|
|
||||||||
Animal: RNA Viruses |
Department of Virology, Veterinary and Agrochemical Research Centre, B-1180 Uccle, Belgium1
Department of Applied Biochemistry and Biology, Faculté Universitaire des Sciences Agronomiques B-5030 Gembloux, Belgium2
Author for correspondence: Pierre Kerkhofs. Fax +32 2 375 09 79. e-mail piker{at}var.fgov.be
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The results of published vaccination trials have been reviewed by Miller (1986)
, Portetelle et al. (1993)
, Kettmann et al. (1994)
and Willems et al. (2000)
. BLV vaccinations were first performed using inactivated virus, fixed BLV-infected cells or purified viral antigens. A significant breakthrough in vaccinology arose from the use of recombinant DNA technology, allowing the expression of large quantities of viral proteins or the development of synthetic vaccines. Among the trials based on these technologies, the use of recombinant vaccinia viruses producing the gp51 antigen in its native configuration was quite encouraging (Gatei et al., 1993a
, b
; Ohishi et al., 1990
, 1991
, 1992
; Portetelle et al., 1991
). Besides inactivated immunogens, attenuated vaccines have proven their efficacy against several virus agents. In the context of retrovirus infections, the simian immunodeficiency virus model has been extensively investigated. In this model, strongly attenuated viruses were obtained by the deletion of viral genes, i.e. the nef gene (Yasutomi et al., 1996
). The results obtained with these attenuated vaccine candidates are considered to be very promising.
In the BLV system, we have demonstrated that the G4 gene is required for virus propagation and pathogenicity in vivo (Kerkhofs et al., 1998
). Indeed, the pathogenic potential is strongly decreased, if not completely abrogated, by the deletion of G4. A virus deleted in this gene could thus be used for the design of a live vaccine.
In addition to these conventional vaccines, recombinant vectors and subunit vaccines, one of the more surprising entrants to the world of vaccines has been the use of naked DNA. Different studies have raised the possibility that DNA-based immunization can induce a virus-specific immune response and protective immunity (Cox et al., 1993
; Robinson et al., 1993
; Wang et al., 1993
; Yasutomi et al., 1996
). This novel method of vaccination elicits both cellular and humoral immunity. Furthermore, the DNA-mediated immune response has been shown to present a long-lived effector activity (Michel et al., 1995
; Robinson et al., 1997
; Tang et al., 1992
; Yasutomi et al., 1996
). For DNA immunization against retroviruses, the envelope gene products have been used preferentially (Agadjanyan, 1994
; Wang et al., 1993
; Yasutomi et al., 1996
).
In the present study we have undertaken an evaluation of the ability of two attenuated BLV variants or DNA-expressed envelope glycoproteins to protect cattle and sheep against a heterologous BLV virus challenge.
| Methods |
|---|
|
|
|---|
BLV recombinant and plasmid used in this study.
|
The plasmid DNA that encodes the BLV envelope gene under the control of the cytomegalovirus promoter (pCMVenv) was constructed by insertion of the env gene from plasmid pBLV344 in the pcDNA plasmid (Invitrogen).
Experimental design.
In the first experimental group, two sheep (animals 278 and 279) and two cattle (animals 171 and 152) were vaccinated by subcutaneous injection of 2 ml of blood from a sheep infected with the attenuated BLV DX variant.
In the second experimental group, two sheep (animals 284 and 285) and one cow (animal 269) were vaccinated by subcutaneous injection of 2 ml of blood from a sheep infected by the second attenuated virus (BLV 6073).
In the third experimental group, two sheep (288 and 289) were vaccinated by intramuscular injection of 3·7 mg of the recombinant plasmid pCMVenv in 50 ml PBS in the quadriceps muscle. The injection was repeated twice after 32 and 74 days as booster immunizations.
As challenge controls, one sheep (animal 290) and one cow (animal 205) remained uninfected until challenge. The negative controls were sheep 291 and cow 605, which also remained uninfected during the whole period of investigation. The design of this vaccination trial is summarized in Table 1
.
|
Serological analysis.
Antibodies against BLV gp51 and p24 were detected by ELISA as described by Portetelle et al. (1989)
.
PCR analysis.
Whole blood was used as a sample for PCR analysis. Semi-quantified PCRs of the sequences corresponding to the tax gene were performed as described by Willems et al. (1998)
using the oligonucleotides 5' CTCTTCGGGATCCATTACCTGA 3' and 5' CCTGCATGATCTTTCATACACAAAT 3'. As a control for semi-quantification, undiluted and 1:10 dilutions of DNA samples from two challenged control animals were amplified in parallel.
PCR amplification of the R3G4 region of the BLV genome was performed using the oligonucleotides 5' TGGAAAGAACTAACGCTGACGG 3' and 5' ACGGTGGGTCTCGCAGGTGAGCGTGGTGTCGATCC 3', as described by Dequiedt et al. (1997)
(see Fig. 3a
).
|
| Results |
|---|
|
|
|---|
To quantify the efficiency of virus propagation of these variants, semi-quantified PCRs of the tax gene were performed on blood samples collected in vaccinated sheep and cattle just prior to challenge (4·5 months after vaccination). As a control for semi-quantification, undiluted and 1:10 dilutions of DNA samples from two challenged control animals (sheep 290 and cow 205) were amplified in parallel (Fig. 1b
). Compared to the control animals, in which the challenge virus (FLK-BLV) was detected 4 months after infection, after the same time the two BLV mutants (BLV DX, BLV 6073) used as vaccine candidates remained undetectable in the semi-quantified PCR conditions used.
These results are in agreement with a previous report of the virological attenuation of the BLV variants used in this study (Kerkhofs et al., 1998
; Willems et al., 1995
). This attenuation phenotype is a mandatory requirement for their possible use as vaccine. These data also extend to cattle our previous observations of virus attenuation in sheep (Willems et al., 1994
, 1995
).
After vaccination, humoral responses against BLV were detected by ELISA against gp51 and p24 (Portetelle et al., 1989
) in all vaccinated animals prior to challenge (Table 1
and Fig. 2
, day 140). These data indicated that the humoral responses directed towards the two attenuated viruses were quite different. The BLV DX mutant was more effective at inducing higher anti-gp51 and anti-p24 antibody levels than BLV 6073. This difference in humoral response mainly concerned the anti-p24 antibodies and was even amplified 20 months after challenge (Fig. 2
, day 760). Indeed, at this time the four animals vaccinated with BLV DX presented the highest anti-p24 titres.
|
These observations led us to conclude that 4 months after challenge, protection against infection by a heterologous BLV strain was achieved in seven out of seven animals infected with the attenuated DX (sheep 278, 279 and cattle 171, 152) or the attenuated 6073 (sheep 284, 285 and cow 269) virus. Irrespective of the BLV DX or BLV 6073 attenuated viruses used for vaccination, long-term protection, as measured 12 and 18 months after challenge, was observed for the four sheep (278, 279, 284 and 285) but only for two out of the three cattle (171 and 269). The infection of BLV DX-vaccinated cow 152 with FLK-BLV was detected 12 months after challenge by the amplification of a 750 bp insert generated by the FLK-BLV virus in addition to the 370 bp fragment corresponding to the attenuated virus BLV DX. The immune response directed against one of the attenuated viruses (DX or 6073) was thus effective in suppressing the challenge infection in four out of four sheep and in two out of three cattle. It should be mentioned that, after vaccination and prior to the challenge, cow 152 presented a lower antibody response against BLV, especially against the capsid protein and that the breakthrough of challenge virus was accompanied by an increase in that antibody response. Sheep vaccinated using one of the two live attenuated BLV variants appeared to be completely protected against the challenge by subcutaneous inoculation of a heterologous BLV strain. Indeed, we were unable to detect the presence of the FLK provirus in their PBMCs by PCRSouthern blot analysis. This result indicates that the challenge virus very poorly, if at all, replicated in the host. However, the attenuated BLV strains (DX and 6073) used as vaccines were detectable during the post-challenge period.
DNA immunization against BLV
To reduce the potential pathological risk linked to the use of live attenuated viruses, we developed another strategy to immunize sheep against BLV. This strategy is based on vaccination with plasmid DNA that encodes the BLV envelope gene placed under the control of the cytomegalovirus promoter (pCMVenv). Therefore, in a third experimental group, two sheep were vaccinated by intramuscular injection of this recombinant DNA construct (Table 1
). This nucleic acid immunization induced in sheep 288 and 289 an effective but rather late humoral response against BLV gp51 as shown by the presence of specific antibodies in the sera of these animals 4·5 months after the first injection (Table 1
and Fig. 2
, day 140). One hundred and forty days after the first injection, the animals were challenged by subcutaneous injection of 104 FLK-BLV-producing cells. The onset of low titres of p24 antibodies 5 to 12 months after challenge suggested that the FLK-BLV virus replicated at a lower rate compared to the control unvaccinated challenged animal (data not shown). The presence of the 750 bp fragment in the PCRSouthern blot analysis performed 18 months after challenge confirmed the serological data. Therefore, it seems likely that our DNA immunization protocol was effective in delaying challenge virus replication but long-term protection was not achieved.
| Discussion |
|---|
|
|
|---|
Of note, the challenge conditions that we used were estimated to be of approximately 100 BLV infectious doses (Portetelle et al., 1993
) and were thus particularly severe. Severe challenge conditions were also reported by Reichert et al. (2000
, accompanying paper). Ideally a candidate vaccine should completely block the establishment of infection in vivo; it is now recognized that even very effective live attenuated lentiviral vaccines cannot completely block infection in all exposed individuals. However, virus loads may be significantly reduced and the onset of the disease may be significantly delayed (Putkonen et al., 1995
; Shibata et al., 1997
). This might be true in the case of cow 152, in which virus replication was significantly delayed.
Nevertheless, a similar situation holds true for vaccinia virus-based vectors, which were shown to be quite effective in sheep but not in cattle (Ohishi et al., 1990
, 1991
, 1992
; Portetelle et al., 1993
).
Although we still cannot explain the reasons for these discrepancies, this observation implies that different strategies or protocols have to be used in cattle to achieve full protection. On the other hand, since most of the successful vaccination trials were performed in sheep (reviewed by Kettmann et al., 1994
and Portetelle et al., 1993
), it will also be of great interest to perform them in cattle. Nevertheless, under the experimental protocol used here it appears that the replication of the challenge virus was significantly delayed, if not abrogated, compared to the situation in unvaccinated control animals.
Direct injection of DNA into animals has been shown to induce both humoral and cellular immune responses against several infectious agents, such as influenza virus, rabies virus, human immunodeficiency virus and bovine herpes virus (Cox et al., 1993
; Robinson et al., 1993
; Wang et al., 1993
; Yasutomi et al., 1996
). Plasmid DNA is highly stable, easily administrated and is inexpensive to produce in large quantities. The lack of protein components represents a major advantage, since it makes the potential vaccine unlikely to be affected by a pre-existing immune response. In addition, the apparent long-term persistence of antigen expression from DNA vaccines may mean that they will be effective in the induction of T cell response as well as the establishment of immunological memory (reviewed in Manickan et al., 1997
). The present vaccination trial using two sheep demonstrated that the injection of a recombinant plasmid encoding the envelope genes of BLV was able to elicit an immune response effective in delaying for more than a year the infection by a challenge virus. Even if complete protection was not observed during this experiment, these results are encouraging for the development of a plasmid-based vaccine in cattle.
Our results demonstrate that attenuated BLV variants might be useful for vaccination of sheep, conferring long-term protection against heterologous BLV virus infection. Plasmid-based immunization of sheep was effective in delaying the challenge virus infection for several months. Further experiments are required to optimize this vaccination strategy against BLV in its natural host, cattle. Nevertheless, these results obtained in the BLV system give significant evidence that attenuated viruses and DNA-based immunization are potential tools for the protection against infection by a member of the BLV/HTLV-I and -II family.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Burny, A., Cleuter, Y., Kettmann, R., Mammerickx, M., Marbaix, G., Portetell, D., Van den Broeke, A., Willems, L. & Thomas, R. (1988). Bovine leukaemia: facts and hypotheses derived from the study of an infectious cancer.Advances in Veterinary Science and Comparative Medicine 32, 149-161.[Medline]
Cox, G. J. M., Zamb, T. J. & Babiuk, L. A. (1993). Bovine herpesvirus 1: immune response in mice and cattle injected with plasmid DNA.Journal of Virology 67, 5664-5667.
Dequiedt, F., Hanon, E., Kerkhofs, P., Pastoret, P.-P., Portetelle, D., Burny, A., Kettmann, R. & Willems, L. (1997). Both wild-type and strongly attenuated bovine leukemia viruses protect peripheral blood mononuclear cells from apoptosis.Journal of Virology 71, 630-639.[Abstract]
Gatei, M. H., Nalf, H. M., Kumar, S., Boyle, D. B., Daniel, R. C., Good, M. F. & Lavin, M. F. (1993a). Protection of sheep against bovine leukemia virus (BLV) infection by vaccination with recombinant vaccinia viruses expressing BLV envelope glycoproteins: correlation of protection with CD4 T-cell response to gp51 peptide 5170.Journal of Virology 67, 1803-1810.
Gatei, M. H., Good, M. F., Daniel, R. C. & Lavin, M. F. (1993b). T-cell responses to highly conserved CD4 and CD8 epitopes on the outer membrane protein of bovine leukemia virus: relevance to vaccine development. Journal of Virology 67, 1796-1802.
Kerkhofs, P., Heremans, H., Burny, A., Kettmann, R. & Willems, L. (1998). In vitro and in vivo oncogenic potential of bovine leukemia virus G4 protein.Journal of Virology 72, 2554-2559.
Kettmann, R., Burny, A., Callebaut, l., Droogmans, L., Mammerickx, M., Willems, L. & Portetelle, D. (1994). Bovine leukemia virus. In The Retroviridae, pp. 39-81. Edited by J. A. Levy. NY: Plenum Press.
Mammerickx, M., Portetelle, D. & Burny, A. (1981). Experimental crosstransmission of bovine leukemia virus (BLV) between several animal species.Zentralblatt Veterinarmedizin 28, 69-81.
Manickan, E., Karem, K. L. & Rouse, B. T. (1997). DNA vaccines a modern gimmick or a boon to vaccinology?Critical Reviews in Immunology 17, 139-154.[Medline]
Michel, M. L., Davis, H. L., Schleef, M., Mancini, M., Tiollais, P. & Whalen, R. G. (1995). DNA-mediated immunization to the hepatitis B surface antigen in mice: aspects of the humoral response mimic hepatitis B viral infection in humans.Proceedings of the National Academy of Sciences, USA 92, 5307-5311.
Miller, J. M. (1986). Bovine leukemia virus vaccine. In Animal Models of Retrovirus Infection and their Relationship to AIDS, pp. 421-430. Edited by L. A. Salzman. NY: Academic Press.
Miller, J. M., Miller, L. D., Olson, C. & Gillette, K. G. (1969). Virus-like particles in phytohemagglutinin-stimulated Iymphocyte cultures with reference to bovine Iymphosarcoma.Journal of the National Cancer Institute 43, 1297-1305.
Ohishi, K., Suzuki, H., Maruyama, T., Yamamoto, T., Funahashi, S., Miki, K., Ikawa, Y. & Sugimoto, M. (1990). Induction of neutralizing antibodies against bovine leukosis virus in rabbits by vaccination with recombinant vaccinia virus expressing bovine leukosis virus envelope glycoprotein. American Journal of Veterinary Research 51, 1170-1173.[Medline]
Ohishi, K., Suzuki, H., Yamamoto, T., Maruyama, T., Miki, K., Ikawa, Y., Numakunai, S., Okada, K., Ohshima, K. & Sugimoto, M. (1991). Protective immunity against bovine leukaemia virus (BLV) induced in carrier sheep by inoculation with a vaccinia virusBLV env recombinant: association with cell-mediated immunity.Journal of General Virology 72, 1887-1892.
Ohishi, K., Suzuki, H., Yasutomi, Y., Onima, M., Okada, K., Numakumai, S., Ohshima, K., Ikawa, Y. & Sugimoto, M. (1992). Augmentation of bovine leukaemia virus (BLV)-specific Iymphocyte proliferation responses in ruminant by inoculation with BLV env-recombinant vaccinia virus: the role in the suppression of BLV replication.Microbiological Immunology 36, 1317-1323.[Medline]
Portetelle, D., Mammerickx, M. & Burny, A. (1989). Use of two monoclonal antibodies in an ELISA test for the detection of antibodies to bovine leukemia virus envelope protein gp51.Journal of Virological Methods 23, 211-222.[Medline]
Portetelle, D., Limbach, K., Burny, A., Mammerickx, M., Desmettre, P., Riviere, M., Zavada, J. & Paoletti, E. (1991). Recombinant vaccinia virus expression of the bovine leukemia virus envelope gene and protection of immunized sheep against infection.Vaccine 9, 194-200.[Medline]
Portetelle, D., Callebaut, I., Bex, F. & Burny, A. (1993). Vaccination against animal retroviruses. In Progress in Vaccinology, pp. 87-138. Edited by R. Pandey, S. Hoglund & G. Prassad. Berlin: Springer-Verlag.
Putkonen, P., Walther, L., Zhang, Y. J., Li, S. L., Nilsson, C., Albert, J., Biberfeld, P., Thorstensson, R. & Biberfeld, G. (1995). Long-term protection against SIV-induced disease in macaques vaccinated with a live attenuated HIV-2 vaccine.Nature Medicine 1, 914-918.[Medline]
Reichert, M., Cantor, G. H., Willems, L. & Kettmann, R. (2000). Protective effects of a live attenuated bovine leukaemia virus vaccine with deletion in the R3 and G4 genes.Journal of General Virology 81, 965-969.
Robinson, H. R., Hunt, L. A. & Webster, R. G. (1993). Protection against lethal influenza virus challenge by immunization with hemagglutinin-expressing plasmid DNA.Vaccine 11, 957-960.[Medline]
Robinson, H. R., Boyle, C. A., Feltquate, D. M., Morin, M. J., Santoro, J. C. & Webster, R. G. (1997). DNA immunization for influenza virus: studies using hemagglutinin and nucleoprotein-expressing DNAs.Journal of lnfectious Diseases 176, 50-55.
Shibata, R., Maldarelli, F., Siemon, C., Matano, T., Parta, M., Miller, G., Fredrickson, T. & Martin, M. A. (1997). Infection and pathogenicity of chimeric simianhuman immunodeficiency viruses in macaques: determinants of high virus loads and CD4 cell killing.Journal of lnfectious Diseases 176, 362-373.
Tang, D., De Vit, M. & Johnston, S. A. (1992). Genetic immunization is a simple method for eliciting an immune response.Nature 356, 152-154.[Medline]
Van der Maaten, M. & Miller, J. (1976). Replication of bovine leukemia virus in monolayer cell cultures.Bibliotheca Haematologica 43, 360-362.
Wang, R., Ugen, K. E., Srikantan, V., Agadjanyan, M. G., Dag, K., Refaeli, Y., Sato, A. l., Boyer, J., Williams, W. V. & Weiner, B. (1993). Gene inoculation generates immune responses against HIV-1. Proceedings of the National Academy of Sciences, USA 90, 4156-4160.
Willems, L., Kettmann, R., Dequiedt, F., Portetelle, D., Voneche, V., Cornil, l., Kerkhofs, P., Burny, A. & Mammerickx, M. (1993). In vivo infection of sheep by bovine leukemia virus mutants.Journal of Virology 67, 4078-4085.
Willems, L., Kerkhofs, P., Dequiedt, F., Portetelle, D., Mammerickx, M., Burny, A. & Kettmann, R. (1994). Attenuation of bovine leukemia virus by deletion of R3 and G4 open reading frames.Proceedings of the National Academy of Sciences, USA 91, 11532-11536.
Willems, L., Gatot, J. S., Mammerickx, M., Portetelle, D., Burny, A., Kerkhofs, P. & Kettmann, R. (1995). The YXXL signalling motifs of the bovine leukemia virus transmembrane protein are required for in vivo infection and maintenance of high virus loads.Journal of Virology 69, 4137-4141.[Abstract]
Willems, L., Grimonpont, C., Kerkhofs, P., Capiau, C., Gheysen, D., Conrath, K., Roussef, R., Mamoun, R., Portetelle, D., Burny, A., Adam, E., Lefèbvre, L., Twizere, J. C., Heremans, H. & Kettmann, R. (1998). Phosphorylation of bovine leukemia virus Tax protein is required for in vitro transformation but not for transactivation.Oncogene 16, 2165-2176.[Medline]
Willems, L., Burny, A., Dangoisse, O., Dequiedt, F., Gatot, J. S., Kerkhofs, P., Lefèbvre, L., Merezak, C., Portetelle, D., Twizere, J. C. & Kettmann, R. (2000). Bovine leukemia virus as a model for the human T-cell leukemia viruses. Current Topics in Virology (in press).
Yasutomi, Y., Robinson, H., Lu, S., Mustafa, F., Lekutus, C., Arthos, J., Mullins, J. l., Voss, G., Manson, K., Wyand, M. & Letvin, N. L. (1996). Simian immunodeficiency virus-specific cytotoxic T-lymphocyte induction through DNA vaccination of rhesus monkeys.Journal of Virology 70, 678-681.[Abstract]
Received 18 August 1999;
accepted 20 December 1999.
This article has been cited by other articles:
![]() |
S. M. Rodriguez, M. D. Golemba, R. H. Campos, K. Trono, and L. R. Jones Bovine leukemia virus can be classified into seven genotypes: evidence for the existence of two novel clades J. Gen. Virol., November 1, 2009; 90(11): 2788 - 2797. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Florins, N. Gillet, M. Boxus, P. Kerkhofs, R. Kettmann, and L. Willems Even Attenuated Bovine Leukemia Virus Proviruses Can Be Pathogenic in Sheep J. Virol., September 15, 2007; 81(18): 10195 - 10200. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mirsaliotis, K. Nurkiyanova, D. Lamb, J. M. Woof, and D. W. Brighty Conformation-Specific Antibodies Targeting the Trimer-of-Hairpins Motif of the Human T-Cell Leukemia Virus Type 1 Transmembrane Glycoprotein Recognize the Viral Envelope but Fail To Neutralize Viral Entry J. Virol., June 1, 2007; 81(11): 6019 - 6031. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lefebvre, V. Ciminale, A. Vanderplasschen, D. D'Agostino, A. Burny, L. Willems, and R. Kettmann Subcellular Localization of the Bovine Leukemia Virus R3 and G4 Accessory Proteins J. Virol., June 27, 2002; 76(15): 7843 - 7854. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Reichert, G. H. Cantor, L. Willems, and R. Kettmann Protective effects of a live attenuated bovine leukaemia virus vaccine with deletion in the R3 and G4 genes J. Gen. Virol., April 1, 2000; 81(4): 965 - 969. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |