|
|
||||||||
Animal: DNA Viruses |
Animal Health and Biomedical Sciences, University of Wisconsin-Madison, 1655 Linden Drive, Madison, WI 53706, USA1
Author for correspondence: Gopal Dasika. Present address: Department of Molecular Medicine, Institute of Biotechnology, University of Texas Health Science Center at San Antonio, 15355 Lambda Drive, San Antonio, TX 78245, USA. Fax +1 210 567 7324. e-mail Dasika{at}uthscsa.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Cross-interference between herpes simplex virus (HSV)-1 and pseudorabies virus (PRV) (Petrovskis et al., 1988
) and between bovine herpesvirus (BHV)-1 and HSV-1 (Chase et al., 1990
, 1993
; Tikoo et al., 1990
) supports the common receptor hypothesis. The observation that the truncated (soluble) gDs of HSV-1 and BHV-1 bind a limited number of cell membrane sites (
4x1051x106 per cell) with comparable affinities (Kd
10-7 M) and partially block homologous infections (Johnson et al., 1990
; Li et al., 1995
) is consistent with the hypothesis but it is not known if HSV-1 and BHV-1 gDs bind the same site(s) on MDBK cells. Recent identification of several human cellular coreceptors for gD (HveA, B, C, D and HIgR), only some of which serve as common receptors for specific alphaherpesviruses, provides further support to the common receptor hypothesis (Montgomery et al., 1996
; Whitbeck et al., 1997
; Geraghty et al., 1998
; Warner et al., 1998
; Krummenacher et al., 1998
; Cocchi et al., 1998
) but it is not known if their animal homologues exist and serve as receptors for HSV. However, certain observations are difficult to explain using the common receptor hypothesis. Firstly, bovine cells expressing BHV-1 gD are resistant to BHV-1, HSV-1 and PRV but cells expressing PRV gD are fully permissive to BHV-1 infection (Chase et al., 1993
). Second, several other candidate receptors for HSV-1 gD identified earlier (Brunetti et al., 1994
, 1995
; Huang & Campadelli-Fiume, 1996
) may be different from the putative BHV-1 gD receptor identified on MDBK cells (Thaker et al., 1994
). However, the exact role of these proteins in infection remains unclear. Thirdly, viruses selected for their ability to grow on gD-expressing cells may carry wild-type gDs (Dean et al., 1995
; G. K. Dasika & G. J. Letchworth, unpublished results). Additionally, mutations in gD of some interference-resistant viruses may not be sufficient for the unrestricted phenotype (Brandimarti et al., 1994
), suggesting that other viral proteins may also participate in gD-mediated interference. Lastly, a point mutation in HSV-1 gD (L25 to P25) enabled mutant HSV-1 to infect cells expressing wild-type HSV-1 gD, but the mutant protein expressed in cells was unable to interfere with wild-type or mutant HSV-1 infection (Campadelli-Fiume et al., 1990
). This led the authors to propose an alternative mechanism involving unfavourable interaction between cellular gD and viral gD (or another viral protein) resulting in interference (Campadelli-Fiume et al., 1990
; Dean et al., 1994
). Recent evidence suggests that an L25 to P25 mutation in gD precludes the use of HveA but the mutant virus utilizes HveC, a coreceptor for HSV-2, BHV-1 and PRV (Geraghty et al., 1998
).
The alphaherpesvirus BHV-1 infects cattle worldwide and causes a variety of clinical syndromes (Yates, 1982
; Ludwig, 1983
). On the basis of apparently different clinical manifestations, BHV-1 isolates were classified into respiratory (BHV-1.1), genital (BHV-1.2) and encephalitic (BHV-1.3) subtypes (Engels et al., 1986
). The neurovirulent virus (BHV-1.3) was reclassified as a separate type, BHV-5 (Roizman et al., 1992
), based on the distinct restriction digest profiles of the genomes although BHV-1.1 and BHV-5 DNAs are 85% hybridizable (Engels et al., 1986
). The BHV-5 gD protein shares 86% amino acid identity with BHV-1 gD (Tikoo et al., 1990
; Abdelmagid et al., 1995
).
We recently showed that full-length BHV-1.1 gD (referred to as BHV-1 gD here) interfered with infection by the distantly related viruses HSV-1 and PRV, but not with the closely related BHV-5, as determined by the number of plaques produced (Dasika & Letchworth, 1999
). However, full-length BHV-1 gD expressed in MDBK cells inhibited cell-to-cell transmission of both BHV-1 and BHV-5 (Dasika & Letchworth, 1999
). Since the exact mechanism of gD-mediated interference has not yet been fully elucidated and both truncated (soluble) (Johnson et al., 1990
; Li et al., 1995
; Nicola et al., 1996
) and full-length gDs (Campadelli-Fiume et al., 1988
; Chase et al., 1990
; Dasika & Letchworth, 1999
; Fehler et al., 1992
; Johnson & Spear, 1989
; Petrovskis et al., 1988
; Tikoo et al., 1990
) have been shown separately to interfere with infection by the homologous virus, we hypothesized that if truncated gD interferes with virus infection by a process analogous to full-length gD, truncated BHV-1 gD should block BHV-1, HSV-1 and PRV but not BHV-5 infections. Our results showed the hypothesis to be correct.
| Methods |
|---|
|
|
|---|
Cells and viruses.
Construction of expression plasmids for transfection.
The plasmids p-gDt and p-controlt were constructed as follows (Fig. 1
). To construct p-gDt, an opal codon was inserted into the BHV-1 gD open reading frame (ORF) (Tikoo et al., 1990
) at position 1077 by PCR amplification with a mutagenic 3' oligonucleotide primer 1161R*gD (5' GCCGAGCTCAGTCGGGGGCCGCGGGCGTA 3') and a wild-type 5' primer (72FgD) including the start codon (5' CGAGCGGGCGAACATGCAAGG 3'). Amplification was done in a programmable tempcycler (model 50 Tempcycler, Coy Laboratory Prod. Inc.) with an initial denaturation at 95 °C for 5 min, followed by 30 cycles through 95 °C for 1 min, 60 °C for 1 min, 72 °C for 1·5 min and terminated by a final extension step at 72 °C for 10 min. The PCR product was purified with the Geneclean II kit (Bio 101), after isolation of the 1098 bp band from low melting temperature gel electrophoresis (Sea Plaque GTG Agarose, FMC Bioproducts) and cloned into PCRII (Invitrogen) to create the plasmid p-TAgDt. The truncated gD gene with EcoRI ends was then transferred to pcDNA3 (Invitrogen) to create the plasmid p-gDt, such that gDt had a CMV promoter upstream and BGH poly(A) signals downstream from the gene. To construct the plasmid p-controlt, the plasmid p-TAgDt was digested with SalI and religated thereby releasing a 786 bp fragment from the gDt ORF. Truncated gD with a SalI deletion was then transferred to pcDNA3 in the opposite orientation.
|
Construction of cell lines.
SDSPAGE and Western blot analysis.
Immunodot blots were performed as an initial screen to pick t-gD-expressing and control non-expressing clones. None of the clones that resulted from p-control transfection expressed t-gD. G418-resistant clones were grown to confluency in 24-well plates (Costar); the cells were then washed with MEM and the medium replaced with 1 ml serum-free MEM. An aliquot (200 µl) from the supernatant was made to bind to nitrocellulose through negative pressure and screened for the presence of gD using polyclonal or monoclonal anti-BHV-1 gD MAb (3402) as described for Western blots (Dasika & Letchworth, 1999
).
Estimation of truncated BHV-1 gD concentration.
In order to estimate the concentration of gD in the supernatant, serum-free supernatant (10 ml) from 75 cm2 flasks was collected after 24 h and 25 µl of serial twofold dilutions was separated by SDSPAGE on an 8% gel and stained with Coomassie blue (see Fig. 3
). Undiluted control supernatant (25 µl) was also run on a similar gel alongside. Serial dilutions of BSA run on a similar gel and stained with Coomassie blue (data not shown) was used as a standard for visual comparison and estimation of the concentration of t-gD.
|
Blocking assay with truncated BHV-1 gD.
1x105 cells per well) were rinsed twice with MEM and treated with 500 µl of supernatant containing truncated gD (
200 µg) or control supernatant for 1 h at 4 °C. Approximately 100 p.f.u. of each virus was added in duplicates on cells (MDBK or MDBKt-gD) and incubated for an additional hour at 4 °C. Supernatant containing the unbound proteins and virus was removed and the cells were overlaid with MEM containing agarose (medium EEO, Sigma) as described previously (Dasika & Letchworth, 1999
Effect of truncated gD on plaque size.
Approximately 100 p.f.u. of each virus (BHV-1, BHV-5, PRV and HSV-1) was used to infect confluent MDBKt-gD or MDBK (control) monolayers in a 24-well plate in duplicates after rinsing the cells with MEM twice. After incubating at 37 °C for 1 h the cells were washed with MEM and overlaid with MEM containing 0·5% agarose (Fisher Scientific) supplemented with 5% FBS, and then placed in an incubator at 37 °C with 5% CO2. Monolayers were fixed with 10% formaldehyde 3 days after infection and stained with crystal violet. The diameters of 3740 random isolated plaques from each virus-infected monolayer were measured under a microscope (Olympus 10x magnification) using an ocular micrometer, and the mean and standard deviations were calculated.
| Results |
|---|
|
|
|---|
64 kDa) than full-length BHV-1 gD from MDBKgD cells (Dasika & Letchworth, 1999
140 kDa, is probably a homodimer of gD since it reacted with MAb 3402. As expected, the control supernatant did not contain truncated BHV-1 gD.
|
64 kDa) in supernatant from MDBKt-gD was estimated to be
100120 µg/ml (Fig. 3
64 kDa band was absent in control supernatant although two other protein bands at
100 kDa and
120 kDa were present. The concentration of t-gD in the same supernatant could be increased to about 450500 µg/ml by collecting the supernatant after 34 days. If the supernatant was not replaced with fresh medium, the cells showed cytotoxic effects after 56 days as evidenced by vacuolation, rounding off and detaching from the surface similar to MDBKgD cells upon induction (Dasika & Letchworth, 1999
Truncated BHV-1 gD blocked BHV-1, HSV-1 and PRV but not BHV-5 infection
Supernatant containing about 200 µg of gD was sufficient to partially block infection with BHV-1 (Fig. 4a
) suggesting that t-gD was functional in a blocking assay. A similar effect was not seen with 200 µg of BSA and truncated gD did not inhibit vesicular stomatitis virus (VSV) infection (not shown). Additionally, supernatant containing truncated BHV-1 gD specifically inhibited BHV-1, HSV-1 and PRV plaques (
60%). There was no apparent reduction in BHV-5 plaque numbers, consistent with the results obtained with MDBK cells expressing full-length BHV-1 gD (Dasika & Letchworth, 1999
).
|
4055% reduction (P<0·01) in plaque numbers of BHV-1, PRV and HSV-1 but not BHV-5 (Fig. 4bSince MDBKt-gD cells were continuously producing t-gD, we tested if cell-to-cell transmission of BHV-1 or BHV-5 was affected in these cells by measuring the sizes of plaques of BHV-1 and BHV-5 on MDBKt-gD cells and control MDBK cells. The plaque sizes were virtually identical in both the cell types with either virus (data not shown), suggesting that there was no significant inhibition of cell-to-cell transmission.
| Discussion |
|---|
|
|
|---|
60%) but had no apparent effect on BHV-5. This is consistent with our results obtained with MDBK cells expressing full-length BHV-1 gD (Dasika & Letchworth, 1999
The interference function required gD to be on the cell surface at the time of infection. Since MDBKt-gD and MDBKgD were constructed from the same parent cells and since both these cell lines express different forms of the same gD and the former unlike the latter are fully susceptible to infection, we conclude that truncation of gD resulted in loss of the interference function. Since pre-incubation of the susceptible MDBKt-gD cells with gD-containing medium partially restored the ability to resist infection (Fig. 4b
), it appears that retention of gD in/on the cells may be a prerequisite for interference. Studies with truncated HSV-1 gD demonstrated that incubation of HSV-1 with t-gD does not reduce the infectivity of the virus (Johnson et al., 1990
). Taken together, it appears that gD acts at the cell membrane possibly blocking a receptor at the time of infection to mediate a block. If the blocking function of gD is same as the interference function, these data suggest that the carboxyl 58 amino acids of gD may not be absolutely required (Fig. 4a
). Truncated gD was able to block herpesviral infections only to about 40% of the controls in MDBKt-gD cells when compared to 60% in MDBK cells. This is consistent with the speculation that gD receptors in MDBKt-gD may be slightly upregulated but the exact reason is unknown. Additionally, MDBKt-gD cells formed normal-size plaques, suggesting that there was no apparent block in cell-to-cell transmission. This is in contrast to our results with MDBKgD cells, which formed tiny plaques when infected with BHV-1 as well as BHV-5 (Dasika & Letchworth, 1999
). Several factors could have contributed to this result. The transmembrane (TM) and/or cytoplasmic (cyt) domain of gD may be required to inhibit cell-to-cell transmission. Since the m.o.i. was <0·01 and the cells neighbouring a particular infected cell would have continued to produce truncated gD even if host-cell protein synthesis was shut off in infected cells, and since the level of truncated gD was much higher than that of full-length gD in MDBKgD cells (Fig. 2
and data not shown), it can be speculated that truncation of gD eliminated the block in cell-to-cell transmission. Alternatively, since the level of inhibition of infection mediated by truncated gD is only a fraction of the interference due to full-length gD, then if the inhibition during cell-to-cell spread is proportionately less, our assay may not have been able to detect it. If the TM and cyt domains indeed code for a function associated with cell-to-cell transmission, it can be tested by constructing cells expressing chimeric gD that carry TM and cyt domains of heterologous glycoproteins, e.g. VSV G protein. We speculate that the block in cell-to-cell transmission mediated by full-length BHV-1 gD in MDBK cells is dependent on basolateral sorting of gD similar to HSV-1 gD, and truncation at amino acid 359 may have deleted the sorting signals of BHV-1 gD resulting in apical secretion of truncated gD from MDBKt-gD cells. Indeed we discovered a putative basolateral-targeting signal in the carboxyl terminus of gD (Table 1
). This would conceivably result in lack of t-gD at the basolateral surface resulting in no block in cell-to-cell transmission.
|
Y in the cytoplasmic domain targets it to the basolateral membrane where it is rapidly internalized through coated pits (Brewer & Roth, 1991
|
We speculate that MDBKt-gD cells were improperly targeting t-gD to the apical surface and thus there was no block in cell-to-cell transmission despite secretion of high levels of t-gD. Similarly, significantly more BHV-1 gD may be required to block BHV-5 and due to preferential basolateral sorting of gD (if true), MDBKgD cells were able to block cell-to-cell transmission of BHV-5 but not the initial infection. Construction of gD-expressing cell lines with a mutation in the putative basolateral targeting signal (Y-S-A-L) should allow us to define if the gD-mediated block in cell-to-cell transmission is dependent on basolateral targeting or if another functional domain in the TM or cyt domain is responsible. Similar to the proposed mechanism of gD-mediated interference, the gD-mediated block in cell-to-cell transmission may involve sequestering or blocking of a cellular factor present in the region of cell-to-cell contact that may or may not be identical to the cellular receptor/s required for initial entry.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Brandimarti, R., Huang, T., Roizman, B. & Campadelli-Fiume, G. (1994). Mapping of herpes simplex virus 1 genes with mutations which overcome host restrictions to infection. Proceedings of the National Academy of Sciences, USA 91, 5406-5410.
Brewer, C. B. & Roth, M. G. (1991). A single amino acid change in the cytoplasmic domain alters the polarized delivery of influenza viral hemagglutinin. Journal of Cell Biology 114, 413-421.
Brunetti, C. R., Burke, R. L., Kornfeld, S., Gregory, W., Dingwell, K. S., Masiarz, F. & Johnson, D. C. (1994). Herpes simplex virus glycoprotein D acquires mannose 6-phosphate residues and binds to mannose 6-phosphate receptors. Journal of Biological Chemistry 269, 17067-17074.
Brunetti, C. R., Burke, R. L., Hoflack, B., Ludwig, T., Dingwell, K. S. & Johnson, D. C. (1995). Role of mannose 6-phosphate receptors in herpes simplex virus entry into cells and cell-to-cell transmission. Journal of Virology 69, 3517-3528.
Campadelli-Fiume, G., Arsenakis, M., Farabegoli, F. & Roizman, B. (1988). Entry of herpes simplex virus 1 in BJ cells that constitutively express viral glycoprotein D is by endocytosis and results in degradation of the virus. Journal of Virology 62, 159-167.
Campadelli-Fiume, G., Qi, S., Avitabile, E., Foa-Tomasi, L., Brandimarti, R. & Roizman, B. (1990). Glycoprotein D of herpes simplex virus encodes a domain which precludes penetration of cells expressing the glycoprotein by superinfecting herpes simplex virus. Journal of Virology 64, 6070-6079.
Chase, C. C. L. & Letchworth, G. J. (1994). Bovine herpesvirus 1 gIV-expressing cells resist virus penetration. Journal of General Virology 75, 177-181.
Chase, C. C. L., Carter-Allen, K., Lohff, C. & Letchworth, G. J. (1990). Bovine cells expressing bovine herpesvirus 1 (BHV1) glycoprotein IV resist infection by BHV1, herpes simplex virus and pseudorabies virus. Journal of Virology 64, 4866-4872.
Chase, C. C. L., Lohff, C. & Letchworth, G. J. (1993). Resistance and susceptibility of bovine cells expressing herpesviral glycoprotein D homologs to herpesviral infection. Virology 194, 365-369.[Medline]
Cocchi, F., Menotti, L., Mirandola, P., Lopez, M. & Campadelli-Fiume, G. (1998). The ectodomain of a novel member of the immunoglobulin subfamily related to the poliovirus receptor has the attributes of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells. Journal of Virology 72, 9992-10002.
Collawn, J. F., Stangel, M., Kuhn, L. A., Esekogwu, V., Jing, S., Trowbridge, I. S. & Tainer, J. A. (1990). Transferrin receptor internalization sequence YXRF implicates a tight turn as the structural recognition motif for endocytosis. Cell 63, 1061-1072.[Medline]
Dasika, G. K. & Letchworth, G. J. (1999). Cellular expression of bovine herpesvirus 1 gD inhibits cell-to-cell spread of two closely related viruses without blocking their primary infection. Virology 254, 24-36.[Medline]
Dean, H. J., Terhune, S., Sheih, M.-T., Susmarski, N. & Spear, P. G. (1994). Single amino acid substitutions in gD of herpes simplex virus 1 confer resistance to gD-mediated interference and cause cell type-dependent alterations in infectivity. Virology 199, 67-80.[Medline]
Dean, H. J., Warner, M. S., Terhune, S. S., Johnson, R. M. & Spear, P. G. (1995). Viral determinants of the variable sensitivity of herpes simplex virus strains to gD-mediated interference. Journal of Virology 69, 5171-5176.
Eberle, W., Sander, C., Klaus, W., Schmidt, B., von Figura, K. & Peters, C. (1991). The essential tyrosine of the internalization signal in lysosomal acid phosphatase is part of a beta turn. Cell 67, 1203-1209.[Medline]
Engels, M., Giuliani, C., Wild, P., Beck, T. M., Loepfe, E. & Wyler, R. (1986). The genome of bovine herpesvirus 1 (BHV-1) exhibiting a neuropathogenic potential compared to known BHV-1 strains by restriction site mapping and cross-hybridization. Virus Research 6, 57-73.[Medline]
Fehler, F., Herrmann, J. M., Saalmuller, A., Mettenleiter, T. C. & Keil, G. M. (1992). glycoprotein IV of bovine herpesvirus 1-expressing cell line complements and rescues a conditionally lethal viral mutant. Journal of Virology 66, 831-839.
Geraghty, R. J., Krummenacher, C., Cohen, G. H., Eisenberg, R. J. & Spear, P. G. (1998). Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280, 1618-1620.
Huang, T. & Campadelli-Fiume, G. (1996). Anti-idiotypic antibodies mimicking glycoprotein D of herpes simplex virus identify a cellular protein required for virus spread from cell to cell and virus induced polykaryocytosis. Proceedings of the National Academy of Sciences, USA 93, 1836-1840.
Johnson, R. M. & Spear, P. G. (1989). Herpes simplex virus glycoprotein D mediates interference with herpes simplex virus infection. Journal of Virology 63, 819-827.
Johnson, D. C., Burke, R. L. & Gregory, T. (1990). Soluble forms of herpes simplex virus glycoprotein D bind to a limited number of cell surface receptors and inhibit virus entry into cells. Journal of Virology 64, 2569-2576.
Krummenacher, C., Nicola, A. V., Whitbeck, J. C., Lou, H., Hou, W., Lambris, J. D., Geraghty, R. J., Spear, P. G., Cohen, G. H. & Eisenberg, R. J. (1998). Herpes simplex virus glycoprotein D can bind to poliovirus receptor-related protein 1 or herpesvirus entry mediator, two structurally unrelated mediators of virus entry. Journal of Virology 72, 7064-7074.
Le Gall, A. H., Yeaman, C., Muesch, A. & Rodriguez-Boulan, E. (1995). Epithelial cell polarity: new perspectives. Seminars in Nephrology 15, 272-284.[Medline]
Li, Y., van Drunen Littel-van den Hurk, S., Babiuk, L. A. & Liang, X. (1995). Characterization of cell-binding properties of bovine herpesvirus 1 glycoproteins B, C, and D: identification of a dual cell-binding function of gB. Journal of Virology 69, 4758-4768.
Ligas, M. W. & Johnson, D. C. (1988). A herpes simplex virus mutant in which glycoprotein D sequences are replaced by
galactosidase sequences binds to but is unable to penetrate into cells. Journal of Virology 62, 1486-1494.
Ludwig, H. (1983). Bovine herpesviruses. In The Herpesviruses, pp. 135-214. Edited by B. Roizman. New York: Plenum.
Marshall, R. L., Rodriguez, L. L. & Letchworth, G. J. (1986). Characterization of the envelope proteins of infectious bovine rhinotracheitis virus (bovine herpesvirus 1) by biochemical and immunological methods. Journal of Virology 57, 745-753.
Montgomery, R. I., Warner, M. S., Lum, B. J. & Spear, P. G. (1996). Herpes simplex virus entry into cells mediated by a novel member of the TNF/NGF receptor family. Cell 87, 427-436.[Medline]
Nicola, A. V., Willis, S. H., Naidoo, N. A., Eisenberg, R. J. & Cohen, G. H. (1996). Structure-function analysis of soluble forms of herpes simplex virus glycoprotein D. Journal of Virology 70, 3815-3822.
Petrovskis, E. A., Meyer, A. L. & Post, L. E. (1988). Reduced yield of infectious pseudorabies virus and herpes simplex virus from cell lines producing viral glycoprotein gp50. Journal of Virology 62, 2196-2199.
Rauh, I. & Mettenleiter, T. C. (1991). Pseudorabies virus glycoproteins gII and gp50 are essential for virus penetration. Virology 65, 5348-5356.
Rodriguez-Boulan, E. & Zurzolo, C. (1993). Polarity signals in epithelial cells. Journal of Cell Science (Suppl.)17, 912.
Roizman, B., Desrosiers, R. C., Fleckenstein, B., Loprez, C., Minson, A. C. & Studdert, M. J. (1992). The family herpesviridae, an update. Archives of Virology 123, 425-449.[Medline]
Spear, P. G. (1993a). Entry of alphaherpesviruses into cells. Seminars in Virology 4, 167-180.
Spear, P. G. (1993b). Membrane fusion induced by herpes simplex virus. In Viral Fusion Mechanisms, pp. 201-232. Edited by J. Bentz. Boca Raton: CRC Press.
Spear, P. G., Shieh, M.-T., Herold, B. C., WuDunn, D. & Koshy, T. I. (1992). Heparan sulfate glycosaminoglycans as primary cell surface receptors for herpes simplex virus. In Heparin and Related Polysaccharides, pp. 341-353. Edited by D. A. Lane. New York: Plenum.
Srinivas, R. V., Balachandran, N., Alonso-Caplen, F. V. & Compans, R. W. (1986). Expression of herpes simplex virus glycoproteins in polarized epithelial cells. Journal of Virology 58, 689-693.
Thaker, S. R., Stine, D. L., Zamb, T. J. & Srikumaran, S. (1994). Identification of a putative cellular receptor for bovine herpesvirus 1. Journal of General Virology 75, 2303-2309.
Thomas, D. C., Brewer, C. B. & Roth, M. G. (1993). Vesicular stomatitis virus glycoprotein contains a dominant cytoplasmic basolateral sorting signal critically dependent upon a tyrosine. Journal of Biological Chemistry 268, 3313-3320.
Tikoo, S. K., Fitzpatrick, D. R., Babiuk, L. A. & Zamb, T. J. (1990). Molecular cloning, sequencing, and expression of functional bovine herpesvirus 1 glycoprotein IV in transfected bovine cells. Journal of Virology 64, 5132-5142.
Warner, M. S., Geraghty, R. J., Martinez, W. M., Montgomery, R. I., Whitbeck, J. C., Xu, R., Eisenberg, R. J., Cohen, G. H. & Spear, P. G. (1998). A cell surface protein with herpesvirus entry activity (HveB) confers susceptibility to infection by mutants of herpes simplex virus type 1, herpes simplex virus type 2, and pseudorabies virus. Virology 246, 179-189.[Medline]
Weiss, R. A. (1993). Cellular receptors and viral glycoproteins involved in retrovirus entry. In The Retroviridae, pp. 1-108. Edited by J. Levy. New York: Plenum.
Whitbeck, J. C., Peng, C., Lou, H., Xu, R., Willis, S. H., Ponce de Leon, M., Peng, T., Nicola, A. V., Montgomery, R. I., Warner, M. S., Soulika, A. M., Spruce, L. A., Moore, W. T., Lambris, J. D., Spear, P. G., Cohen, G. H. & Eisenberg, R. J. (1997). Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the tumor necrosis factor receptor superfamily and a mediator of HSV entry. Journal of Virology 71, 6083-6093.
Yates, W. D. G. (1982). A review of infectious bovine rhinotracheitis, shipping fever pneumonia and viralbacterial synergism in respiratory disease of cattle. Canadian Journal of Comparative Medicine 46, 225-263.
Zhu, X. & Letchworth, G. J. (1996). Mucosal and systemic immunity to bovine herpesvirus-1 glycoprotein D confer resistance to viral replication and latency. Vaccine 14, 61-69.[Medline]
Received 5 August 1999;
accepted 10 December 1999.
This article has been cited by other articles:
![]() |
F. Meurens, F. Schynts, G. M. Keil, B. Muylkens, A. Vanderplasschen, P. Gallego, and E. Thiry Superinfection Prevents Recombination of the Alphaherpesvirus Bovine Herpesvirus 1 J. Virol., April 15, 2004; 78(8): 3872 - 3879. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nixdorf, B. G. Klupp, and T. C. Mettenleiter Role of the cytoplasmic tails of pseudorabies virus glycoproteins B, E and M in intracellular localization and virion incorporation J. Gen. Virol., January 1, 2001; 82(1): 215 - 226. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |