|
|
||||||||
Insect |
Chuo-Sanken Laboratory, Katakura Industries Co. Ltd, 1548 Shimo-Okutomi, Sayama, Saitama 350-1332, Japan1
Laboratory of Molecular Bioengineering, Faculty of Engineering, Mie University, 1515 Kamihama-cho, Tsu, Mie 514-8507, Japan2
Author for correspondence: Toshimichi Kanaya. Fax +81 42 954 2172. e-mail katakura{at}za2.so-net.ne.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In this paper, we describe the purification of a haemolymph protein of silkworm that promotes BmNPV replication and polyhedrin promoter-mediated gene expression in vitro. In addition, we report the successful cloning and sequencing of the cDNA encoding this novel insect haemolymph protein.
| Methods |
|---|
|
|
|---|
Insect cell culture and virus.
A recombinant BmNPV, CPd-luci (Suzuki et al., 1997
), was used for estimating virus replication and the level of polyhedrin promoter-mediated gene expression by measuring luciferase activity. In this recombinant virus, the luciferase gene from the firefly, Photinus pyralis (de Wet et al., 1987
), has been introduced just downstream of the polyhedrin promoter, and the viral cysteine protease gene (vcath) has been deleted.
Purification of the promoting protein (PP).
Several abdominal prolegs of the fifth instar larvae 2 days after ecdysis were cut off, and haemolymph was collected into a tube on ice. After incubation in a water bath at 65 °C for 30 min, the haemolymph was centrifuged at 12000 g for 20 min. The supernatant was filtered through a 0·45 µm mesh and stored at -80 °C. To separate protein components in the supernatant, gel filtration chromatography was carried out at 4 °C as follows. The stored supernatant (10 ml) was applied to a Sephadex G-200 column (ø 2·5x40 cm), pre-equilibrated with 10 mM phosphate buffer containing 200 mM NaCl, pH 7. Elution was performed with the same buffer at a flow rate of 20 ml/h and fractions containing 5 ml of effluent were collected. Those fractions that were positive in the assay for promoting activity were further separated by ion exchange chromatography performed at room temperature using an HPLC system (JASCO Co.) as follows. The positive fractions were applied to Biofine CM (JASCO Co.) pre-equilibrated with 10 mM phosphate buffer containing 200 mM NaCl, pH 7, at a flow rate of 1 ml/min. After washing the column with the same buffer for 15 min, the elution was performed with a linear gradient of 0·21 M NaCl for 25 min, and fractions containing 2·5 ml of effluent were collected. For each fraction, promoting activity was assayed and protein components were analysed by SDSPAGE.
Assays for promoting activity.
During the purification of PP, promoting activities of (i) haemolymph, (ii) its chromatographic fractions and (iii) the purified PP were assayed using BoMo cells cultured in the medium containing one of the above and infected with recombinant BmNPV (CPd-luci) by measuring and comparing luciferase activities in the cells and/or virus titres in the culture supernatants as follows.
For assaying promoting activity of the silkworm haemolymph and its chromatographic fractions, BoMo cells were suspended at a density of 2x105 cells/ml in MM medium containing 3% FBS, and 200 µl of the suspension was seeded in each well of a 96-well plate (Nunc). Then, 10 µl of heat-treated haemolymph or its fractions were added to the respective wells, and the cells in each well were inoculated with the recombinant BmNPV, CPd-luci, at an m.o.i. of 3. After 5 days of incubation at 25 °C, the cells were harvested from each well and used in the luciferase assay.
For assaying promoting activity of the purified PP, 10 suspensions of BoMo cells at a density of 2x105 cells/ml in MM medium containing 3% FBS and different concentrations of the purified PP (0, 0·001, 0·005, 0·01, 0·05, 0·1, 0·5, 1, 5 and 10 µg PP/ml) were prepared. Then, CPd-luci was inoculated into each cell suspension at an m.o.i. of 3. After 2 h of incubation at 25 °C, the medium containing the virus in each suspension was removed by centrifugation at 3000 g for 10 min. The cells were washed twice with MM medium and resuspended in the same volume of fresh media containing respective concentrations of PP as those before virus inoculation. One ml of each cell suspension was transferred into a well of a 24-well plate. The plates were incubated at 25 °C. At 5 days post-inoculation, the cells and medium in each well were harvested together and separated by centrifugation at 3000 g for 10 min.
Luciferase assay.
The pellets of BoMo cells were lysed in cell lysis buffer (25 mM HEPES pH 7, 2 mM DTT, 2 mM 1,2-diaminocycloheamin, 10% glycerol, 1% Triton X-100) at room temperature for 20 min, and then centrifuged at 10000 g for 10 min. One hundred µl of substrate mixture (50 mM HEPES pH 7·5, 15 mM MgSO4, 5 mM ATP, 1 mM Luciferin) was added to 50 µl of supernatant of the cell lysate in a luminometer cuvette by an auto-injector, and the luciferase activity was measured using a luminometer (Rurmat, Berdol Japan Co.) as relative light units (RLU) per 10 s.
Virus titration.
BoMo-II cells (104) suspended in 50 µl of MGM-448 medium containing 10% FBS were seeded in each well of a 96-well plate. Tenfold serial dilutions of the culture supernatant of BoMo cells infected with CPd-luci were prepared with the same medium and 50 µl of each dilution was added to a well (eight wells for each dilution). The plates were incubated at 25 °C for 7 days. The number of wells containing infected BoMo-II cells showing obvious cytopathic effects were counted by microscopic observation to calculate the TCID50 of each culture supernatant according to Reed & Muench (1938)
.
Determination of protein concentration.
Protein concentration was determined using the DC protein assay kit (Bio-Rad) with BSA as a standard.
SDSPAGE.
This was carried out according to Laemmli (1970)
using a 15% polyacrylamide separating gel. The proteins resolved in the gel were detected by a silver staining kit (Wako).
Molecular mass determination of PP.
The molecular mass of the native PP was determined by comparing the relative mobility of the purified PP to marker proteins in the LMW Electrophoresis Calibration kit (Pharmacia) using Biofine PO-60 (JASCO Co.) column chromatography. The molecular mass of the denatured PP was estimated by SDSPAGE.
Determination of the N-terminal amino acid sequence of PP.
The purified PP resolved in an SDSpolyacrylamide gel was blotted onto a PVDF membrane (Bio-Rad) using a Trans-Blot transfer cell (Bio-Rad) and stained with Coomassie brilliant blue R250 (Merck). The band of PP was cut out and used for direct sequencing of N-terminal amino acids by a peptide sequencer (ABI, model 473A).
Cloning of PP cDNA.
The first-strand cDNA was synthesized using reverse transcriptase and oligo-dT from total RNA purified from the fat bodies of fifth instar larvae using ISOGEN-LS (Nippongene). For the amplification of PP cDNA, a PCR reaction with degenerate primers 5' gaSttYaaYgtNgt 3' (S=c and g; Y=c and t; and N=a, c, g and t), corresponding to nucleotide sequences deduced from the N-terminal amino acid sequence of PP, and oligo-dT was performed using the TAKARA RNA LA PCR kit (Takara). The PCR products were ligated into pBluescript II SK- and sequenced by the chain termination method using a DNA sequencing kit (ABI) to identify the PP cDNA. The upstream region of the cDNA including the 5' untranslated region and the coding region for the putative signal sequence of the PP was synthesized by the 5' RACE method using three primers: 5' tatgtaggtacatacacag 3', 5' atacaatatgtgagcagtttta 3' and 5' gcacagtcgactgttaaccacagggg 3' (complementary to nt 530550, nt 498520 and nt 165189, respectively, see Fig. 5
). The DNA fragments obtained by the 5' RACE method were ligated into pBluescript II SK- and sequenced to confirm the nucleotide sequence within overlapping regions. To exclude PCR-derived errors, the PP cDNA sequence was determined based on the predominant sequence among the 10 clones, which were sequenced completely in both directions.
|
Construction of a recombinant BmNPV expressing PP cDNA.
Preparation of rat antiserum against PP.
Purified PP (600 µg) was emulsified with Freunds complete adjuvant and injected subcutaneously into the leg of a rat. A booster injection with 500 µg of PP was performed 2 weeks after the first injection and blood was collected 2 weeks later. The serum was stored at -80 °C.
Immunoblot analysis of native and recombinant PP.
The purified native PP and the culture supernatant of BoMo-II cells infected with the recombinant BmNPV CPd-PP were resolved by SDSPAGE and blotted electrophoretically onto a nitrocellulose membrane using a Trans-Blot transfer cell (Bio-Rad). After blocking with 5% skim milk in PBS for 60 min, the membrane was incubated for 60 min in appropriately diluted rat antiserum raised against the purified native PP as above, and then washed with PBS containing 0·1% Tween 20 (PBST). The membrane was further incubated in PBST containing peroxidase-conjugated goat anti-rat IgG F(ab)2 fragment (1:1000 dilution, Wako) for 60 min. After washing, the immunoreactive bands were visualized with an ECL detection kit (Amersham).
| Results |
|---|
|
|
|---|
|
|
|
|
|
Nucleotide sequence of the cDNA encoding PP precursor and properties of recombinant PP expressed by a baculovirus vector
Using RTPCR and 5' RACE methods, we obtained several partial cDNA fragments encoding the PP precursor. By combining sequence data from these fragments, we reproduced the 615 bp PP cDNA shown in Fig. 6
. The cDNA contained a single long open reading frame (ORF) of 465 bp, 5' and 3' untranslated regions, and a poly(A) tail. In the deduced 154 amino acid sequence of the ORF, the sequence from amino acids 19 to 34 was completely consistent with the N-terminal 16 amino acids determined for the purified PP. The N-terminal 18 amino acids of the deduced sequence consisted of predominantly hydrophobic residues, such as alanine, leucine and phenylalanine. This suggests that the PP precursor encoded by the cDNA is composed of both a putative signal peptide of 18 amino acids at the N terminus and the mature PP polypeptide of 136 amino acids. The calculated molecular mass of 15266 Da for the mature PP was consistent with the estimated molecular mass of 15200 Da for the purified PP by SDSPAGE. A putative N-glycosylation site was found at amino acids 139141 (Fig. 6
, double underlined).
|
Immunoblot analysis of the culture supernatant of the BoMo-II cells infected with the recombinant BmNPV, CPd-PP, expressing the cDNA encoding PP precursor revealed that recombinant PP was similar in molecular mass and immunoreactivity to native PP (Fig. 7A
). Promoting activity of the purified recombinant PP determined by the luciferase assay was also comparable to that of native PP (Fig. 7B
).
|
| Discussion |
|---|
|
|
|---|
Several proteins enhancing NPV infection in vivo have been isolated from viral occlusion bodies. A protein component in the occlusion bodies of Pseudaletia unipuncta granulovirus (PuGV) called the synergistic factor (SF) enhanced P. unipuncta NPV (PuNPV) infection in the larvae (Tanada et al., 1973
). The PuGV SF can also enhance NPV infections in both P. separata and Spodoptera littoralis (Hukuhara et al., 1987
). The SF is a lipoprotein with a molecular mass of 126 kDa (Tanada, 1985
; Uchima et al., 1989
; Hukuhara & Zhu, 1989
). Similarly, occlusion bodies of Trichoplusia ni GV contain a protein factor named enhancin that can enhance NPV infection in T. ni larvae (Derksen & Granados, 1988
; Gallo et al., 1991
). Furthermore, Lepore et al. (1996)
confirmed that the 98 kDa enhancin is a metalloprotease that can digest the peritrophic membrane protein. An enhancing factor which enhanced NPV infection in larvae of the armyworm, P. separata, was purified from the spheroid of a P. separata entomopoxvirus, and characterized as a homogeneous glycoprotein of 38 kDa (Xu & Hukuhara, 1994
).
The PP isolated and purified from silkworm haemolymph in this study was clearly different in molecular mass and in biochemical nature from those enhancing or synergistic proteins derived from viral occlusion bodies. The PP was identified as a single polypeptide of 15·2 kDa. In the silkworm larvae, the PP is probably synthesized in the fat body, although we have not yet examined other tissues, secreted into the haemolymph and maintained at concentrations of more than 10 µg/ml throughout the fifth instar larval stage. Thus, it is reasonable to assume that PP may play a specific role in silkworm physiology as an important ubiquitous component of haemolymph. Sequence similarities to several secretory proteins belonging to the E1 family indicate that PP may also share a function with these proteins, although none of their functions have been revealed.
The mechanism by which PP promotes virus replication in BoMo cells cultured in MM medium remains to be solved. A preliminary experiment showed that the addition of PP to BoMo cell culture induced cell agglutination (data not shown). Ohba & Tanada (1983
, 1984
) reported a similar agglutination of several insect cell lines induced by PuGV SF, which also enhanced PuNPV infection in cultured insect cells. Specific binding of SF to the surface of Spodoptera frugiperda cells and to the envelopes of PuNPV and T. ni NPV was visualized by immunoelectron microscopy (Hukuhara & Zhu, 1989
). These results suggested that SF enhanced NPV infection in vitro by increasing virus adsorption to the cell membrane and facilitating virus entry. Thus, PP may act like SF to facilitate virus entry to BoMo cells and, as a consequence, increase the number of infected cells, although further studies are required to demonstrate this hypothesis.
We also succeeded in producing sufficient amounts of recombinant PP which is similar to native PP in promoting activity, molecular mass and immunoreactivity. This recombinant PP production system enables us to purify PP more quickly and easily than trying to use silkworm haemolymph as the starting material. Taking advantage of the recombinant PP, we are investigating the mode of PP action on BmNPV replication in BoMo cells, as well as in other baculovirusinsect cell systems. Studies aimed at identifying the natural role of PP in silkworm physiology are also in progress.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
de Wet, J. R., Wood, K. V., Deluca, M., Helinski, D. R. & Subramani, S. (1987). Firefly luciferase gene: structure and expression in mammalian cells.Molecular and Cellular Biology 7, 725-737.
Gallo, L. G., Corsaro, B. G., Hughies, P. R. & Granados, R. R. (1991). In vitro enhancement of baculovirus infection by the viral enhancing factor of a granulosis of the cabbage looper, Trichoplusia ni. (Lepidoptera: Noctuidae).Journal of Invertebrate Pathology 58, 203-210.
Gardiner, G. R. & Stockdale, H. (1975). Two tissue culture media for production of lepidopteran cells and nuclear polyhedrosis virus.Journal of Invertebrate Pathology 25, 363-370.
Grace, T. D. C. (1958). Effects of various substances on growth of silkworm tissue in vitro.Australian Journal of Biological Sciences 11, 407-417.
Grace, T. D. C. (1962). Establishment of four strains of cells from insect tissues grown in vitro.Nature 195, 788-789.[Medline]
Grace, T. D. C. (1967). Establishment of a line of cells from the silkworm, Bombyx mori.Nature 216, 613.[Medline]
Granados, R. R. & McKenna, K. A. (1995). Insect cell culture methods and their use in virus research. In Baculovirus Expression System and Biopesticides, pp. 13-39. Edited by M. L. Shuler, H. A. Wood, R. R. Granados & D. A. Hammer. New York: Wiley-Liss.
Hukuhara, T. & Zhu, Y. (1989). Enhancement of the in vitro infectivity of a nuclear polyhedrosis virus by a factor in the capsule of a granulosis virus.Journal of Invertebrate Pathology 54, 71-78.
Hukuhara, T., Tamura, K., Zhu, Y., Abe, H. & Tanada, Y. (1987). Synergistic factors show specificity in enhancing nuclear polyhedrosis virus infections.Applied Entomology and Zoology 22, 235-236.
Inoue, H. & Mitsuhashi, J. (1988). Characterization of a new continuous cell line from silkworm (Bombyx mori) embryos. Applied Entomology and Zoology 23, 8-14.
Inoue, H., Shimizu, K. & Kuwabara, N. (1989). In vitro effect of insect hemolymph on the production of polyhedra of a nuclear polyhedrosis virus.Applied Entomology and Zoology 24, 486-488.
Inoue, H., Taniai, K. & Kobayashi, J. (1990). Establishment and characterization of substrate depending cell lines of Bombyx mori.Bulletin of the National Institute of Sericulture and Entomological Science 1, 13-25.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature 227, 680-685.[Medline]
Lepore, L. S., Roelvink, P. R. & Granados, R. R. (1996). Enhancin, the granulovirus protein that facilitates nucleopolyhedrovirus (NPV) infections, is a metalloprotease.Journal of Invertebrate Pathology 68, 131-140.[Medline]
Maeda, S. (1989). Expression of foreign genes in insect cells using baculovirus vectors. In Insect Cell Biochemistry, pp. 1-31. Edited by K. Maramorosch & A. H. McIntosh. Boca Raton, FL: CRC Press.
Mitsuhashi, J. (1984). Isolation of continuous cell line from larval fat bodies of an arctii, Spilarctia seriatopunctata (Insecta, Lepidoptera, Arctiidae).Zoological Science 1, 415-419.
Mitsuhashi, J. & Maramorosch, K. (1964). Leafhopper tissue culture: embryonic, nymphal, and imaginal tissues from aseptic insects.Contributions from Boyce Thompson Institute 22, 435-460.
Ohba, M. & Tanada, Y. (1983). A synergistic factor enhances the in vitro infection of an insect baculovirus.Naturwissenschaften 70, 613-615.
Ohba, M. & Tanada, Y. (1984). A synergistic factor of an insect granulosis virus agglutinates insect cells.Experientia 40, 742-744.
OReilly, D. R., Miller, L. K. & Luckow, V. A. (1992). Baculovirus Expression Vectors: A Laboratory Manual, p. 347. New York: Freeman.
Reed, L. J. & Muench, H. (1938). A simple method for estimating fifty percent endpoints.American Journal of Hygiene 27, 493-497.
Suzuki, T., Kanaya, T., Okazaki, H., Ogawa, K., Usami, A., Watanabe, H., Kadono-Okuda, K., Yamakawa, M., Sato, H., Mori, H., Takahashi, S. & Oda, K. (1997). Efficient protein production using a Bombyx mori nuclear polyhedrosis virus lacking the cysteine proteinase gene.Journal of General Virology 78, 3073-3080.[Abstract]
Tanada, Y. (1985). A synopsis of studies on the synergistic property of an insect baculovirus: a tribute to Edward A. Steinhaus.Journal of Invertebrate Pathology 45, 125-138.
Tanada, Y., Himeno, M. & Omi, E. M. (1973). Isolation of a factor from the capsule of a granulosis virus, synergistic factor a nuclear polyhedrosis virus of the armyworm.Journal of Invertebrate Pathology 21, 31-40.[Medline]
Uchima, K., Egerter, D. E. & Tanada, Y. (1989). Synergistic factor of a granulosis virus of the armyworm, Pseudaletia unipuncta: its uptake and enhancement of virus infection in vitro.Journal of Invertebrate Pathology 54, 156-164.
Watanabe, H. (1987). Effect of the concentration of fetal bovine serum in a culture medium on the susceptibility of Bombyx mori cells to a nuclear polyhedrosis virus.Applied Entomology and Zoology 22, 397-398.
Watanabe, Y., Yoshihara, T. & Inoue, H. (1988). Infection of a Bombyx cell line adapted to different media with a nuclear polyhedrosis virus.Journal of Sericultural Science of Japan 57, 227-231.
Wyatt, S. S. (1956). Culture in vitro of tissue from the silkworm Bombyx mori L.Journal of General Physiology 39, 841-852.
Xu, J. & Hukuhara, T. (1994). Biochemical properties of an enhancing factor of an entomopoxvirus.Journal of Invertebrate Pathology 63, 14-18.
Received 23 August 1999;
accepted 17 December 1999.
This article has been cited by other articles:
![]() |
H. J. R. Popham, K. S. Shelby, S. L. Brandt, and T. A. Coudron Potent virucidal activity in larval Heliothis virescens plasma against Helicoverpa zea single capsid nucleopolyhedrovirus J. Gen. Virol., August 1, 2004; 85(8): 2255 - 2261. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |