J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reichert, M.
Right arrow Articles by Kettmann, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reichert, M.
Right arrow Articles by Kettmann, R.
Agricola
Right arrow Articles by Reichert, M.
Right arrow Articles by Kettmann, R.
Journal of General Virology (2000), 81, 965-969.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Protective effects of a live attenuated bovine leukaemia virus vaccine with deletion in the R3 and G4 genes

M. Reichert1, G. H. Cantor2, L. Willems3 and R. Kettmann3

National Veterinary Research Institute, Pulawy, Poland1
Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164-7040, USA2
Faculty of Agronomy, B-5030 Gembloux, Belgium3

Author for correspondence: Michal Reichert. Fax +48 81 8862595. e-mail reichert{at}piwet.pulawy.pl


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In this study the protective effects of a live attenuated bovine leukaemia provirus (pBLVDX) with deletion in the R3 and G4 genes were tested. Six out of six sheep appeared to resist challenge with parental BLV344. Two out of three animals transfected with pBLVDX were protected against challenge with bovine leukaemia virus (BLV) from a naturally infected cow. As a model for the protection against infection by members of the human T-lymphotropic virus/BLV group, these data provide evidence that a DNA-based vaccination with an attenuated provirus is able to protect against challenge infections.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Eradication of enzootic bovine leukaemia has been made possible in regions like the EU where efforts were made to identify and systematically eliminate all the infected animals. Such an expensive strategy involves: (1) detection of bovine leukaemia virus (BLV)-infected herds; (2) identification of the infected animals within the positive herds; (3) elimination of all BLV-positive animals; and (4) testing of the remaining animals at regular intervals until seropositive animals have been entirely eliminated (Portetelle et al., 1993Down ). Another approach is to vaccinate all the animals from a given population in order to decrease virus prevalence. A strategy based on vaccination is supported by the fact that BLV-specific antibodies are present in the colostrum of infected cows and act for several months as a first barrier against virus transmission (Mammerickx et al., 1980Down ; Lassauzet et al., 1989Down ). Among numerous vaccination trials, the use of recombinant vaccinia virus producing the gp51 antigen in its native configuration was quite promising. The data point to the importance of high titres of neutralizing antibodies at early stages after challenge, with less reliance on humoral immunity over longer periods, and also suggest that cell-mediated immune responses play a major role in the suppression of BLV proliferation (Portetelle et al., 1993Down ).

More recently further encouraging evidence came from the use of attenuated provirus DNA as tested in animal models for the human, simian and feline immunodeficiency lentiviruses (Daniel et al., 1992Down ; Desrosiers, 1992Down ; Wyand et al., 1996Down ; Lu et al., 1996Down ; Shibata et al., 1997Down ; Desrosiers et al., 1998Down ; Langlois et al., 1998Down ; Hosie et al., 1998Down ).

Here, as a model for the protection against infection by members of the human T-lymphotropic virus/BLV group, we report the protective effects of a live attenuated BLV plasmid DNA vaccine with deletion in the R3 and G4 genes.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Plasmids.
The genetic material used was the cloned wild-type BLV provirus 344 (pBLV344) described previously (Van den Broeke et al., 1988Down ). pBLVDX was obtained after excision of the BamHI–XbaI fragment containing the R3 and G4 genes from pBLV344 (Willems et al., 1994Down ).

{blacksquare} In vivo transfections.
Sixteen sheep were used in these experiments. Throughout the study, the animals were kept under controlled conditions in the experimental herd in Pulawy. Sheep were injected with plasmids mixed with DOTAP (Boehringer) in 1 ml HEPES-buffered saline (pH 7·4). Sheep 1, 2, 3, 7, 8, 10, 13, 14 and 15 were injected intradermally in six different locations with a total dose of 200 µg pBLVDX. Sheep 17 and 19 were injected at three different locations with 100 µg pBLV344. Control sheep 4, 11, 16, 20 and 21 were not transfected. Sheep were challenged 3 months after transfection and again at 6·5 months after transfection. As a challenge, sheep 1, 2, 3 and 4 were injected intradermally with 200 µg of the infectious molecular clone pBLV344 (Willems et al., 1993Down ); sheep 7, 8, 10 and 11 received 1·8 ml of blood (8200 leucocytes/µl) from a sheep previously infected with pBLV344; and sheep 13, 14, 15 and 16 received 1 ml of blood (14600 leucocytes/µl) from a persistently lymphocytotic (PL), naturally BLV-infected cow. Sheep 17, 19, 20 and 21 were not challenged (Fig. 1Down).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1. Scheme of the experiment.

 
{blacksquare} Serological examination.
The presence and titre of anti-BLV antibodies was monitored using an AGID assay (Dr Bommeli AG, Switzerland) and ELISA (ELISA BLV kit, Bioveta).

{blacksquare} DNA isolation.
Blood samples were collected every 2 weeks and used both for serological tests and PCR. DNA for PCR was isolated from whole blood using the IsoQuick kit (MicroProbe Corporation).

{blacksquare} Primers and probes.
The following oligonucleotides were used for amplification of BLV-specific sequences: OL-5 (position 6711; 5' TCTGGTGCTGGGGATAAGATGC 3') and OL-6 (position 7353; 5' GATCCTTTCGAATTGGAGTCGT 3'). The primers were selected using the computer program Oligo-4 (National Bioscience) and were synthesized using a Gene Assembler-plus apparatus (Pharmacia Biotech). Position of primers was defined according to the map of Sagata et al. (1985)Down .

{blacksquare} PCR assays.
Approximately 1 µg DNA was added to a 50 µl reaction mixture containing 10 mM Tris–HCl (pH 8·8), 2 mM MgCl2, 50 mM KCl, 0·1% Triton X-100, 0·2 mM dNTPs, 0·5 µM of each primer and 2 units of Taq polymerase (Amersham). The reaction mixture was overlaid with 50 µl of mineral oil, denatured for 5 min at 94 °C and subjected to 30 cycles of PCR (1 min at 94 °C, 1 min at 65 °C and 1·5 min at 72 °C) using a DNA thermal cycler (Perkin-Elmer). The amplification products were analysed by Southern blot hybridization using the cloned 8·1 kb SacI BLV fragment labelled with 32P as previously described (Reichert & Grundboeck-Juko, 1991Down ).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Nine sheep were experimentally infected by intradermal injection of 200 µg of plasmid pBLVDX (animals 2, 3, 4, 7, 8, 10, 13, 14 and 15) (Fig. 1Up). This plasmid contains an attenuated BLV provirus with deletion of the R3 and G4 accessory genes. The pathogenic potential of this virus is strongly decreased, if not completely abrogated, by the deletion of these genes (Kerkhofs et al., 1998Down ). Two other sheep (control animals 17 and 19) received 100 µg of wild-type pBLV344 (Fig. 1Up). Animals 4, 11, 16, 20 and 21 were not transfected. Seroconversion as measured by AGID assay and ELISA tests occurred in all the transfected animals 3 to 4 weeks after plasmid injection. The humoral response was quite similar among the infected animals, except for animals 15 and 17, which display lower and higher titres respectively (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Specific antibody titres (ELISA) of sheep transfected with wild-type and mutant provirus DNA, before and after challenge with BLV

 
Three months after infection with the attenuated pBLVDX or the virulent wild-type pBLV344, the animals were challenged for the first time with 200 µg of wild-type pBLV344 (sheep 1–4), 1·8 ml of blood from a pBLV344-infected sheep (animals 7–11), 1 ml of blood from a PL, ELISA-positive cow from a high prevalence herd in Poland (sheep 13–16) or nothing (animals 17–21).

Superinfection was monitored 6 weeks after the first challenge by PCR for the detection of BLV proviral sequences in the sheep peripheral blood lymphocytes. The use of specific pairs of oligonucleotides allows the amplification of a 664 bp fragment corresponding to the wild-type pBLV344 or a 281 bp fragment from the attenuated BLVDX, in which the R3 and G4 genes are deleted. To increase the sensitivity of the detection, the PCR products were analysed by Southern blotting with a 32P-labelled BLV-specific probe.

As expected, the 664 bp fragment of wild-type BLV344 was present in the PCR reaction corresponding to control animals 4, 11 and 16, which were not transfected with BLV plasmid DNA prior to experimental challenge. Similarly, the 664 bp fragment was detected in control animals 17 and 19, which were infected with the infectious virulent wild-type pBLV344, but were not challenged. The DNA from all the animals transfected with the attenuated pBLVDX (animals 1, 2, 3, 7, 8, 10, 13, 14 and 15) revealed the presence of the 281 bp fragment corresponding to the deleted R3/G4 portion but not the 664 bp fragment corresponding to the wild-type pBLV344 (Fig. 2Down).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Southern blot analysis of PCR-amplified DNAs from lymphocytes of 16 sheep collected 6 weeks after the first (A) or the second (B) challenge. Amplification products were electrophoresed, blotted on nylon filters and hybridized with a BLV-specific probe as described in the text. Designations of lanes are compatible with the numbers of the experimental animals. Lanes 4, 11, 16 – DNA of nontransfected but challenged sheep. Lanes 1, 2, 3, 7, 8, 10, 13, 14, 15 – DNA of pDX344-transfected and challenged sheep. Lanes 17 and 19 – DNA of p344-transfected and nonchallenged sheep. Lanes 20 and 21 – DNA of nontransfected and nonchallenged control animals.

 
Three and half months after the first challenge, the animals were challenged again with a similar infectious dose and the presence of viral sequences was verified as described above. Again, Southern blot analysis of the PCR products failed to reveal the 664 bp corresponding to wild-type pBLV344 in the animals previously infected by the attenuated pBLVDX, except for animal 14 where a very faint band is visible (Fig. 2Up).


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In this study, the infectious attenuated plasmid pBLVDX, in which the R3 and G4 genes are deleted, was able to protect eight out of nine sheep against a challenge by either wild-type BLV or BLVs present in the blood of infected animals. It has previously been reported that virus propagation of BLVDX, as measured by semiquantitative PCR, appeared to be significantly reduced when the R3 and G4 genes were deleted (Willems et al., 1994Down ). In addition, over a period of 40 months, none of the 13 sheep infected with pBLVDX developed leukaemias and/or lymphosarcomas (Kerkhofs et al., 1998Down ). Together with the previous results, our data and those of Kerkhofs et al. (2000, accompanying paper) showing that pBLVDX protects against challenge suggest that pBLVDX is a vaccine candidate. Although many European countries are now considered free of BLV, an efficient and cheap vaccine is still of potential interest in countries with high prevalence of enzootic bovine leukosis. BLV is also a model to examine the efficiency of a plasmid DNA-based vaccine against the HTLV/BLV group of leukaemia viruses. Because HTLV-I and -II are responsible for severe disease in some areas in the world, vaccination against these agents could be important. Another important aspect is the safety of the vaccine. In the case of plasmid DNA-based vaccines, further studies in animal models are necessary to evaluate the level of attenuation compatible with an efficient vaccination potential. For BLV, mutations in the env and gag genes led to attenuation (Willems et al., 1995Down , 1997Down ). Here, we showed another region of the BLV genome in which deletions lead to attenuation and effective protection against challenge.

The viruses used for challenge in this study were the cloned wild-type Belgian BLV344 parental to BLVDX or BLV from an infected cow in Poland. Six out of six animals (1, 2, 3, 7, 8 and 10) transfected with pBLVDX resisted the challenge with the parental pBLV344. Two out of three animals transfected with pBLVDX were protected against challenge with BLV from a naturally infected cow. Sheep 14 had a very faint 644 bp band on Southern blotting after challenge, indicating only partial protection. Additional studies are necessary to determine the significance of this failure to fully protect in one animal.

We do not know the mechanisms that are responsible for the protective immunity observed in these experiments. Even if high and relatively stable levels of BLV-specific antibodies were detected, the humoral immune response was not further characterized nor was the cellular-mediated immune response investigated. It has been suggested that the latter response may play a major role in the suppression of BLV proliferation (Ohishi et al., 1991Down , 1992Down ). Additional work should be performed to establish the length of effective protective time in relation to the dose of inoculum. Here, two animals were resistant to the challenge with 1·5x107 peripheral leucocytes from a PL cow. That infection dose is very high, since in similar experimental conditions only 924 bovine leucocytes were proven to be sufficient to establish infection in sheep (Mammerickx et al., 1987Down ). This heavy challenge might explain why sheep 14 became infected. Alternatively, differences in strains may explain the inability of pBLVDX to fully protect all of the animals.

In conclusion, the data reported here provide evidence that attenuated, infectious BLV plasmid DNA is able to efficiently protect sheep against challenge infections. However, to be more practical, additional experiments have to be performed in cattle, since it appears to be more difficult to protect cattle than sheep (Kerkhofs et al., 2000Down , accompanying paper).


   Acknowledgments
 
R. Kettmann and L. Willems are respectively Research Director and Senior Research Associate of the Belgian FNRS. This work was supported by the ‘Belgian Association Against Cancer’, the ‘Caisse generale d’Epargne et de Retraite (CGER)’, and by ‘Maria Sklodowska-Curie Fund II’.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Daniel, M. F., Kirchhoff, F., Czajak, S. C., Sehgal, P. K. & Desrosiers, R. C. (1992). Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene.Science 258, 1938-1941.[Abstract/Free Full Text]

Desrosiers, R. C. (1992). HIV with multiple gene deletions as a live attenuated vaccine for AIDS.AIDS Research & Human Retroviruses 8, 411-420.[Medline]

Desrosiers, R. C., Lifson, J. D., Gibbs, D., Czajak, S. C., Howe, A. Y. M., Arthur, L. O. & Johnson, R. P. (1998). Identification of highly attenuated mutants of simian immunodeficiency virus.Journal of Virology 72, 1431-1437.[Abstract/Free Full Text]

Hosie, M. J., Flynn, J. N., Rigby, A. A., Cannon, C., Dunsford, T., Mackay, N. A., Argyle, D., Willett, B. J., Miyazawa, T., Onions, D. E., Jarrett, O. & Neil, J. C. (1998). DNA vaccination affords significant protection against feline immunodeficiency virus infection without inducing detectable antiviral antibodies.Journal of Virology 72, 7310-7319.[Abstract/Free Full Text]

Kerkhofs, P., Heremans, H., Burny, A., Kettmann, R. & Willems, L. (1998). In vitro and in vivo oncogenic potential of bovine leukemia virus G4 protein.Journal of Virology 72, 2554-2559.[Abstract/Free Full Text]

Kerkhofs, P., Gatot, J.-S., Knapen, K., Mammerickx, M., Birny, A., Portetelle, D., Willems, L. & Kettmann, R. (2000). Long-term protection against bovine leukaemia virus replication in cattle and sheep.Journal of General Virology 81, 957-963.[Abstract/Free Full Text]

Langlois, A. J., Desrosiers, R. C., Lewis, M. G., Kewalramani, V. H., Littman, D. R., Zhou, J. Y., Manson, K., Wyand, M. S., Bolognesi, D. P. & Montefiori, D. C. (1998). Neutralizing antibodies in sera from macaques immunized with attenuated simian immunodeficiency virus.Journal of Virology 72, 6950-6955.[Abstract/Free Full Text]

Lassauzet, M., Johnson, W., Thurmond, M. & Stevens, F. (1989). Protection of colostral antibodies against bovine leukemia virus infection in calves on a California dairy.Canadian Journal of Veterinary Research 53, 424-430.

Lu, Y., Salvato, M. S., Pauza, C. D., Li, J., Sodroski, J., Manson, K., Wyand, M. S., Letvin, N., Jenkins, S., Touzian, N., Chutkowski, C., Kushner, N., LeFaile, M., Payne, G. L. & Roberts, B. (1996). Utility of SHIV for testing HIV-1 vaccine candidates in macaques.Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 12, 99-106.[Medline]

Mammerickx, M., Portetelle, D., Burny, A. & Leunen, J. (1980). Detection by immunodiffusion – and radioimmunoassay – tests of antibodies to bovine leukemia virus antigens in sera of experimentally infected sheep and cattle.Zentralblatt für Veterinärmedizin, Reihe B 27, 291-303.

Mammerickx, M., Portetelle, D., De Clerco, K. & Burny, A. (1987). Experimental transmission of enzootic bovine leukosis to cattle, sheep and goats: infectious doses of blood and incubation period of the disease.Leukemia Research 11, 353-358.[Medline]

Ohishi, K., Suzuki, H., Yamamoto, T., Maruyama, T., Miki, K., Ikawa, Y., Numakunai, S., Okada, K., Ohshima, K. & Sugimoto, M. (1991). Protective immunity against bovine leukaemia virus (BLV) induced in carrier sheep by inoculation with a vaccinia–BLV env recombinant: association with cell-mediated immunity.Journal of General Virology 72, 1887-1892.[Abstract/Free Full Text]

Ohishi, K., Suzuki, H., Yasutomi, Y., Onima, M., Okada, K., Numakumai, S., Ohsima, K., Ikawa, Y. & Sugimoto, M. (1992). Augmentation of bovine leukaemia virus (BLV)-specific lymphocyte proliferation responses in ruminant by inoculation with BLV env-recombinant vaccinia virus: the role in the suppression of BLV replication.Microbiology and Immunology 36, 1317-1323.[Medline]

Portetelle, D., Callebaut, I., Bex, F. & Burny, A. (1993). Vaccination against animal retroviruses. In Progress in Vaccinology, pp. 87-138. Edited by R. Pandey, S. Hoglund & G. Prassad. Berlin: Springer-Verlag.

Reichert, M. & Grundboeck-Juko, J. (1991). Molecular cloning of provirus DNA from bovine leukaemia lymphocytes and its application as a probe for diagnostic purpose.Acta Biochimica Polonica 38, 111-114.[Medline]

Sagata, N., Yasunaga, Y., Tsuzuku-Kawamura, J., Ohishi, K., Ogawa, Y. & Ikawa, Y. (1985). Complete nucleotide sequence of the genome of bovine leukemia virus: its evolutionary relationship to other retroviruses.Proceedings of the National Academy of Sciences, USA 82, 677-681.[Abstract/Free Full Text]

Shibata, R., Simeon, C., Czajak, S. C., Desrosiers, R. C. & Martin, A. M. (1997). Live, attenuated simian immunodeficiency virus vaccines elicit potent resistance against a challenge with a human immunodeficiency virus type 1 chimeric virus.Journal of Virology 71, 8141-8148.[Abstract]

Van den Broeke, A., Cleuter, Y., Chen, G., Portetelle, D., Mammerickx, M., Zagury, D., Fouchard, M., Coulombel, L., Kettmann, R. & Burny, A. (1988). Even transcriptionally competent proviruses are silent in bovine leukemia virus-infected sheep tumor cells.Proceedings of the National Academy of Sciences, USA 85, 9263-9267.[Abstract/Free Full Text]

Willems, L., Kettmann, R., Dequiedt, F., Portetelle, D., Voneche, V., Cornil, L., Kerkhofs, P., Burny, A. & Mammerickx, M. (1993). In vivo infection of sheep by bovine leukemia virus mutants.Journal of Virology 67, 4078-4085.[Abstract/Free Full Text]

Willems, L., Kerkhofs, P., Dequiedt, F., Portetelle, D., Mammerickx, M., Burny, A. & Kettmann, R. (1994). Attenuation of bovine leukemia virus by deletion of R3 and G4 open reading frames.Proceedings of the National Academy of Sciences, USA 91, 11532-11536.[Abstract/Free Full Text]

Willems, L., Gatot, J. S., Mammerickx, M., Portetelle, D., Burny, A., Kerkohofs, P. & Kettmann, R. (1995). The YXXL signalling motifs of the bovine leukemia transmembrane protein are required for in vivo infection and maintenance of high viral loads.Journal of Virology 69, 4137-4141.[Abstract]

Willems, L., Kerkhofs, P., Attenelle, L., Burny, A., Portetelle, D. & Kettmann, R. (1997). The major homology region of bovine leukemia virus p24gag is required for virus infectivity in vivo.Journal of General Virology 78, 637-640.[Abstract]

Wyand, M. S., Manson, K. H., Garcia-Moll, M., Montefiori, D. C. & Desrosiers, R. C. (1996). Vaccine protection by a triple deletion mutant of simian immunodeficiency virus.Journal of Virology 70, 3724-3733.[Abstract]

Received 18 August 1999; accepted 20 December 1999.


This article has been cited by other articles:


Home page
J DAIRY SCIHome page
M. A. Juliarena, M. Poli, C. Ceriani, L. Sala, E. Rodriguez, S. Gutierrez, G. Dolcini, A. Odeon, and E. N. Esteban
Antibody response against three widespread bovine viruses is not impaired in Holstein cattle carrying bovine leukocyte antigen DRB3.2 alleles associated with bovine leukemia virus resistance
J Dairy Sci, January 1, 2009; 92(1): 375 - 381.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Florins, N. Gillet, M. Boxus, P. Kerkhofs, R. Kettmann, and L. Willems
Even Attenuated Bovine Leukemia Virus Proviruses Can Be Pathogenic in Sheep
J. Virol., September 15, 2007; 81(18): 10195 - 10200.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Lefebvre, V. Ciminale, A. Vanderplasschen, D. D'Agostino, A. Burny, L. Willems, and R. Kettmann
Subcellular Localization of the Bovine Leukemia Virus R3 and G4 Accessory Proteins
J. Virol., June 27, 2002; 76(15): 7843 - 7854.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Kerkhofs, J.-S. Gatot, K. Knapen, M. Mammerickx, A. Burny, D. Portetelle, L. Willems, and R. Kettmann
Long-term protection against bovine leukaemia virus replication in cattle and sheep
J. Gen. Virol., April 1, 2000; 81(4): 957 - 963.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reichert, M.
Right arrow Articles by Kettmann, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reichert, M.
Right arrow Articles by Kettmann, R.
Agricola
Right arrow Articles by Reichert, M.
Right arrow Articles by Kettmann, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS