|
|
||||||||
Animal: RNA Viruses |
Unité de Virologie et Immunologie moléculaires1 and Unité de Biochimie et Structure des protéines2, Institut National de la Recherche Agronomique, F-78350 Jouy-en-Josas, France
Author for correspondence: Bernard Delmas. Fax +33 1 3465 2621. e-mail delmas{at}biotec.jouy.inra.fr
| Abstract |
|---|
|
|
|---|
Ala motifs. A trans activity of the VP4 protease of IBDV, and also IPNV VP4 protease, was demonstrated by co-expression of VP4 and a polypeptide substrate in Escherichia coli. For both proteases, cleavage specificity was identical in the cis- and trans-activity assays. An attempt was made to determine whether VP4 proteases of IBDV and IPNV were able to cleave heterologous substrates. In each case, no cleavage was observed with heterologous combinations. These results on the IBDV VP4 confirm and extend our previous characterization of the IPNV VP4, delineating the birnavirus protease as a new type of viral serine protease. | Introduction |
|---|
|
|
|---|
We have recently reported the characterization of the IPNV VP4 protease (Petit et al., 2000
), showing that this protease may use a catalytic serinelysine dyad, a catalytic site previously identified in several prokaryotic peptidases and hydrolases (for a review, see Barrett & Rawlings, 1995
). The IPNV VP4 cleavage sites were identified by N-terminal sequencing. They were probed by mutagenesis and found to be defined by the (Ser/Thr)XAla
(Ser/Ala) motif. For IBDV, the canonical HisAspSer catalytic triad found in classical chymotrypsin-like proteases has been proposed as the VP4 active site (Brown & Skinner, 1996
). Immunoelectron microscopy data from IBDV-infected cells showed that the VP4 protein does not appear to be a constituent of mature virions, but is mainly associated with tubules 24 nm in diameter (Granzow et al., 1997
). Recently, site-directed mutagenesis experiments allowed the identification of two tripeptides, Leu-511AlaAla-513 and Met-754AlaAla-756, that are essential for processing at the pVP2VP4 and VP4VP3 junctions. A secondary pVP2VP4 processing site was also detected upstream of the LeuAlaAla site (Sanchez & Rodriguez, 1999
).
With the identification of catalytic residues and of the cleavage sites of IBDV VP4, the present analysis extends our previous characterization of the IPNV protease and leads us to propose that the birnavirus VP4 defines a novel group of serine proteolytic enzymes.
| Methods |
|---|
|
|
|---|
Construction of the IBDV segment A (IBDA) expression vector pUC-IBDA.
Site-directed mutagenesis of pUC19/IBDA.
Mutations were introduced by using Pfu DNA polymerase with the QuikChange site-directed mutagenesis kit (Stratagene) as described by the manufacturer. For some mutations, a novel restriction site (EcoRI) was introduced (Table 1
), and sequence analysis was carried out to confirm the amino acid changes.
|
Construction of plasmids expressing truncated IBDA segments.
0), a PCR was carried out with the Pfu DNA polymerase, pUC19/IBDA as template and oligonucleotides 5' GGGAATTCAGGAACTGCTCGAGCCGCGTC 3' and 5' CGGAATTCTCAAGGTCCTCATCAGAGACGG 3' for cloning into the EcoRI restriction site of pET-28b (Novagen). Thus, six histidines and a T7 epitope were present at the N terminus of the open reading frame and six histidines at the C terminus of VP3. To obtain the reading frame M-VP4His, carrying the complete VP4 sequence in a bacterial expression plasmid, the VP4 sequence was amplified by PCR with the oligonucleotides 5' CGTCGTCCATGGCCGACAAGGGGTACGAGGTAGTC 3' and 5' CGTCGTCTCGAGAGCCATTGCAAGGTGGTACTGGCGTCC 3' for cloning between the NcoI and XhoI sites of pET-28b. Thus, six histidines were present at the C terminus of VP4, after Ala-755. The mutated form M-VP4His S652T was constructed by site-directed mutagenesis with suitable oligonucleotides as described above.
To obtain a reading frame carrying the pVP2VP4 junction (named VP24j), the pET-28b/VP43
0 plasmid was digested with HindIII, treated with Klenow fragment to fill recessed 3' termini and self-ligated. Thus, a stop codon was located after Ser-687 (see Fig. 5
). The pET-28b/VP24j plasmid was cut with NcoI and Bpu1102I and the insert was subcloned in a modified pET-22b vector (Novagen), in which the pelB leader sequence was deleted and the NcoI restriction site was located on the initiation codon. Thus, bacterial expression of VP24j could be carried out in medium containing ampicillin or kanamycin.
|
Construction of plasmids expressing truncated IPNV segments A (IPNA).
In vitro expression, protein labelling and immunoprecipitation.
In vitro T7-driven expression was carried out by using the TNT Quick coupled transcription/translation system (Promega) as described by the manufacturer, except that reactions were performed in a final volume of 11 µl. The DNA template (1 µg) was incubated for 1·5 h at 30 °C, aliquots of 23 µl were submitted to 10% SDSPAGE, essentially according to Laemmli (1970)
, and gels were dried for autoradiography.
N-terminal sequence determination of VP3 and VP4 polypeptides expressed in E. coli.
Two hundred and fifty ml of an overnight liquid culture of E. coli BL21 (DE3) carrying the construct VP43
0 was diluted in an equal volume of LB medium containing kanamycin (50 µg/ml) and expression was induced with 1 mM IPTG for 4 h at room temperature. The induced cells were collected by centrifugation at 5000 g for 5 min and resuspended in 50 ml of 50 mM TrisHCl (pH 8), 2 mM EDTA. After an additional centrifugation (5000 g, 5 min), cells were resuspended in 15 ml of 50 mM TrisHCl (pH 8), 60 mM NaCl with a cocktail of protease inhibitors without EDTA (Boehringer Mannheim). Lysozyme was added to a concentration of 300 µg/ml and the mixture was placed in an ice bath for 30 min. Fifty µl benzonase (Boehringer) and 42 µl of 1 M MgCl2 was added and the mixture was incubated for 10 min. The lysates were centrifuged at 13000 r.p.m. for 1 h at 4 °C. The supernatants were diluted in 20 mM TrisHCl (pH 8), 5 mM imidazole, 0·5 M NaCl. The pellet was resuspended in the same buffer supplemented with 6 M urea and solubilized overnight at 4 °C with mild agitation. This material was clarified by centrifugation (13000 g, 30 min). The VP3 and VP4 polypeptides were solubilized in the buffer containing urea and they were processed for Ni2+ affinity chromatography under denaturing conditions as described by Novagen. The VP3 polypeptides were eluted by the 200 mM imidazole buffer. About 1 nmol VP3 was processed for automated N-terminal Edman sequencing with a Perkin Elmer Applied Biosystems Procise 494A sequencer with the manufacturers reagents and methods. For the VP4 polypeptide, an aliquot of the material eluted from the column by the binding buffer (5 mM imidazole, 0·5 M NaCl, 6 M urea, 20 mM TrisHCl, pH 7·9) was loaded on a 10% polyacrylamide gel for blotting on a ProBlott membrane (Applied Biosystems). The band was visualized by staining with 0·1% Coomassie blue R250 in methanol:acetic acid:water (40:1:59) (1 min at room temperature) and destaining in 50% methanol. The polypeptide of interest was submitted for N-terminal sequencing.
Protease trans-activity assay.
Cultures of recombinant E. coli BL21 harbouring the two plasmids were precultured overnight in 2 ml LB medium containing ampicillin (100 µg/ml) and kanamycin (50 µg/ml) at 37 °C with shaking. The cultured cells were diluted in an equal volume of the same medium with 1 mM IPTG and shaken for a further 4 h. The cultured cells were then harvested and suspended in water and a portion of the supernatant was submitted to SDSPAGE for Coomassie blue staining or for blotting on a ProBlott membrane. The processed products were visualized by Coomassie blue staining for N-terminal sequencing.
| Results |
|---|
|
|
|---|
|
0 construct encoding a 5'-truncated form of the polyprotein with part of pVP2, VP4 and VP3 fused to two 6xHis tags located at the N and C termini (Fig. 2a
0 polypeptide was expressed in E. coli and VP3His protein was found in the inclusion bodies. VP3His was purified by Ni2+ affinity chromatography and direct sequence analysis of its first seven amino acids was carried out (Fig. 2b
|
|
0 polypeptide was expressed in E. coli and the inclusion body material that was not retained on the Ni2+ column was blotted on a membrane for N-terminal sequencing of the VP4 protein. Sequence analysis of the first seven amino acids was carried out (Fig. 2b
|
Trans-activity of the IBDV and IPNV VP4 proteases
To measure the ability of the VP4 protease to cleave a substrate in trans, we developed a co-expression assay that detects cleavage activity by co-transformation of E. coli with the expression plasmids pET/VP4His as the source of proteolytic activity and pET/VP24j IBDV as the substrate (Fig. 5
). pET/VP24j encodes a portion of the IBDV segment A genome leading to expression of amino acids 490687, which include the C-terminal domain of pVP2 and the first 175 amino acids of VP4. Thus, the cleavage site between pVP2 and VP4 (P1P1' position: residues 512513) and two potential alternative cleavage sites (P1P1' positions residues 494495 and 501502) are present in this construct. As shown in Fig. 5(b)
, we found that the VP24j polypeptide disappeared only when the VP4 protease was co-expressed. As a result of the cleavage, a polypeptide of 23 kDa was generated. Processing of the VP24j polypeptide was not due to experimental artefacts, as demonstrated by co-expression of VP24j with an inactive protease (by mutation of Ser-652 to Thr; VP4His S652T) (Fig. 5
). To map the cleavage site on VP24j, the bacterial material was blotted on a membrane for N-terminal sequencing. The first eight amino acids of the 23 kDa band were identified as NH2-ADKGYEVV, corresponding to the N terminus of VP4. These results indicated that IBDV VP4 can act efficiently in trans and that the substrate specificity was identical in the cis- (self-cleavage activity) and trans-activity assays.
To extend our observations on another birnavirus protease, we constructed two expression plasmids, pET/VP43 IPNV as the source of IPNV VP4 proteolytic activity and pET/VP24j IPNV for substrate (Fig. 6
). pET/VP24j IPNV encodes the junction domain between VP2 and VP4, leading to expression of amino acids 480624 (Fig. 6a
). As shown in Fig. 6(b)
, co-expression of the two polypeptides resulted in the partial cleavage of VP24j IPNV to generate a 15 kDa band. To determine the cleavage site in this assay, the 15 kDa protein was processed for N-terminal sequencing. The first seven residues were identified as NH2-SGGPDGK, residues corresponding to the N terminus of IPNV VP4 (Petit et al., 2000
). Similarly to the results reported above for IBDV, this result shows that the substrate specificity for IPNV VP4 was identical in the trans- and cis-activity assays.
|
|
| Discussion |
|---|
|
|
|---|
In this study, we first used site-directed mutagenesis to ascertain the importance of the two homologous residues of IBDV VP4 for its protease activity. Ser-652 and Lys-692 were critical for this function. It is very likely that Ser-652 represents the nucleophilic residue because its substitution by threonine or alanine completely abolished the self-cleavage activity of the polyprotein, whereas its substitution by cysteine, which can act as the nucleophile in several viral proteases (Babé & Craik, 1997
), yielded a mutant protein with good activity. Finally, all of the substitutions of Lys-692 resulted in complete inactivation of the protease activity, suggesting strongly that this residue acts as a general base at the catalytic site. Thus, these residues appear to be the functional counterparts of Ser-633 and Lys-674 of IPNV VP4. These results confirm our previous proposition (Petit et al., 2000
) that the birnavirus VP4s may use a serinelysine catalytic dyad. Such a catalytic serinelysine dyad has been characterized from prokaryotic serine proteases and hydrolases such as D-AlaD-Ala peptidase A and the
-lactamases (with the catalytic motif SerXXLys) and from peptidases such as the bacterial signal (or leader) peptidases and from the LexA repressor family (with these catalytic residues distant on the primary sequence) (Strynadka et al., 1992
; Paetzel et al., 1998
; Peat et al., 1996
; Barrett & Rawlings, 1995
). This catalytic dyad has only been described in eukaryotes from the two subunits of the mitochondrial inner membrane protease of the yeast Saccharomyces cerevisiae (Nunnari et al., 1993
).
The IBDV VP4 cleavage sites have been determined by direct N-terminal sequence analysis of the cleavage products generated in E. coli, and they were probed by mutagenesis. The N-terminal residues of VP4 and VP3 were identified as Ala-513 and Ala-756, respectively. This was in accordance with the identification of the tripeptides Leu-511AlaAla-513 and Met-754AlaAla-756 as critical for cleavage of the pVP2VP4 and VP4VP3 junctions, respectively (Sanchez & Rodriguez, 1999
). The two cleavage sites thus identified possess structural similarities. They are characterized by the (Thr/Ala)XAla
Ala motif, with alanines in the P1P1' positions and a threonine or an alanine in the P3 position. Even though they were not directly determined by N-terminal sequence determination, three other (putative) cleavage sites in the C-terminal part of pVP2 (P1P1' positions 487488, 494495 and 501502) were characterized indirectly. Firstly, these cleavage sites were identified by sequence comparison: the P1P1' residues were conserved as an alanine doublet, the P3 residue as an alanine and the P2'P3' residues (SerGly) were identical for these three cleavage sites. Secondly, only cumulative mutagenesis of the P1P1' residues of all four AlaAla doublets (487488, 494495, 501502 and 512513) abolished processing completely at the mutated junction, thus revealing the existence of three alternative cleavage sites at these positions.
The pVP2 to VP2 conversion observed in infected cells involves one (or multiple) cleavage(s) of pVP2 near its C terminus, an event proposed to be associated with VP4 protease activity (Azad et al., 1987
; Kibenge et al., 1997
). The identification of three alternative cleavage sites for VP4 in the C-terminal domain of pVP2 argues strongly for the implication of VP4 in the pVP2 to VP2 conversion. It is noteworthy that, for IBDV, we identified (by N-terminal sequencing and mutagenesis) four cleavage sites between the VP2 and VP4 domains, whereas only three cleavage sites were defined for IPNV (Petit et al., 2000
). This probably indicates that during the assembly of the virus particle, an event probably associated with the conversion of pVP2 to the VP2 mature form, different structural constraints exist for the maturation of the IBDV and IPNV particles.
The IBDV cleavage motif thus defined, (Thr/Ala)XAla
Ala(SerGly), was not fully conserved for the cleavage sites of IPNV and DXV. The IPNV VP4 cleavage sites were defined by the consensus motif (Ser/Thr)XAla
(Ser/Ala)Gly, whereas the DXV cleavage site between the VP2 and VP4 domains could be defined as an AlaXSer
Ala motif (Chung et al., 1996
). Our results indicate that, even though these cleavage site motifs have strong similarities, the VP4 proteases of birnaviruses are species specific, since they do not cleave heterologous substrates. In addition, it is interesting to note that, for bacterial signal peptidases (which possess the serinelysine catalytic dyad), alanine residues are the most common residues at the P1 and P3 positions, giving the so-called -1, -3 or AlaXAla rule. The similarities observed between their catalytic sites and substrate cleavage sites suggest that these birnavirus proteases and prokaryotic signal peptidases are structurally related.
A trans-cleavage assay of IBDV and IPNV VP4 was developed, which detects cleavage activity in E. coli. By using a co-expressed substrate, the cleavage activity was detected by SDSPAGE and Coomassie blue staining. We determined by N-terminal sequencing that cleavage specificity was conserved in this assay. We believe that the VP4 trans-activity is likely to occur in vivo, since the pVP2 to VP2 conversion is probably associated with VP4 cleavage sites at the C terminus of pVP2. It is interesting to note that previous attempts to detect a trans-cleavage activity of VP4 failed: in vitro or baculovirus-driven co-expression experiments with IPNV VP4 and truncated precursor polypeptides never allowed the detection of a trans-activity of the protease (Manning et al., 1990
; Magyar & Dobos, 1994
). This difference can probably be explained by the high level of expression obtained in E. coli, compared with these other expression systems. Our results suggest that it may be possible to develop a more convenient cleavage assay that would allow the screening of birnavirus protease inhibitors.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Babé, L. M. & Craik, C. S. (1997). Viral proteases: evolution of diverse structural motifs to optimize function. Cell 91, 427-430.[Medline]
Barrett, A. J. & Rawlings, N. D. (1995). Families and clans of serine peptidases. Archives of Biochemistry and Biophysics 318, 247-250.[Medline]
Böttcher, B., Kiselev, N. A., StelMashchuk, V. Y., Perevozchikova, N. A., Borisov, A. V. & Crowther, R. A. (1997). Three-dimensional structure of infectious bursal disease virus determined by electron cryomicroscopy. Journal of Virology 71, 325-330.
Brown, M. D. & Skinner, M. A. (1996). Coding sequences of both genome segments of a European very virulent infectious bursal disease virus. Virus Research 40, 1-15.[Medline]
Chung, H. K., Kordyban, S., Cameron, L. & Dobos, P. (1996). Sequence analysis of the bicistronic Drosophila X virus genome segment A and its encoded polypeptides. Virology 225, 359-368.[Medline]
Dobos, P., Hill, B. J., Hallett, R., Kells, D. T. C., Becht, H. & Teninges, D. (1979). Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded RNA genomes. Journal of Virology 32, 593-605.
Dobos, P., Berthiaume, L., Leong, J. A., Kibenge, F. S. B., Muller, H. & Nicholson, B. L. (1995). Family Birnaviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp. 240-244. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag.
Granzow, H., Birghan, C., Mettenleiter, T. C., Beyer, J., Köllner, B. & Mundt, E. (1997). A second form of infectious bursal disease virus-associated tubule contains VP4. Journal of Virology 71, 8879-8885.
Hudson, P. J., McKern, N. M., Power, B. E. & Azad, A. A. (1986). Genomic structure of the large RNA segment of infectious bursal disease virus. Nucleic Acids Research 14, 5001-5012.
Jagadish, M. N., Staton, V. J., Hudson, P. J. & Azad, A. A. (1988). Birnavirus precursor polyprotein is processed in Escherichia coli by its own virus-encoded polypeptide. Journal of Virology 62, 1084-1087.
Kibenge, F. S. B., Qian, B., Cleghorn, J. R. & Martin, C. K. (1997). Infectious bursal disease virus polyprotein processing does not involve cellular proteases. Archives of Virology 142, 2401-2419.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Magyar, G. & Dobos, P. (1994). Expression of infectious pancreatic necrosis virus polyprotein and VP1 in insect cells and the detection of the polyprotein in purified virus. Virology 198, 437-445.[Medline]
Manning, D. S., Mason, C. L. & Leong, J. C. (1990). Cell-free translational analysis of the processing of infectious pancreatic necrosis virus polyprotein. Virology 179, 9-15.[Medline]
Morgan, M. M., Macreadie, I. G., Harley, V. R., Hudson, P. J. & Azad, A. A. (1988). Sequence of the small double-stranded RNA genomic segment of infectious bursal disease virus and its deduced 90-kDa product. Virology 163, 240-242.[Medline]
Mundt, E., Beyer, J. & Müller, H. (1995). Identification of a novel viral protein in infectious bursal disease virus-infected cells. Journal of General Virology 76, 437-443.
Nunnari, J., Fox, T. D. & Walter, P. (1993). A mitochondrial protease with two catalytic subunits of nonoverlapping specificities. Science 262, 1997-2004.
Paetzel, M., Dalbey, R. E. & Strynadka, N. C. J. (1998). Crystal structure of a bacterial signal peptidase in complex with a
-lactam inhibitor. Nature 396, 186-190.[Medline]
Peat, T. S., Frank, E. G., McDonald, J. P., Levine, A. S., Woodgate, R. & Hendrickson, W. A. (1996). Structure of the UmuD' protein and its regulation in response to DNA damage. Nature 380, 727-730.[Medline]
Petit, S., Lejal, N., Huet, J.-C. & Delmas, B. (2000). Active residues and viral substrate cleavage sites of the protease of the birnavirus infectious pancreatic necrosis virus. Journal of Virology 74 20572066.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanchez, A. B. & Rodriguez, J. F. (1999). Proteolytic processing in infectious bursal disease virus: identification of the polyprotein cleavage sites by site-directed mutagenesis. Virology 262, 190-199.[Medline]
Strynadka, N. C. J., Adachi, H., Jensen, S. E., Johns, K., Sielecki, A., Betzel, C., Sutoh, K. & James, M. N. G. (1992). Molecular structure of the acylenzyme intermediate in
-lactam hydrolysis at 1·7
resolution. Nature 359, 700-705.[Medline]
Received 13 October 1999;
accepted 2 December 1999.
This article has been cited by other articles:
![]() |
J. Lee, A. R. Feldman, B. Delmas, and M. Paetzel Crystal Structure of the VP4 Protease from Infectious Pancreatic Necrosis Virus Reveals the Acyl-Enzyme Complex for an Intermolecular Self-cleavage Reaction J. Biol. Chem., August 24, 2007; 282(34): 24928 - 24937. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chevalier, M. Galloux, J. Pous, C. Henry, J. Denis, B. Da Costa, J. Navaza, J. Lepault, and B. Delmas Structural Peptides of a Nonenveloped Virus Are Involved in Assembly and Membrane Translocation J. Virol., October 1, 2005; 79(19): 12253 - 12263. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Villanueva, J. L. Galaz, J. A. Valdes, M. M. Jashes, and A. M. Sandino Genome Assembly and Particle Maturation of the Birnavirus Infectious Pancreatic Necrosis Virus J. Virol., December 15, 2004; 78(24): 13829 - 13838. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. I. von Einem, A. E. Gorbalenya, H. Schirrmeier, S.-E. Behrens, T. Letzel, and E. Mundt VP1 of infectious bursal disease virus is an RNA-dependent RNA polymerase J. Gen. Virol., August 1, 2004; 85(8): 2221 - 2229. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Galloux, C. Chevalier, C. Henry, J.-C. Huet, B. D. Costa, and B. Delmas Peptides resulting from the pVP2 C-terminal processing are present in infectious pancreatic necrosis virus particles J. Gen. Virol., August 1, 2004; 85(8): 2231 - 2236. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chevalier, J. Lepault, B. Da Costa, and B. Delmas The Last C-Terminal Residue of VP3, Glutamic Acid 257, Controls Capsid Assembly of Infectious Bursal Disease Virus J. Virol., April 1, 2004; 78(7): 3296 - 3303. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dieye, A. J. W. Hoekman, F. Clier, V. Juillard, H. J. Boot, and J.-C. Piard Ability of Lactococcus lactis To Export Viral Capsid Antigens: a Crucial Step for Development of Live Vaccines Appl. Envir. Microbiol., December 1, 2003; 69(12): 7281 - 7288. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Zinovkin, T. N. Erokhina, D. E. Lesemann, W. Jelkmann, and A. A. Agranovsky Processing and subcellular localization of the leader papain-like proteinase of Beet yellows closterovirus J. Gen. Virol., August 1, 2003; 84(8): 2265 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Da Costa, S. Soignier, C. Chevalier, C. Henry, C. Thory, J.-C. Huet, and B. Delmas Blotched Snakehead Virus Is a New Aquatic Birnavirus That Is Slightly More Related to Avibirnavirus Than to Aquabirnavirus J. Virol., January 1, 2003; 77(1): 719 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. J. Tacken, B. P. H. Peeters, A. A. M. Thomas, P. J. M. Rottier, and H. J. Boot Infectious Bursal Disease Virus Capsid Protein VP3 Interacts both with VP1, the RNA-Dependent RNA Polymerase, and with Viral Double-Stranded RNA J. Virol., November 15, 2002; 76(22): 11301 - 11311. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chevalier, J. Lepault, I. Erk, B. Da Costa, and B. Delmas The Maturation Process of pVP2 Requires Assembly of Infectious Bursal Disease Virus Capsids J. Virol., March 1, 2002; 76(5): 2384 - 2392. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Da Costa, C. Chevalier, C. Henry, J.-C. Huet, S. Petit, J. Lepault, H. Boot, and B. Delmas The Capsid of Infectious Bursal Disease Virus Contains Several Small Peptides Arising from the Maturation Process of pVP2 J. Virol., March 1, 2002; 76(5): 2393 - 2402. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Caston, J. L. Martinez-Torrecuadrada, A. Maraver, E. Lombardo, J. F. Rodriguez, J. I. Casal, and J. L. Carrascosa C Terminus of Infectious Bursal Disease Virus Major Capsid Protein VP2 Is Involved in Definition of the T Number for Capsid Assembly J. Virol., November 15, 2001; 75(22): 10815 - 10828. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Francois, N. Eterradossi, B. Delmas, V. Payet, and P. Langlois Construction of Avian Adenovirus CELO Recombinants in Cosmids J. Virol., June 1, 2001; 75(11): 5288 - 5301. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jungmann, H. Nieper, and H. Müller Apoptosis is induced by infectious bursal disease virus replication in productively infected cells as well as in antigen-negative cells in their vicinity J. Gen. Virol., May 1, 2001; 82(5): 1107 - 1115. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |