|
|
||||||||
Animal: RNA Viruses |
National Veterinary Research Institute, Pulawy, Poland1
Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164-7040, USA2
Faculty of Agronomy, B-5030 Gembloux, Belgium3
Author for correspondence: Michal Reichert. Fax +48 81 8862595. e-mail reichert{at}piwet.pulawy.pl
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
More recently further encouraging evidence came from the use of attenuated provirus DNA as tested in animal models for the human, simian and feline immunodeficiency lentiviruses (Daniel et al., 1992
; Desrosiers, 1992
; Wyand et al., 1996
; Lu et al., 1996
; Shibata et al., 1997
; Desrosiers et al., 1998
; Langlois et al., 1998
; Hosie et al., 1998
).
Here, as a model for the protection against infection by members of the human T-lymphotropic virus/BLV group, we report the protective effects of a live attenuated BLV plasmid DNA vaccine with deletion in the R3 and G4 genes.
| Methods |
|---|
|
|
|---|
Plasmids.
In vivo transfections.
Sixteen sheep were used in these experiments. Throughout the study, the animals were kept under controlled conditions in the experimental herd in Pulawy. Sheep were injected with plasmids mixed with DOTAP (Boehringer) in 1 ml HEPES-buffered saline (pH 7·4). Sheep 1, 2, 3, 7, 8, 10, 13, 14 and 15 were injected intradermally in six different locations with a total dose of 200 µg pBLVDX. Sheep 17 and 19 were injected at three different locations with 100 µg pBLV344. Control sheep 4, 11, 16, 20 and 21 were not transfected. Sheep were challenged 3 months after transfection and again at 6·5 months after transfection. As a challenge, sheep 1, 2, 3 and 4 were injected intradermally with 200 µg of the infectious molecular clone pBLV344 (Willems et al., 1993
); sheep 7, 8, 10 and 11 received 1·8 ml of blood (8200 leucocytes/µl) from a sheep previously infected with pBLV344; and sheep 13, 14, 15 and 16 received 1 ml of blood (14600 leucocytes/µl) from a persistently lymphocytotic (PL), naturally BLV-infected cow. Sheep 17, 19, 20 and 21 were not challenged (Fig. 1
).
|
Serological examination.
DNA isolation.
Blood samples were collected every 2 weeks and used both for serological tests and PCR. DNA for PCR was isolated from whole blood using the IsoQuick kit (MicroProbe Corporation).
Primers and probes.
The following oligonucleotides were used for amplification of BLV-specific sequences: OL-5 (position 6711; 5' TCTGGTGCTGGGGATAAGATGC 3') and OL-6 (position 7353; 5' GATCCTTTCGAATTGGAGTCGT 3'). The primers were selected using the computer program Oligo-4 (National Bioscience) and were synthesized using a Gene Assembler-plus apparatus (Pharmacia Biotech). Position of primers was defined according to the map of Sagata et al. (1985)
.
PCR assays.
Approximately 1 µg DNA was added to a 50 µl reaction mixture containing 10 mM TrisHCl (pH 8·8), 2 mM MgCl2, 50 mM KCl, 0·1% Triton X-100, 0·2 mM dNTPs, 0·5 µM of each primer and 2 units of Taq polymerase (Amersham). The reaction mixture was overlaid with 50 µl of mineral oil, denatured for 5 min at 94 °C and subjected to 30 cycles of PCR (1 min at 94 °C, 1 min at 65 °C and 1·5 min at 72 °C) using a DNA thermal cycler (Perkin-Elmer). The amplification products were analysed by Southern blot hybridization using the cloned 8·1 kb SacI BLV fragment labelled with 32P as previously described (Reichert & Grundboeck-Ju
ko, 1991
).
| Results |
|---|
|
|
|---|
|
Superinfection was monitored 6 weeks after the first challenge by PCR for the detection of BLV proviral sequences in the sheep peripheral blood lymphocytes. The use of specific pairs of oligonucleotides allows the amplification of a 664 bp fragment corresponding to the wild-type pBLV344 or a 281 bp fragment from the attenuated BLVDX, in which the R3 and G4 genes are deleted. To increase the sensitivity of the detection, the PCR products were analysed by Southern blotting with a 32P-labelled BLV-specific probe.
As expected, the 664 bp fragment of wild-type BLV344 was present in the PCR reaction corresponding to control animals 4, 11 and 16, which were not transfected with BLV plasmid DNA prior to experimental challenge. Similarly, the 664 bp fragment was detected in control animals 17 and 19, which were infected with the infectious virulent wild-type pBLV344, but were not challenged. The DNA from all the animals transfected with the attenuated pBLVDX (animals 1, 2, 3, 7, 8, 10, 13, 14 and 15) revealed the presence of the 281 bp fragment corresponding to the deleted R3/G4 portion but not the 664 bp fragment corresponding to the wild-type pBLV344 (Fig. 2
).
|
| Discussion |
|---|
|
|
|---|
The viruses used for challenge in this study were the cloned wild-type Belgian BLV344 parental to BLVDX or BLV from an infected cow in Poland. Six out of six animals (1, 2, 3, 7, 8 and 10) transfected with pBLVDX resisted the challenge with the parental pBLV344. Two out of three animals transfected with pBLVDX were protected against challenge with BLV from a naturally infected cow. Sheep 14 had a very faint 644 bp band on Southern blotting after challenge, indicating only partial protection. Additional studies are necessary to determine the significance of this failure to fully protect in one animal.
We do not know the mechanisms that are responsible for the protective immunity observed in these experiments. Even if high and relatively stable levels of BLV-specific antibodies were detected, the humoral immune response was not further characterized nor was the cellular-mediated immune response investigated. It has been suggested that the latter response may play a major role in the suppression of BLV proliferation (Ohishi et al., 1991
, 1992
). Additional work should be performed to establish the length of effective protective time in relation to the dose of inoculum. Here, two animals were resistant to the challenge with 1·5x107 peripheral leucocytes from a PL cow. That infection dose is very high, since in similar experimental conditions only 924 bovine leucocytes were proven to be sufficient to establish infection in sheep (Mammerickx et al., 1987
). This heavy challenge might explain why sheep 14 became infected. Alternatively, differences in strains may explain the inability of pBLVDX to fully protect all of the animals.
In conclusion, the data reported here provide evidence that attenuated, infectious BLV plasmid DNA is able to efficiently protect sheep against challenge infections. However, to be more practical, additional experiments have to be performed in cattle, since it appears to be more difficult to protect cattle than sheep (Kerkhofs et al., 2000
, accompanying paper).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Desrosiers, R. C. (1992). HIV with multiple gene deletions as a live attenuated vaccine for AIDS.AIDS Research & Human Retroviruses 8, 411-420.[Medline]
Desrosiers, R. C., Lifson, J. D., Gibbs, D., Czajak, S. C., Howe, A. Y. M., Arthur, L. O. & Johnson, R. P. (1998). Identification of highly attenuated mutants of simian immunodeficiency virus.Journal of Virology 72, 1431-1437.
Hosie, M. J., Flynn, J. N., Rigby, A. A., Cannon, C., Dunsford, T., Mackay, N. A., Argyle, D., Willett, B. J., Miyazawa, T., Onions, D. E., Jarrett, O. & Neil, J. C. (1998). DNA vaccination affords significant protection against feline immunodeficiency virus infection without inducing detectable antiviral antibodies.Journal of Virology 72, 7310-7319.
Kerkhofs, P., Heremans, H., Burny, A., Kettmann, R. & Willems, L. (1998). In vitro and in vivo oncogenic potential of bovine leukemia virus G4 protein.Journal of Virology 72, 2554-2559.
Kerkhofs, P., Gatot, J.-S., Knapen, K., Mammerickx, M., Birny, A., Portetelle, D., Willems, L. & Kettmann, R. (2000). Long-term protection against bovine leukaemia virus replication in cattle and sheep.Journal of General Virology 81, 957-963.
Langlois, A. J., Desrosiers, R. C., Lewis, M. G., Kewalramani, V. H., Littman, D. R., Zhou, J. Y., Manson, K., Wyand, M. S., Bolognesi, D. P. & Montefiori, D. C. (1998). Neutralizing antibodies in sera from macaques immunized with attenuated simian immunodeficiency virus.Journal of Virology 72, 6950-6955.
Lassauzet, M., Johnson, W., Thurmond, M. & Stevens, F. (1989). Protection of colostral antibodies against bovine leukemia virus infection in calves on a California dairy.Canadian Journal of Veterinary Research 53, 424-430.
Lu, Y., Salvato, M. S., Pauza, C. D., Li, J., Sodroski, J., Manson, K., Wyand, M. S., Letvin, N., Jenkins, S., Touzian, N., Chutkowski, C., Kushner, N., LeFaile, M., Payne, G. L. & Roberts, B. (1996). Utility of SHIV for testing HIV-1 vaccine candidates in macaques.Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 12, 99-106.[Medline]
Mammerickx, M., Portetelle, D., Burny, A. & Leunen, J. (1980). Detection by immunodiffusion and radioimmunoassay tests of antibodies to bovine leukemia virus antigens in sera of experimentally infected sheep and cattle.Zentralblatt für Veterinärmedizin, Reihe B 27, 291-303.
Mammerickx, M., Portetelle, D., De Clerco, K. & Burny, A. (1987). Experimental transmission of enzootic bovine leukosis to cattle, sheep and goats: infectious doses of blood and incubation period of the disease.Leukemia Research 11, 353-358.[Medline]
Ohishi, K., Suzuki, H., Yamamoto, T., Maruyama, T., Miki, K., Ikawa, Y., Numakunai, S., Okada, K., Ohshima, K. & Sugimoto, M. (1991). Protective immunity against bovine leukaemia virus (BLV) induced in carrier sheep by inoculation with a vacciniaBLV env recombinant: association with cell-mediated immunity.Journal of General Virology 72, 1887-1892.
Ohishi, K., Suzuki, H., Yasutomi, Y., Onima, M., Okada, K., Numakumai, S., Ohsima, K., Ikawa, Y. & Sugimoto, M. (1992). Augmentation of bovine leukaemia virus (BLV)-specific lymphocyte proliferation responses in ruminant by inoculation with BLV env-recombinant vaccinia virus: the role in the suppression of BLV replication.Microbiology and Immunology 36, 1317-1323.[Medline]
Portetelle, D., Callebaut, I., Bex, F. & Burny, A. (1993). Vaccination against animal retroviruses. In Progress in Vaccinology, pp. 87-138. Edited by R. Pandey, S. Hoglund & G. Prassad. Berlin: Springer-Verlag.
Reichert, M. & Grundboeck-Ju
ko, J. (1991). Molecular cloning of provirus DNA from bovine leukaemia lymphocytes and its application as a probe for diagnostic purpose.Acta Biochimica Polonica 38, 111-114.[Medline]
Sagata, N., Yasunaga, Y., Tsuzuku-Kawamura, J., Ohishi, K., Ogawa, Y. & Ikawa, Y. (1985). Complete nucleotide sequence of the genome of bovine leukemia virus: its evolutionary relationship to other retroviruses.Proceedings of the National Academy of Sciences, USA 82, 677-681.
Shibata, R., Simeon, C., Czajak, S. C., Desrosiers, R. C. & Martin, A. M. (1997). Live, attenuated simian immunodeficiency virus vaccines elicit potent resistance against a challenge with a human immunodeficiency virus type 1 chimeric virus.Journal of Virology 71, 8141-8148.[Abstract]
Van den Broeke, A., Cleuter, Y., Chen, G., Portetelle, D., Mammerickx, M., Zagury, D., Fouchard, M., Coulombel, L., Kettmann, R. & Burny, A. (1988). Even transcriptionally competent proviruses are silent in bovine leukemia virus-infected sheep tumor cells.Proceedings of the National Academy of Sciences, USA 85, 9263-9267.
Willems, L., Kettmann, R., Dequiedt, F., Portetelle, D., Voneche, V., Cornil, L., Kerkhofs, P., Burny, A. & Mammerickx, M. (1993). In vivo infection of sheep by bovine leukemia virus mutants.Journal of Virology 67, 4078-4085.
Willems, L., Kerkhofs, P., Dequiedt, F., Portetelle, D., Mammerickx, M., Burny, A. & Kettmann, R. (1994). Attenuation of bovine leukemia virus by deletion of R3 and G4 open reading frames.Proceedings of the National Academy of Sciences, USA 91, 11532-11536.
Willems, L., Gatot, J. S., Mammerickx, M., Portetelle, D., Burny, A., Kerkohofs, P. & Kettmann, R. (1995). The YXXL signalling motifs of the bovine leukemia transmembrane protein are required for in vivo infection and maintenance of high viral loads.Journal of Virology 69, 4137-4141.[Abstract]
Willems, L., Kerkhofs, P., Attenelle, L., Burny, A., Portetelle, D. & Kettmann, R. (1997). The major homology region of bovine leukemia virus p24gag is required for virus infectivity in vivo.Journal of General Virology 78, 637-640.[Abstract]
Wyand, M. S., Manson, K. H., Garcia-Moll, M., Montefiori, D. C. & Desrosiers, R. C. (1996). Vaccine protection by a triple deletion mutant of simian immunodeficiency virus.Journal of Virology 70, 3724-3733.[Abstract]
Received 18 August 1999;
accepted 20 December 1999.
This article has been cited by other articles:
![]() |
A. Florins, N. Gillet, M. Boxus, P. Kerkhofs, R. Kettmann, and L. Willems Even Attenuated Bovine Leukemia Virus Proviruses Can Be Pathogenic in Sheep J. Virol., September 15, 2007; 81(18): 10195 - 10200. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lefebvre, V. Ciminale, A. Vanderplasschen, D. D'Agostino, A. Burny, L. Willems, and R. Kettmann Subcellular Localization of the Bovine Leukemia Virus R3 and G4 Accessory Proteins J. Virol., June 27, 2002; 76(15): 7843 - 7854. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kerkhofs, J.-S. Gatot, K. Knapen, M. Mammerickx, A. Burny, D. Portetelle, L. Willems, and R. Kettmann Long-term protection against bovine leukaemia virus replication in cattle and sheep J. Gen. Virol., April 1, 2000; 81(4): 957 - 963. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |