| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Insect |
Venture Laboratory, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan1
Author for correspondence: Kyoji Hagiwara. Fax +81 75 724 7990. e-mail hagiwara{at}ipc.kit.ac.jp
 |
Abstract |
|---|
 TOP Abstract Main textReferences |
|---|
|
Main text |
|---|
|
TOPAbstractMain textReferences |
|---|
; Belloncik, 1989 ). The CPV capsid contains a 10-segmented double-stranded (ds) RNA genome (S1–S10) (Fujii-Kawata et al., 1970 ) and five structural proteins (V1–V5) (Payne & Rivers, 1976 ; McCrae & Mertens, 1983 ; Payne & Mertens, 1983 ). Recently, it was reported that the CPV particle has a single-shelled capsid and that there are two sizes of protrusions on the capsid shells. V3 and V5 are likely candidates for these protrusions (Zhang et al., 1999 ). However, we could not speculate further on the possible structure of the CPV particle comprising these structural proteins because no sequence data are available. Thus, for elucidation of the molecular architecture of the CPV particle it is important to determine the nucleotide sequences of RNA segments and identify the encoded structural proteins. For Bombyx mori cypovirus 1 (BmCPV-1), we have already determined the complete nucleotide sequences of S8, S9 and S10, which encode nonstructural proteins (Hagiwara et al., 1998a , b ; Miyajima et al., 1998 ). Here, we report the complete nucleotide sequences of BmCPV-1 S6 and S7, encoding the viral structural proteins V4 and V5, respectively.
To obtain full-length cDNAs of S6 and S7, genomic dsRNA of BmCPV-1 was separated by 0·8% agarose gel electrophoresis, and S6 and S7 dsRNAs were purified after being excised from the gel. The S6 and S7 dsRNAs were converted to cDNAs by a sequence-independent RT–PCR amplification method (Paul et al., 1992 ). The 3'-terminal region of 5'-phosphorylated primers was blocked by NH2 (primer 1, 5' PO4-CCCGGATCCGTCGACGAATTCTTT-NH2 3') to prevent concatenation of primer 1 in subsequent dsRNA/DNA ligation reactions. Then, primer 1 was ligated to both 3' ends of the purified dsRNA segment (S6 or S7) using T4 RNA ligase, and reverse transcription was performed using primer 2 (5' AAAGAATTCGTCGACGGATCCGGG 3'), complementary to primer 1. After removing the template RNAs by digestion with E. coli RNase H, the resulting cDNAs representing the plus and minus strands of the genomic RNA were annealed. Then, the terminal regions of annealed cDNAs were repaired using Taq DNA polymerase, and PCR amplification was carried out using primer 2. The resulting RT–PCR products were cloned into pBluescript KS(-) and sequenced.
The nucleotide sequences of the S6 and S7 cDNAs were determined using M13 and M13rev primers. To minimize sequence errors, three clones containing cDNAs of S6 or S7 were sequenced, respectively. The complete nucleotide sequences and deduced amino acid sequences are shown in Fig. 1. S6 consisted of 1796 nucleotides and possessed a long open reading frame (ORF) starting with the ATG codon (bases 44 to 46) and terminating with a TAG stop codon (bases 1727 to 1729), encoding a polypeptide of 561 amino acids (Fig. 1a) with a molecular mass of 63604 (ca. 64 kDa). Here, we designated the putative protein encoded by S6 as p64. S7 consisted of 1501 nucleotides and possessed a long ORF starting with the ATG codon (bases 25 to 27) and terminating with a TGA stop codon (bases 1369 to 1371), encoding a polypeptide of 448 amino acids (Fig. 1b) with a molecular mass of 49875 (ca. 50 kDa). Here, we designated the putative protein encoded by S7 as p50. Compared with terminal sequences of five segments from BmCPV-1 (S4, S5, S8, S9 and S10) (Kuchino et al., 1982 ), 5'-terminal five (AGTAA) and 3'-terminal seven (CCGATTG) consensus amino acids were completely conserved in both S6 and S7 (Fig. 1a, b).
|
) using the computer program PSORT (Nakai & Kanehisa, 1992 ). p50 was rich in alanine (9·8%) and threonine (9·4%) residues. One and two nuclear localization signals were also found in the amino acid sequences of p50 and p64, respectively (Fig. 1a, b). Motif analysis using the GenomeNet server showed six N-glycosylation sites in the amino acid sequence of p64, and four N-glycosylation sites in p50. One ATP/GTP-binding site motif was also found from position 353 to 360 in p64 (Fig. 1a).
Homology searches using the BLAST program (Altschul et al., 1990 ) failed to identify any proteins of the Reoviridae viruses with significant similarity to the deduced amino acid sequences of p64 and p50. However, localized similarity with translation initiation factor IF-3 of Buchnera aphidicola was found in the deduced amino acid sequence of p64 at positions 19 to 35 and 282 to 320 (Table 1). These results suggested that p64 possesses nucleic-acid-binding activity and may play an important role in CPV replication.
|
). Here, we designated the protein encoded by S6 as V4, in line with the nomenclature used by McCrae & Mertens (1983) . V4 is considered to be a minor component of the CPV particle and is expressed at low levels compared with other structural proteins (Fig. 2a) so we could not detect it in BmN4 cells infected with BmCPV-1. On immunoblotting analysis using anti-GST-p50C265 antibody, a major immunoreactive protein (p50) of about 56 kDa was detected in virus-infected BmN4 cells (Fig. 2c). Four proteins with molecular masses of 34, 36, 38 and 40 kDa were also detected in purified virions (Fig. 2c). Four similar bands were also observed on SDS–PAGE analysis of purified virions (Fig. 2a). It has been reported that a viral structural protein of about 31 kDa (corresponding to V5) might be produced by posttranslational modification (Payne & Mertens, 1983 ). It has also been reported that reovirus µ1 protein encoded by the M2 gene is the major component of reovirus particles and this protein is cleaved to protein µ1C to associate with protein 
3 (Zweerink & Joklik, 1970 ; Wiener & Joklik, 1988 ; Tillotson & Shatkin, 1992 ). It is possible that the larger S7 product (p50) is cleaved to the smaller protein (V5) when CPV particles are assembled to associate with other viral proteins such as V4. So, the four proteins detected on SDS–PAGE and immunoblot analyses of purified virions may have been cleavage products of p50 produced during the formation of virus particles. Here, we designated the cleaved protein produced by processing of p50 as V5, in line with the nomenclature used by McCrae & Mertens (1983) . However, we cannot exclude the possibility that these proteins may have been degradation products of V5 produced during purification because the distinct molecular mass of V5 has not been reported. It is interesting that p50 was detected in midgut cell extracts of silkworm (data not shown) and BmN4 cells 6 days after virus infection, suggesting that p50 may play an important role in host cells as a nonstructural protein. Further investigations of the function of p50 will clarify its role in the CPV replication cycle.
|
). It has also been reported that the morphology of CPV is similar to that of orthoreovirus (Hill et al., 1999 ). The sequencing results presented here may greatly contribute to confirmation of the three-dimensional structure and arrangement of CPV particles. |
Footnotes |
|---|
|
References |
|---|
|
TOPAbstractMain textReferences |
|---|
Belloncik, S. (1989). Cytoplasmic polyhedrosis virus – Reoviridae.Advances in Virus Research 36, 173-209.
Fujii-Kawata, I., Miura, K. & Fuke, M. (1970). Segments of genome of viruses containing double-stranded ribonucleic acid.Journal of Molecular Biology 51, 247-253.[Medline]
Hagiwara, K., Tomita, M., Kobayashi, J., Miyajima, S. & Yoshimura, T. (1998a). Nucleotide sequence of Bombyx mori cytoplasmic polyhedrosis virus segment 8.Biochemical and Biophysical Research Communications 247, 549-553.[Medline]
Hagiwara, K., Tomita, M., Nakai, K., Kobayashi, J., Miyajima, S. & Yoshimura, T. (1998b). Determination of the nucleotide sequence of Bombyx mori cytoplasmic polyhedrosis virus segment 9 and its expression in BmN4 cells.Journal of Virology 72, 5762-5768.
Hill, C. L., Booth, T. F., Prasad, B. V. V., Grimes, J. M., Mertens, P. P. C., Sutton, G. C. & Stuart, D. I. (1999). The structure of a cypovirus and the functional organization of dsRNA viruses.Nature Structural Biology 6, 565-568.[Medline]
Kuchino, Y., Nishimura, S., Smith, R. E. & Furuichi, Y. (1982). Homologous terminal sequences in the double-stranded RNA genome segments of cytoplasmic polyhedrosis virus of the silkworm Bombyx mori. Journal of Virology 44, 538-543.
McCrae, M. A. & Mertens, P. P. C. (1983). In vitro translation studies on and RNA coding assignments for cytoplasmic polyhedrosis viruses. In Double-stranded RNA Viruses, pp. 35-41. Edited by R. W. Compans & D. H. L. Bishop. New York: Elsevier Science.
Miyajima, S., Mori, A., Hagiwara, K., Kobayashi, J., Yoshimura, T., Nakai, K., Suzuki, Y. & Tomita, M. (1998). Microheterogeneity in the polyhedrin gene of Bombyx mori, a cytoplasmic polyhedrosis virus.Journal of Sericultural Science of Japan 67, 287-294.
Nakai, K. & Kanehisa, M. (1992). A knowledge base for predicting protein localization sites in eukaryotic cells.Genomics 14, 897-911.[Medline]
Paul, R. L., Susan, J. C., Owen, E. C. & Ian, N. C. (1992). Cloning of noncultivatable human rotavirus by single primer amplification.Journal of Virology 66, 1817-1822.
Payne, C. C. & Mertens, P. P. C. (1983). Cytoplasmic polyhedrosis virus. In The Reoviridae, pp. 425-504. Edited by W. K. Joklik. New York: Academic Press.
Payne, C. C. & Rivers, C. F. (1976). A provisional classification of cytoplasmic polyhedrosis viruses based on the sizes of the RNA genome segments.Journal of General Virology 33, 71-85.
Tillotson, L. & Shatkin, A. J. (1992). Reovirus polypeptide 3 and N-terminal myristoylation of polypeptide µ1 are required for site-specific cleavage to µ1C in transfected cells.Journal of Virology 66, 2180-2186.
Wiener, J. R. & Joklik, W. K. (1988). Evolution of reovirus gene: a comparison of serotype 1, 2, and 3 M2 genome segments, which encode the major structural capsid protein µ1C.Virology 163, 603-613.[Medline]
Zhang, H., Zhang, J., Yu, X., Lu, X., Zhang, Q., Jakana, J., Chen, D. H., Zhang, X. & Zhou, Z. H. (1999). Visualization of protein–RNA interactions in cytoplasmic polyhedrosis virus.Journal of Virology 73, 1624-1629.
Zweerink, H. L. & Joklik, W. K. (1970). Studies on the intracellular synthesis of reovirus-specific proteins.Virology 41, 501-522.[Medline]
Received 9 September 1999;
accepted 21 December 1999.
This article has been cited by other articles:
|
|
 |
|
  Y. Orihara, H. Hamamoto, H. Kasuga, T. Shimada, Y. Kawaguchi, and K. Sekimizu A silkworm baculovirus model for assessing the therapeutic effects of antiviral compounds: characterization and application to the isolation of antivirals from traditional medicines J. Gen. Virol., January 1, 2008; 89(1): 188 - 194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, J. Zhang, Y. Li, L. Tan, W. Chen, H. Luo, and Y. Hu Phylogenetic analysis of Heliothis armigera cytoplasmic polyhedrosis virus type 14 and a series of dwarf segments found in the genome J. Gen. Virol., March 1, 2007; 88(3): 991 - 997. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, L. Tan, Y. Li, W. Chen, J. Zhang, and Y. Hu Identification and genome characterization of Heliothis armigera cypovirus types 5 and 14 and Heliothis assulta cypovirus type 14 J. Gen. Virol., February 1, 2006; 87(2): 387 - 394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Nibert and J. Kim Conserved Sequence Motifs for Nucleoside Triphosphate Binding Unique to Turreted Reoviridae Members and Coltiviruses J. Virol., May 15, 2004; 78(10): 5528 - 5530. [Full Text] [PDF]
|
|
|
|
|
|
K. Hagiwara and H. Naitow Assembly into single-shelled virus-like particles by major capsid protein VP1 encoded by genome segment S1 of Bombyx mori cypovirus 1 J. Gen. Virol., September 1, 2003; 84(9): 2439 - 2441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Renault, S. Bigot, M. Lemesle, P.-Y. Sizaret, and Y. Bigot The cypovirus Diadromus pulchellus RV-2 is sporadically associated with the endoparasitoid wasp D. pulchellus and modulates the defence mechanisms of pupae of the parasitized leek-moth, Acrolepiopsis assectella J. Gen. Virol., July 1, 2003; 84(7): 1799 - 1807. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Xia, J. Jakana, J.-Q. Zhang, and Z. H. Zhou Structural Comparisons of Empty and Full Cytoplasmic Polyhedrosis Virus. PROTEIN-RNA INTERACTIONS AND IMPLICATIONS FOR ENDOGENOUS RNA TRANSCRIPTION MECHANISM J. Biol. Chem., January 3, 2003; 278(2): 1094 - 1100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hagiwara, S. Rao, S. W. Scott, and G. R. Carner Nucleotide sequences of segments 1, 3 and 4 of the genome of Bombyx mori cypovirus 1 encoding putative capsid proteins VP1, VP3 and VP4, respectively J. Gen. Virol., June 1, 2002; 83(6): 1477 - 1482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. R. Qanungo, S. C. Kundu, J. I. Mullins, and A. K. Ghosh Molecular cloning and characterization of Antheraea mylitta cytoplasmic polyhedrosis virus genome segment 9 J. Gen. Virol., June 1, 2002; 83(6): 1483 - 1491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Ikeda, S. Nagaoka, S. Winkler, K. Kotani, H. Yagi, K. Nakanishi, S. Miyajima, J. Kobayashi, and H. Mori Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4 J. Virol., January 15, 2001; 75(2): 988 - 995. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
