDNAs identified by DDRT–PCR that were down- or up-regulated by E7 protein expression in MCF7E7Tet cells are shown in Fig. 2Down. The down-regulated band was sequenced and identified as the S100P gene. An up-regulated band was identified as the ADP/ATP carrier protein gene. Both cDNAs were amplified by PCR with specific primers (S100P, HT11C/GH06; ADP/ATP-carrier protein, HT11C/GH12) and cloned into a pUC19 vector. The cloned cDNAs were used as probes in Northern blot analysis, which confirmed that the mRNA for the S100P protein was down-regulated after 48 h. The gene for the ADP/ATP carrier protein was up-regulated at 24 h, followed by a decrease in the mRNA after 48 h of induction (Fig. 3Down). Western blot analysis of 40 µg total protein from cell lysates prepared from MCF7E7Tet cells uninduced and induced for 24 h showed that S100P protein was down-regulated in the E7-expressing cells (Fig. 4Down).



View larger version (97K):
[in this window]
[in a new window]
 
Fig. 2. PAGE of {alpha}-35S-dATP-labelled RNA amplified by differential display. RNA was isolated from MCF7E7Tet cells induced for 24, 48 and 72 h, amplified and separated on 5 % polyacrylamide gels. In the top panel, the RNA band that was reduced with time of induction is identified as S100P. In the middle panel, the RNA band that was up-regulated with time of induction is identified as the ADP/ATP carrier. In the lower panel, the {beta}-actin and heat shock protein 27 (HSP27) RNAs are shown as bands that remained constant during E7 protein induction. Two independent RNA preparations were analysed at each time of induction and the results are shown in the lanes labelled 1 and 2. The gel was developed by autoradiography.

 


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 3. Northern blot analysis of RNA prepared from MCF7E7Tet cells at time 0 and 24 and 48 h after induction. Two independent RNA isolates were analysed at each time (lanes 1 and 2). The upper panel was hybridized with an S100P-specific probe, the middle panel with an ADP/ATP carrier-specific probe and the lower panel with a {beta}-actin-specific probe. All probes were prepared by randomly primed labelling of specific DNA fragments with [{alpha}-32P]dATP. The blots were developed by autoradiography.

 


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4. Western blot analysis of the amount of S100P protein present in extracts made from MCF7E7Tet cells before and after induction for 24 h. Aliquots containing 40 µg total protein from each lysate were separated on 10% polyacrylamide gels and transferred to a PVDF membrane. The membrane was incubated with MAbs specific for E7 or S100P as shown, followed by biotinylated anti-mouse antibodies. The reaction was visualized by ECL detection reagent and exposed to Hyperfilm ECL (Amersham).

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
To study the gene-regulatory properties of HPV-16 E7, we established an MCF7 cell line in which E7 protein expression could be induced. This allowed us to investigate the immediate effect of E7 expression and its influence on the transcriptional activity of the cells relative to uninduced MCF7E7Tet cells. DDRT–PCR identified differentially expressed mRNAs for S100P and the ADP/ATP carrier protein.

Expression of S100P mRNA was down-regulated by E7 protein induction. S100P belongs to the S100 super-family of calcium-binding proteins. Members of this family have been associated with cell differentiation and malignancy, when the proteins are most often up-regulated (Schäfer & Heizmann, 1996Down ; Grigorian et al., 1996Down ), with chemotaxis (Newton & Hogg, 1998Down ; Jinquan et al., 1996Down ) and with the cell cytoskeleton and motility (Donato, 1991Down ). The genes are often clustered on chromosome 1, but S100P was mapped to chromosome 4 by Schäfer et al. (1995)Down . The best-characterized S100 gene is A4 (CAPL, mts-1), which is involved in metastasis and cell motility (Grigorian et al., 1996Down ; Takenaga et al., 1994Down ). In mammary carcinoma cells, the S100A2 gene (CaN19) is down-regulated (Lee et al., 1992Down ). These authors observed that the gene was expressed abundantly not only in normal mammary keratinocytes, but also in an HPV-immortalized cell line, which is in contrast to our finding that S100P was down-regulated in cells that produced HPV-16 E7 protein. The biological function and cellular localization of S100P are not known, but the gene was first isolated and cloned from placenta by Becker et al. (1992)Down , who expressed S100P as a homodimer. The amino acid sequence of S100P is most closely related to S100 A1 ({alpha}) and B ({beta}), whereas S100A2 is less related (Schäfer & Heizmann, 1995; Lee et al., 1992Down ). The only other reports on S100P describe S100P as being regulated in prostate cancer cells in an androgen-dependent fashion, which needs to be confirmed, and being up-regulated in doxorubicin-resistant colon carcinoma cell lines (Averboukh et al., 1996Down ; Bertram et al., 1998Down ).

The importance of the second E7-regulated gene, the ADP/ATP carrier protein gene, for control of cell growth is also unknown. Marzo et al. (1998)Down reported that the ADP/ATP carrier protein interacts with Bax and mediates permeabilization of the mitochondria as a first step in the apoptotic pathway. As the S100 proteins have also been described to promote apoptosis (Hu & Van Eldik, 1996Down ; Mariggió et al., 1994Down ), the differential regulation of S100P and the ADP/ATP carrier protein could be important for HPV-16 E7 protein-induced cell cycle progression. However, we have not been able to show E7-induced apoptosis by FACS analysis or any changes in the levels of Bax, Bcl-2 or Bcl-x mRNA after MCF7E7Tet induction (data not shown). We are currently looking for biological functions of the S100P protein, and preliminary results have shown that it might be involved in the regulation of cell motility and neurite outgrowth (data not shown). It might also be involved in regulation of protein kinases, in analogy to observations on S100A12 (Heierhorst et al., 1996Down ), or in intracellular functions related to cell cycle control, as reported for S100A2 (Lee et al., 1992Down ) and for S100B through binding to p53 (Baudier et al., 1995Down ).

Genes that have been described previously as regulated by HPV-16 E7 were not identified in our study. b-myb (Lam et al., 1994Down ) and smooth-muscle {alpha}-actin (Nishida et al., 1995Down ) are both regulated by E2F complexes and their expression is linked to the cell cycle (Lam et al., 1995Down ). Cell cycle-dependent regulation can easily be overlooked by DDRT–PCR of mRNA isolated from non-synchronized cells, as used in the present study.

In conclusion, our data demonstrate for the first time that the cellular genes for S100P and the ADP/ATP carrier protein are regulated in cells expressing the HPV-16 E7 oncoprotein. The contribution of these genes to the altered phenotype of transfected cells will be addressed in future studies.


   Acknowledgments
 
We want to thank Professor Michael Strauss at the Danish Cancer Institute for his interest and support during the initiation of this study, Professor J. Celis, Department of Clinal Biochemistry, Aarhus University, for helpful discussions and Malene Dalgaard and Lina Leerhøj for excellent technical assistance. The work was supported by grants from the Danish Medical Research Council (no. 12-1625-1), the Biotechnology Program (no. 9501891), the Danish Cancer Society (no. 94 100 41/42), the Carlsberg Foundation, Fabrikant Einar Willumsens Mindelegat, Direktør E. Danielsen og Hustrus Fond, Løvens kemiske Fabriks Forskningsfond, Arvid Nielssons Fond and Gluds Legat. We are grateful to Dr M. Jättela, Department of Cancer Biology, Danish Cancer Institute, for donating the probes for Bax, Bcl-2 and Bcl-x. Special thanks also to Dr J. Batckowa, who donated the MCF7Tet cell line.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Antinore, M. J., Birrer, M. J., Patel, D., Nader, L. & McCance, D. J. (1996). The human papillomavirus type 16 E7 gene product interacts with and trans-activates the AP1 family of transcription factors. EMBO Journal 15, 1950-1960.[Medline]

Averboukh, L., Liang, P., Kantoff, P. W. & Pardee, A. B. (1996). Regulation of S100P expression by androgen. Prostate 29, 350-355.[Medline]

Bates, S., Phillips, A. C., Clark, P. A., Stott, F., Peters, G., Ludwig, R. L. & Vousden, K. H. (1998). p14ARF links the tumour suppressors RB and p53. Nature 395, 124-125.[Medline]

Baudier, J., Bergeret, E., Bertacchi, N., Weintraub, H., Gagnon, J. & Garin, J. (1995). Interactions of myogenic bHLH transcription factors with calcium-binding calmodulin and S100a (alpha alpha) proteins. Biochemistry 34, 7834-7846.[Medline]

Becker, T., Gerke, V., Kube, E. & Weber, K. (1992). S100P, a novel Ca2+-binding protein from human placenta. cDNA cloning, recombinant protein expression and Ca2+ binding properties. European Journal of Biochemistry 207, 541-547.[Medline]

Bertram, J., Palfner, K., Hiddemann, W. & Kneba, M. (1998). Elevated expression of S100P, CAPL and MAGE 3 in doxorubicin-resistant cell lines: comparison of mRNA differential display reverse transcription-polymerase chain reaction and subtractive suppressive hybridization for the analysis of differential gene expression. Anticancer Drugs 9, 311-317.[Medline]

Donato, R. (1991). Perspectives in S-100 protein biology. Cell Calcium 12, 713-726.[Medline]

Dyson, N., Howley, P. M., Münger, K. & Harlow, E. (1989). The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 243, 934-937.[Abstract/Free Full Text]

Dyson, N., Guida, P., Münger, K. & Harlow, E. (1992). Homologous sequences in adenovirus E1A and human papillomavirus E7 proteins mediate interaction with the same set of cellular proteins. Journal of Virology 66, 6893-6902.[Abstract/Free Full Text]

Edmonds, C. & Vousden, K. H. (1989). A point mutational analysis of human papillomavirus type 16 E7 protein. Journal of Virology 63, 2650-2656.[Abstract/Free Full Text]

Gossen, M. & Bujard, H. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences, USA 89, 5547-5551.[Abstract/Free Full Text]

Grigorian, M., Ambartsumian, N., Lykkesfeldt, A. E., Bastholm, L., Elling, F., Georgiev, G. & Lukanidin, E. (1996). Effect of mts1 (S100A4) expression on the progression of human breast cancer cells. International Journal of Cancer 67, 831-841.

Hawley-Nelson, P., Vousden, K. H., Hubbert, N. L., Lowy, D. R. & Schiller, J. T. (1989). HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO Journal 8, 3905-3910.[Medline]

Heierhorst, J., Kobe, B., Feil, S. C., Parker, M. W., Benian, G. M., Weiss, K. R. & Kemp, B. E. (1996). Ca2+/S100 regulation of giant protein kinases. Nature 380, 636-639.[Medline]

Hu, J. & Van Eldik, L. J. (1996). S100 beta induces apoptotic cell death in cultured astrocytes via a nitric oxide-dependent pathway. Biochimica et Biophysica Acta 1313, 239-245.[Medline]

Jewers, R. J., Hildebrandt, P., Ludlow, J. W., Kell, B. & McCance, D. J. (1992). Regions of human papillomavirus type 16 E7 oncoprotein required for immortalization of human keratinocytes. Journal of Virology 66, 1329-1335.[Abstract/Free Full Text]

Jinquan, T., Vorum, H., Larsen, C. G., Madsen, P., Rasmussen, H. H., Gesser, B., Etzerodt, M., Honore, B., Celis, J. E. & Thestrup-Pedersen, K. (1996). Psoriasin: a novel chemotactic protein. Journal of Investigative Dermatology 107, 5-10.[Medline]

Jones, D. L., Thompson, D. A. & Münger, K. (1997). Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology 239, 97-107.[Medline]

Jørgensen, M., Bévort, M., Kledal, T. S., Hansen, B. V., Dalgaard, M. & Leffers, H. (1999). Differential display competitive polymerase chain reaction: an optimal tool for assaying gene expression. Electrophoresis 20, 230-240.[Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lam, E. W., Morris, J. D., Davies, R., Crook, T., Watson, R. J. & Vousden, K. H. (1994). HPV16 E7 oncoprotein deregulates B-myb expression: correlation with targeting of p107/E2F complexes. EMBO Journal 13, 871-878.[Medline]

Lam, E. W., Bennett, J. D. & Watson, R. J. (1995). Cell-cycle regulation of human B-myb transcription. Gene 160, 277-281.[Medline]

Lee, S. W., Tomasetto, C., Swisshelm, K., Keyomarsi, K. & Sager, R. (1992). Down-regulation of a member of the S100 gene family in mammary carcinoma cells and reexpression by azadeoxycytidine treatment. Proceedings of the National Academy of Sciences, USA 89, 2504-2508.[Abstract/Free Full Text]

Liang, P. & Pardee, A. B. (1992). Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967-971.[Abstract/Free Full Text]

Mariggió, M. A., Fulle, S., Calissano, P., Nicoletti, I. & Fano, G. (1994). The brain protein S-100ab induces apoptosis in PC12 cells. Neuroscience 60, 29-35.[Medline]

Marzo, I., Brenner, C., Zamzami, N., Jurgensmeier, J. M., Susin, S. A., Vieira, H. L., Prevost, M. C., Xie, Z., Matsuyama, S., Reed, J. C. & Kroemer, G. (1998). Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis. Science 281, 2027-2031.[Abstract/Free Full Text]

Massimi, P., Pim, D., Storey, A. & Banks, L. (1996). HPV-16 E7 and adenovirus E1a complex formation with TATA box binding protein is enhanced by casein kinase II phosphorylation. Oncogene 12, 2325-2330.[Medline]

Massimi, P., Pim, D. & Banks, L. (1997). Human papillomavirus type 16 E7 binds to the conserved carboxy-terminal region of the TATA box binding protein and this contributes to E7 transforming activity. Journal of General Virology 78, 2607-2613.[Abstract]

Morgenstern, J. P. & Land, H. (1990). Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Research 18, 3587-3596.[Abstract/Free Full Text]

Morris, J. D., Crook, T., Bandara, L. R., Davies, R., LaThangue, N. B. & Vousden, K. H. (1993). Human papillomavirus type 16 E7 regulates E2F and contributes to mitogenic signalling. Oncogene 8, 893-898.[Medline]

Münger, K., Phelps, W. C., Bubb, V., Howley, P. M. & Schlegel, R. (1989). The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. Journal of Virology 63, 4417-4421.[Abstract/Free Full Text]

Newton, R. A. & Hogg, N. (1998). The human S100 protein MRP-14 is a novel activator of the beta 2 integrin Mac-1 on neutrophils. Journal of Immunology 160, 1427-1435.[Abstract/Free Full Text]

Nishida, M., Miyamoto, S., Kato, H., Miwa, T., Imamura, T., Miwa, K., Yasumoto, S., Barrett, J. C. & Wake, N. (1995). Transcriptional repression of smooth-muscle alpha-actin gene associated with human papillomavirus type 16 E7 expression. Molecular Carcinogenesis 13, 157-165.[Medline]

Phelps, W. C., Yee, C. L., Münger, K. & Howley, P. M. (1988). The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53, 539-547.[Medline]

Phillips, A. C. & Vousden, K. H. (1997). Analysis of the interaction between human papillomavirus type 16 E7 and the TATA-binding protein, TBP. Journal of General Virology 78, 905-909.[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schäfer, B. W. & Heizmann, C. W. (1996). The S100 family of EF-hand calcium-binding proteins: functions and pathology. Trends in Biochemical Sciences 21, 134-140.[Medline]

Schäfer, B. W., Wicki, R., Engelkamp, D., Mattei, M. G. & Heizmann, C. W. (1995). Isolation of a YAC clone covering a cluster of nine S100 genes on human chromosome 1q21: rationale for a new nomenclature of the S100 calcium-binding protein family. Genomics 25, 638-643.[Medline]

Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J. & Howley, P. M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-1136.[Medline]

Scheffner, M., Huibregtse, J. M., Vierstra, R. D. & Howley, P. M. (1993). The HPV-16 E6 and E6–AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505.[Medline]

Schmitt, A., Harry, J. B., Rapp, B., Wettstein, F. O. & Iftner, T. (1994). Comparison of the properties of the E6 and E7 genes of low- and high-risk cutaneous papillomaviruses reveals strongly transforming and high Rb-binding activity for the E7 protein of the low-risk human papillomavirus type 1. Journal of Virology 68, 7051-7059.[Abstract/Free Full Text]

Storey, A. & Banks, L. (1993). Human papillomavirus type 16 E6 gene cooperates with EJ-ras to immortalize primary mouse cells. Oncogene 8, 919-924.[Medline]

Takenaga, K., Nakamura, Y., Endo, H. & Sakiyama, S. (1994). Involvement of S100-related calcium-binding protein pEL98 (or mts1) in cell motility and tumor cell invasion. Japanese Journal of Cancer Research 85, 831-839.[Medline]

Tommasino, M., Adamczewski, J. P., Carlotti, F., Barth, C. F., Manetti, R., Contorni, M., Cavalieri, F., Hunt, T. & Crawford, L. (1993). HPV16 E7 protein associates with the protein kinase p33CDK2 and cyclin A. Oncogene 8, 195-202.[Medline]

Voss, H., Nentwich, U., Duthie, S., Wiemann, S., Benes, V., Zimmermann, J. & Ansorge, W. (1997). Automated cycle sequencing with Taquenase: protocols for internal labeling, dye primer and ‘doublex’ simultaneous sequencing. Biotechniques 23, 312-318.[Medline]

Vousden, K. (1993). Interactions of human papillomavirus transforming proteins with the products of tumor suppressor genes. FASEB Journal 7, 872-879.[Abstract]

Wan, J. S., Sharp, S. J., Poirier, G. M., Wagaman, P. C., Chambers, J., Pyati, J., Hom, Y. L., Galindo, J. E., Huvar, A., Peterson, P. A., Jackson, M. R. & Erlander, M. G. (1996). Cloning differentially expressed mRNAs. Nature Biotechnology 14, 1685-1691.[Medline]

Zwerschke, W., Joswig, S. & Jansen-Dürr, P. (1996). Identification of domains required for transcriptional activation and protein dimerization in the human papillomavirus type-16 E7 protein. Oncogene 12, 213-220.[Medline]

Received 5 November 1999; accepted 13 January 2000.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schønning, B. H.
Right arrow Articles by Norrild, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schønning, B. H.
Right arrow Articles by Norrild, B.
Agricola
Right arrow Articles by Schønning, B. H.
Right arrow Articles by Norrild, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS