|
|
||||||||
Insect |
Department of Microbiology, School of Medical Sciences, Otago University, PO Box 56, Dunedin, New Zealand1
AgResearch, Canterbury Agricultural and Science Centre, Lincoln, New Zealand2
Author for correspondence: James Kalmakoff. Fax +64 3 479 8540. e-mail james.kalmakoff{at}stonebow.otago.ac.nz
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Wiseana species are significant lepidopteran pests of pastoral farming in New Zealand (Barratt et al., 1990
; French, 1973
). An NPV isolated from this insect genus in 1962 (Steinhaus & Marsh, 1962
; Entwistle & Robertson, 1968
) has been shown to be this insects most important microbial pathogen, advancing hopes to develop a biological agent against Wiseana. To work towards this aim, we are investigating the molecular biology of the Wiseana NPV.
The genomes of four NPVs have now been completely sequenced, providing data to explore diversity within this virus group. The four NPVs from Autographa californica (AcMNPV; Ayres et al., 1994
), Orgyia pseudotsugata (OpMNPV; Ahrens et al., 1997
), Lymantria dispar (LdMNPV; Kuzio et al., 1999
) and Bombyx mori (BmMNPV; Gomi et al., 1999
) are all morphologically similar. The viral nucleocapsids are enveloped and embedded as multiples within the occlusion bodies (designated MNPV) and, with the exception of LdMNPV, the viruses are part of the same phylogenetic subdivision (Group I) of the NPV genus (Zanotto et al., 1993
). The Wiseana NPV is morphologically and phylogenetically distinct from these other NPVs. The virion is enveloped singly within the occlusion body (designated SNPV), and phylogenetic analysis of the Wiseana SNPV polyhedrin (polh) gene indicates that it is related to a separate subdivision of the NPV (the Group II NPVs) (Sadler et al., 1998
). In addition, polh phylogeny suggests that the Wiseana SNPV has no close relation among previously characterized NPVs. The Wiseana SNPV is therefore an interesting isolate that may offer a unique perspective to baculovirus biology.
The genomes of AcMNPV, BmMNPV, OpMNPV and LdMNPV differ to varying degrees. However, blocks of genes are conserved between all four NPV genomes. The genes within the blocks are consistent in their occurrence and relative orientation, although the location and the relative orientation of each block varies between the genomes. This pattern of conserved gene blocks interspersed with variable regions is a major phenomenon in the evolution of genomes (Casjens et al., 1992
; Hannenhalli et al., 1995
). We were interested in comparing the arrangement of the genome of Wiseana SNPV to other NPVs to gauge the conservation of gene order in this unique NPV.
The genome from an SNPV isolated from Wiseana signata (WisiSNPV) was cloned and physically mapped by Southern hybridization and restriction endonuclease analysis. The map was confirmed by sequence analysis and the sequence generated was compared to baculoviral sequences in the GenBank database. Homologous ORFs were located on the viral genome and the genetic map of WisiSNPV was compared to the genomes of AcMNPV, OpMNPV and LdMNPV.
| Methods |
|---|
|
|
|---|
Isolation of WisiSNPV.
Isolation and cloning of the WisiSNPV genome.
The viral genome was purified from viral occlusions isolated from a single larva using the method of OReilly et al. (1992)
with minor modifications to exclude humic compounds collected with the insect larvae.
The purified viral genome was restricted with HindIII or BamHI (Roche), and digestion products were separated by horizontal electrophoresis in 1x TAE buffer, through a 1% agarose gel at 50 V. DNA fragments separated by electrophoresis were visualized with UV light after staining with ethidium bromide (1 µg/ml) and recorded using a GDS 5000 gel documentation system (Ultraviolet Products). Electrophoresis buffers were prepared as described by Sambrook et al. (1989)
. To avoid samples that contained several different virus strains, DNA that had submolar fragments within the restriction profile of the viral genome were excluded from subsequent cloning experiments.
To clone the WisiSNPV genome, DNA restricted with HindIII or BamHI was ligated, using T4 DNA ligase (New England Biolabs), into the pBluescript II KS(-) vector (Stratagene) that had been digested with the equivalent enzyme and then dephosphorylated using HK Thermolabile Phosphatase (Epicentre Technologies). Ligation products were ethanol-precipitated and resuspended in H2O then electroporated into DH5
competent Escherichia coli cells (Dower, 1988
) using an E. coli TransPorator (BTX). Recombinant plasmids were detected as white bacterial colonies by plating transformed E. coli onto LB media supplemented with 100 µg/ml ampicillin (Sigma), X-Gal and IPTG (Gold BioTechnology). Recombinant plasmids were initially visualized and segregated into size classes by colony cracking. Bacterial colonies were incubated in 25 µl disruption buffer [50 mM NaOH, 0·5% SDS, 5 mM EDTA (pH 8·0), 10% glycerol and 0·01% bromocresol green] at 65 °C for 30 min. The cell lysate was electrophoresed and stained with ethidium bromide to visualize the DNA. Where possible, multiples of all genome fragments were prepared by alkali lysis (Sambrook et al., 1989
) for further characterization.
Physical mapping of the WisiSNPV genome.
The WisiSNPV genome was reassembled from cloned restriction fragments by linking the BamHI and HindIII libraries using Southern hybridization. Southern hybridizations were carried out by fixing the restricted viral genome and all cloned DNAs digested with BamHI or HindIII onto Hybond-N nylon membranes (Amersham). DNA probes were prepared by restricting cloned viral genome fragments and electrophoresis followed by gel purification using a QIAEX II Gel Extraction kit (Qiagen). Probe fragments were randomly labelled with radioactive [35P]dCTP using the RTS RadPrime DNA Labelling System (GibcoBRL). All hybridizations followed the protocols recommended by the manufacturer of the membrane and the probes were detected by autoradiography using Cronex (Kodak) film.
All recombinant plasmids were characterized by single and multiple restriction with HindIII, BamHI and EcoRI. The locations of ambiguous restriction endonuclease sites were clarified using PstI or SalI. The distribution of restriction sites within a clone was used to confirm and define the overlap between HindIII and BamHI cloned fragments detected by hybridization analysis.
To verify the junctions between clones, the termini of all cloned genome fragments were sequenced. Sequencing was performed with a Prism ready DyeDeoxy termination cycle sequencing kit (Applied Biosystems) and the T7 and T3 primers. These were then electrophoresed using an ABI 377-XL automated DNA sequencer (Applied Biosystems) according to the manufacturers instructions. DNA primers designed from the terminal sequence data were used to sequence the region between contiguous HindIII clones by one of two methods. In the first method, the junction between HindIII clones was sequenced directly from the overlapping BamHI library. In the second method, primer pairs from contiguous HindIII clones were used to amplify portions of the virus genome which were then sequenced with one of the primers used in the PCR or, alternatively, cloned into pBluescript KS(-) by TA cloning and then sequenced from the vectors universal sequencing primers. For TA cloning, vectors were prepared by restriction with EcoRV to create blunt ends then T tailing. The cut plasmid DNA was then incubated at 72 °C in 1x PCR buffer (Roche) with 100 mM dTTP (GibcoBRL) and Taq polymerase (Roche) for 30 min. DNA primers were synthesized by GibcoBRL and used at 0·2 µM with 200 µM of each dNTP and 2·5 U Taq DNA polymerase (Roche) in the buffer supplied. The PCR thermal profile generally consisted of an initial incubation at 95 °C for 1 min, followed by 30 cycles of 15 s at 95 °C, 15 s at 60 °C, 1 min at 72 °C, then a final 5 min incubation at 72 °C using a Hybaid OmniGene thermal cycler. To amplify longer PCR products, the Roche Long Template PCR System was used with buffer 1 and an altered dNTP concentration of 350 µM. This reaction mixture was used with a thermal profile consisting of a 2 min denaturation step at 94 °C, followed by 10 cycles of 10 s at 94 °C, a 30 s annealing step at 65 °C and an 8 min elongation at 68 °C, then an additional 20 cycles with a 20 s addition to the elongation at each cycle. PCR products were purified using the High Pure PCR Product Purification kit (Roche).
Genetic mapping of the WisiSNPV genome.
Nucleotide sequence generated at the termini of cloned genome restriction fragments was edited with EditView 1.0.1 (Applied Biosystems) and GeneJockey 1.2.0 (Biosoft). These were then compared to GenBank databases using the BLAST 2.0 algorithm (Altschul et al., 1998
). Gapped BLASTN and BLASTX searches were performed using both the entire GenBank database and just baculovirus sequences within the database. Homologous putative ORFs identified were positioned on the WisiSNPV physical map to produce a limited genetic map of the viral genome.
The circular NPV genomeis traditionally described as starting at the polh gene. In order to locate polh within the genome of WisiSNPV, a portion of the gene was amplified (with the primers 5' GCGAGTCATCAAGAATGCC and 5' TACCTTGTTGATGAAGTGCTCG) and used as a DNA probe to locate polh within restriction digests of the viral genome and the cloned genomic libraries. The orientation of the polh ORF was determined by sequence analysis of the appropriate clone.
Characteristic features of baculoviral genomes are homologous repeat sequences (hrs). Matrix analysis was used to detect palindromic hrs within the WisiSNPV genome. The sequence generated from the WisiSNPV genome was compared to itself or its complementary strand with a 24 nucleotide sliding window at 88% identity using the GCG programs and GCGFIGURE (Genetics Computer Group).
| Results |
|---|
|
|
|---|
|
Despite the apparent genetic homogeneity of the sample, some variability was detected between cloned genome fragments. The most notable instance was the HindIII restriction fragment A. This clone (pHdA) lacked an anticipated BamHI site. This discrepancy could not be resolved as this fragment of the genome was isolated only once, was too large (23 kbp) to amplify using PCR, and the overlapping BamHI fragments were not isolated. Insufficient viral DNA was purified from a single insect larva to allow additional analysis, such as restriction endonuclease analysis of genome fragments purified from agarose gels. Clone pHdA was retained, but this discrepancy has been noted in the physical map (Fig. 1
).
|
Sequence analysis at the termini of all cloned DNAs provided direct and indirect support for the proposed physical map. Indirect endorsement of the map was produced by joining sequences generated from the termini of separate cloned genome fragments in order to reconstitute putative ORFs identified by BLAST searches. For instance, the nucleotide sequences at the T7 primed terminus of the clone pHdB together with the T7 terminal sequence of pHdG constituted different halves of the putative p74 ORF (Table 2
). Sequencing also confirmed directly that two genome fragments were contiguous. An example of this was the sequence from the T3 primed terminus of the cloned BamHI fragment H, which aligned with both the T3 primed sequence from pHdC and the T7 primed sequence from pHdD (Fig. 1
). Finally, by amplifying and sequencing the appropriate section from the intact viral genome, the junctions between the remaining putative contiguous HindIII clones were verified.
|
The HindIII fragment D contained the polh gene and so is defined as the start of the circular physical map of the WisiSNPV. The direction of the polh ORF within HindIII D was ascertained by sequencing a 7·1 kbp EcoRI and BamHI subclone coded pSCD (Table 2
). The start of the physical map of the WisiSNPV genome was orientated starting at the EcoRI site immediately upstream of the polh ORF (Fig. 1
).
Genetic map of the WisiSNPV genome
In total, 20 kb of predominantly single-strand sequence was generated from the cloned BamHI and HindIII restriction fragments. Sequence data are available to interested parties by contacting the corresponding author. The sequence constitutes approximately 16% of the WisiSNPV genome. Half of this sequence had no significant sequence match to nucleotide or protein databases. Sequence analysis predicted that all the sequences primed from clone termini, with the exception of the T3 primed sequence of pHdD, contained or were within predicted ORFs. Seventeen putative ORFs were identified with similarity to ORFs from nine other baculoviruses. These homologous putative ORFs are listed in Table 2
.
During sequence analysis, a putative inhibitor of apoptosis (IAP) was identified at the T3 primed terminus of the HindIII genome fragment C (Table 2
). The four different classes of IAP described had distinctly different levels of identity with the WisiSNPV sequence. Because the WisiSNPV putative IAP sequence had the highest identity to the class three IAPs from CpGV, OpMNPV, CfNPV and BusuSNPV (with BLASTX scores of 1e-38, 2e-38, 5e-35 and 4e-37, respectively), it has been tentatively designated a class three IAP.
There was little hybridization data to support the existence of hrs. The HindIII genome fragment K may be the only possible exception as this fragment hybridized weakly to the BamHI fragments D, F and G (data not shown). Dot matrix analysis of all sequence data did not detect any hrs.
All putative homologues recognized from the sequence of WisiSNPV were positioned on the virus physical map to generate a genetic map of the viral genome. Fig. 2
contrasts the genetic map of WisiSNPV with those of AcMNPV, OpMNPV and LdMNPV.
|
| Discussion |
|---|
|
|
|---|
The Wiseana SNPV was isolated from field-collected insects because no laboratory method exists to culture the virus. Efforts were made to isolate a pure NPV strain. This was an important consideration as heterogeneity could confound efforts to reconstruct the viral genome from cloned DNAs. To achieve a pure strain, Wiseana larvae were collected over three consecutive years and screened to exclude samples with mixed NPV strains. A previous study (Sadler et al., 1998
) reported that insects collected in the first and second year were infected with several strains of SNPV. Insects collected in the third year appeared to be infected with a single strain of SNPV (Fig. 1
), and so were used to clone the virus genome.
To further avoid heterogeneous viral genomes, SNPVs were isolated from a single insect. Consequently only small amounts of the viral DNA were purified, prompting the adoption of a simple cloning strategy. The WisiSNPV genome was isolated as fully digested restriction fragments. To ensure restriction fragments were not missed, the cloned HindIII genome library was referenced against an overlapping cloned BamHI library and genome fragments were amplified from the intact viral genome using PCR.
The genome of WisiSNPV was calculated to be 128 kbp. This value is 17 kbp larger than our previous estimate (Sadler et al., 1998
). The value given here has been calculated by restriction analysis of each cloned genome fragment and so is more accurate than the previous estimate which was determined by analysis of the entire viral genome (Table 1
). In addition, several genome fragments were isolated which were previously obscured as doublets within the restricted virus genome.
This estimation of the WisiSNPV genome size was 18 kbp larger than that calculated by Burgess (1977)
for an NPV isolated from Wiseana cervinata. We believe that the discrepancy between our estimate and that of Burgess is due to methodology differences rather than genomic differences between the virus isolates. The estimate was deduced by Burgess using EM analysis of the DNA molecule rather than by restriction analysis as was used here. It is noted that a recent estimate of the size of the Epiphyas postvittana MNPV (EppoMNPV) genome calculated by restriction enzyme analysis (Hyink et al., 1998
) also differed from Burgess estimate for EppoMNPV by a similar margin.
Approximately 20 kb of ssDNA sequence was derived from the genome of WisiSNPV. From this sequence, only 17 putative homologues were recognized by BLAST searches (Table 2
). These matches were almost exclusive to the Baculoviridae. Because we assumed that the majority of WisiSNPV genes would be represented in some form within other NPV genomes, it was surprising that less than half of the WisiSNPV sequence matched the database. The low proportion of homologous sequence was most likely due to the incomplete nature of the WisiSNPV sequence generated and its variance compared to other NPVs rather than to heterogeneous gene content. In many instances only partial ORFs have been sequenced and compared to the databases. In addition, variance of the WisiSNPV sequence from that within the database also made detection of homologous ORFs difficult. The usually conserved polh gene differs considerably between WisiSNPV and other NPVs (Sadler et al., 1998
). Therefore, less constrained genes are likely to have such low identity that homologies may not be recognized by the BLAST algorithm. Predictably, all of the putative ORFs recognized from the database coded for genes for which the sequence is conserved between different NPVs. Even then, the sequence from WisiSNPV still deviated significantly from that of other NPVs. A corresponding low degree of homology was found for sequence from the Xestria c-nigrum GV (XcGV) (Goto et al., 1998
). In this instance, only half of the XcGV sequence was homologous with sequences in databases. It would be reasonable to expect higher sequence identities for WisiSNPV than for the GV because the majority of the baculovirus database contains sequences from NPVs. WisiSNPV is, however, phylogenetically quite distinct from other characterized NPVs (Sadler et al., 1998
).
Phylogenetic analysis of NPVs based on the polh gene delineated two taxonomic divisions designated Groups I and II (Zanotto et al., 1993
). Three of the four genomes that have been completely sequenced (AcMNPV, BmMNPV and OpMNPV) are classified as Group I NPVs. LdMNPV is the only virus from Group II that has been completely sequenced. The level of homology between the WisiSNPV sequence and those in the databases reflects these relationships, with eight of the 17 putative homologues identified most closely matching LdMNPV sequences: p74, ie-0, orf46, occlusion-derived virion (ODV) e25, p18, lef5, orf99 and polh.
Of the remaining ten homologous putative ORFs, five had the highest affinity to partial sequence from other Group II NPVs: pk-1 from Spodoptera litura SNPV (SlSNPV), a theoretical protein as well as helicase from Spodoptera exigua MNPV (SeMNPV), DNA pol from Helicoverpa zea SNPV (HzSNPV) and polh from an SNPV from Buzura suppressaria (BusuSNPV). Interestingly, two ORFs had the highest identity to sequence from the CpGV: a putative signal protein and iap3. Three ORFs had the highest homology to sequences from the Group I NPVs: major capsid protein (MCP) vp39 from OpMNPV, gp64 from AcMNPV and ie-1 from BmMNPV. The low sequence identity to other NPVs reinforces the findings from a previous study predicting that WisiSNPV is a distinctly different NPV (Sadler et al., 1998
).
The uniqueness of WisiSNPV was further explored by investigating gene arrangements on the viral genome. The 17 putative gene homologues identified by BLAST analysis were positioned on the WisiSNPV physical map to produce a partial genetic map (Fig. 2
). The genetic map of WisiSNPV was compared to the genome arrangements of AcMNPV, OpMNPV and LdMNPV.
Four blocks of genes were conserved between the genomes of AcMNPV, OpMNPV and LdMNPV: (a) p74 to ie-1; (b) polh and pk-1; (c) vp39 to lef5; and (d) DNA pol to iap2 (Fig. 2
). These, and an additional four gene blocks, were also apparent in partial sequence analysis of the BusuSNPV genome (Hu et al., 1998
). As putative ORFs relevant to four gene blocks conserved between AcMNPV, OpMNPV and LdMNPV were also identified here, we were able to determine their preservation in the genome of WisiSNPV. Only the vp39lef5 region was conserved in the WisiSNPV genome (Fig. 2
). Jehle & Backhaus (1994)
demonstrated that this region is also conserved in a GV isolated from Cryptophlebia leucotreta. The conservation of this region between such diverse baculoviruses led Heldens et al. (1998)
to predict that this region may be conserved in all baculoviruses. The partial genetic map of WisiSNPV supports this prediction.
This proposed pattern of genome evolution, where diverse genomes have a conserved core and vary most in the flanking sequence, is analogous to patterns recognized within a number of other large dsDNA viruses such as the herpesviruses (Gompels et al., 1995
). The mechanisms producing the patterns of genome conservation in NPVs may be due to functional constraints or alternatively may reflect the manner in which baculoviral genomes replicate.
This analysis shows that the WisiSNPV is significantly different from other NPVs characterized to date. The partial genetic map presented here shows that the viral genome has a unique arrangement, with only the arrangement of the vp39lef5 region being similar to that recorded from other NPV genomes. These findings support previous analysis that suggest that WisiSNPV is a distinct NPV species.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L., Scaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1998). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402.
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605.[Medline]
Barratt, B. I. P., van Toor, R. F., Ferguson, R. F. & Stewart, K. M. (1990). Grass grub and porina in Otago and Southland. A guide to management and control, pp. 104. Dunedin: MAF Technology, New Zealand Tablet.
Burgess, S. (1977). Molecular weights of lepidopteran baculovirus DNAs: derivation by electron microscopy. Journal of General Virology 37, 501-510.
Casjens, S., Hatfull, G. & Hendrix, R. (1992). Evolution of dsDNA tailed-bacteriophage genomes. Seminars in Virology 3, 383-397.
Dower, W. J. (1988). Transformation of E. coli to extremely high efficiency by electroporation. Molecular Biology Reports 6, 3-4.
Entwistle, P. F. & Robertson, J. S. (1968). An unusual nuclearpolyhedrosis virus from larvae of a Hepialid moth. Journal of Invertebrate Pathology 11, 487-495.
French, R. A. (1973). Some aspects of the biology, population dynamics and economic status of Wiseana cervinata (Lepidoptera: Hepialidae). PhD thesis, University of Canterbury, New Zealand.
Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323-1337.[Abstract]
Gompels, U. A., Nicholas, J., Lawrence, G., Jones, G., Thomson, B. J., Martin, M. E. D., Efstathiou, S., Craxton, M. & Macaulay, H. A. (1995). The DNA sequence of human herpesvirus-6: structure, coding content and genome evolution. Virology 209, 29-51.[Medline]
Goto, C., Hayakawa, T. & Maeda, S. (1998). Genome organization of Xestria c-nigrum granulovirus. Virus Genes 16, 199-210.[Medline]
Hannenhalli, S., Chappey, C., Koonin, E. V. & Pevzner, P. A. (1995). Genome sequence comparison and scenarios for gene rearrangements: a test case. Genomics 30, 299-311.[Medline]
Heldens, J. G. M., Liu, Y., Zuidema, D., Goldbach, R. W. & Vlak, J. M. (1998). A highly conserved genomic region in baculoviruses: sequence analysis of an 11·3 kbp DNA fragment (46·5 55·1 m.u.) of the Spodoptera exigua multicapsid nucleopolyhedrovirus. Virus Research 55, 187-198.[Medline]
Hu, Z. H., Arif, B. M., Jin, F., Martens, J. W. M., Chen, X. W., Sun, J. S., Zuidema, D., Goldbach, R. W. & Vlak, J. M. (1998). Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome. Journal of General Virology 79, 2841-2851.[Abstract]
Hyink, O., Graves, S., Fairbairn, F. M. & Ward, V. K. (1998). Mapping and polyhedrin gene analysis of the Epiphyas postvittana nucleopolyhedrovirus genome. Journal of General Virology 79, 2853-2862.[Abstract]
Jehle, J. A. & Backhaus, H. (1994). Genome organization of the DNA-binding protein gene region of Cryptophlebia leucotreta granulosis virus is closely related to that of nuclear polyhedrosis viruses. Journal of General Virology 75, 1815-1820.
Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. M. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 17-34.[Medline]
OReilly, D. R., Miller, L. K. & Luckow, V. A. (1992). Baculovirus Expression Vectors: A Laboratory Manual. New York: W. H. Freeman.
Sadler, T. J., Ward, V. K., Glare, T. & Kalmakoff, J. (1998). Examination of New Zealands endemic Wiseana nucleopolyhedrovirus by analysis of the viral polyhedrin gene. Archives of Virology 143, 2273-2288.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. New York: Cold Spring Harbor Laboratory Press.
Steinhaus, E. A. & Marsh, G. A. (1962). Report of diagnoses of diseased insects, 19511961. Hilgardia 33, 344-490.
Zanotto, P. M., Kessing, B. D. & Maruniak, J. E. (1993). Phylogenetic interrelationships among baculoviruses: evolutionary rates and host associations. Journal of Invertebrate Pathology 62, 147-164.[Medline]
Received 7 September 1999;
accepted 14 December 1999.
This article has been cited by other articles:
![]() |
O. Hyink, R. A. Dellow, M. J. Olsen, K. M. B. Caradoc-Davies, K. Drake, E. A. Herniou, J. S. Cory, D. R. O'Reilly, and V. K. Ward Whole genome analysis of the Epiphyas postvittana nucleopolyhedrovirus J. Gen. Virol., April 1, 2002; 83(4): 957 - 971. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |