J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mackewicz, C. E.
Right arrow Articles by Levy, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mackewicz, C. E.
Right arrow Articles by Levy, J. A.
Agricola
Right arrow Articles by Mackewicz, C. E.
Right arrow Articles by Levy, J. A.
Journal of General Virology (2000), 81, 1261-1264.
© 2000 Society for General Microbiology


Animal: RNA Viruses

CD8+ cell noncytotoxic anti-human immunodeficiency virus response inhibits expression of viral RNA but not reverse transcription or provirus integration

Carl E. Mackewicz1, Bruce K. Patterson2, Sandra A. Lee1 and Jay A. Levy1

Department of Medicine, Box 1270, University of California, San Francisco, CA 94143, USA1
Children’s Memorial Hospital, Chicago, IL, USA2

Author for correspondence: Jay Levy. Fax +1 415 476 8365.


   Abstract
TOP
Abstract
Main text
References
 
CD8+ T cells from human immunodeficiency virus (HIV)-infected individuals can suppress HIV replication in CD4+ cells by a noncytotoxic mechanism that inhibits the expression of viral RNA. The present study examined whether other step(s) in the virus replicative cycle could be affected by the CD8+ cells. Culturing HIV-infected CD4+ T cells with antiviral CD8+ T cells did not significantly reduce the amounts of (i) early HIV DNA reverse transcripts (detected by LTR-U3/R), (ii) total nuclear HIV gag DNA, or (iii) integrated proviral DNA. However, exposure to the CD8+ T cells did cause a reduction in the amount of multiply spliced tat and full-length gag mRNA expressed by the infected CD4+ T cells, confirming previous observations. The levels of glyceraldehyde-3-phosphate dehydrogenase and interleukin-2 receptor-{alpha} mRNA were not affected. The results support the conclusion that the noncytotoxic anti-HIV response of CD8+ T cells, demonstrable in vitro, does not affect any of the virus replication steps leading to the integration of proviral HIV, but specifically interrupts the expression of viral RNA.


   Main text
TOP
Abstract
Main text
References
 
Noncytotoxic inhibition of human immunodeficiency virus (HIV) replication by CD8+ T cells from HIV-infected individuals (Walker et al., 1986Down ) has become well-documented over the past 10 years (Levy et al., 1996Down ). This antiviral response is characterized by the suppression of HIV production in infected cells upon coculture with CD8+ cells, or following exposure to CD8+ cell supernatants. Under both conditions, death of the infected target cells is not observed. The effector stage of this response does not require HLA histocompatibility and involves the inhibition of viral RNA expression (Chen et al., 1993Down ; Copeland et al., 1995Down ; Mackewicz et al., 1995Down ). In the present study, we sought to determine if the CD8+ cell noncytotoxic antiviral activity also affects early steps of HIV replication, prior to transcription of integrated proviral DNA.

Purified CD4+ cells, stimulated for 3 days in the presence of 3 µg/ml phytohaemagglutinin (PHA; Sigma), were infected with 6000 TCID50 of a molecular clone of HIV-1SF2 (Sanchez-Pescador et al., 1985Down ) for 1 h and then trypsinized to remove surface-bound particles as described (Mackewicz et al., 1994Down ). Two to four million cells, after washing, were cultured immediately in duplicate, either alone or with an equal number of PHA-stimulated CD8+ T cells isolated from an HIV-infected individual with known CD8+ cell antiviral activity (Mackewicz et al., 1994Down ). At selected intervals after the 1 h infection period, the cells were collected (from separate wells for each time-point), washed once with PBS, centrifuged, and the cell pellet was snap-frozen in an ethanol/dry ice bath. To control for the CD8+ cell proportion in the cocultures, an equal number of the same CD8+ cells (grown alone in parallel cultures) was added to the CD4+ cell controls just prior to pelleting and freezing.

Early virus replication events involving reverse transcription and proviral integration were monitored by measuring the levels of different species of HIV DNA. Quantification of early HIV DNA reverse transcripts in total cellular DNA was done essentially by the method of Tang et al. (1995)Down using primer sets specific for early LTR-U3/R reverse transcription products and real-time quantitative PCR methodology (Patterson et al., 1996Down , 1998Down , 1999Down ). The sequence of the primers and the probe used are as follows: LTR-U3, 5' CAGATATCCACTGACCTTTGG 3'; LTR-R, 5' GAGGCTTAAGCAGTGGGTTC 3'; R fluorogenic probe, 5' FAM-GGGAGCTCTCTGGCTAACT-TAMRA 3'. In brief, 45 µl of a reaction mix [1x Taqman PCR buffer (PE Applied Biosystems), 4·0 mM MgCl2, 200 µM dATP, 200 µM dCTP, 200 µM dGTP, 200 µM dTTP, 200 nM SK38 primer, 200 nM SK39 primer, 100 nM SK19 fluorogenic probe labelled at the 5' end with FAM and at the 3' end with TAMRA, 10 U AmpliTaq Gold polymerase] was added to approximately 500 ng of DNA in 5 µl of water. Thermal amplification was performed using the following linked profile: 10 min at 95 °C, 40 cycles of denaturation (95 °C for 15 s) and annealing/extension (60 °C for 1 min) in a 7700 sequence detection system (PE Applied Biosystems). This PCR product quantification method is based on the 5' to 3' cleavage of the fluorescently labelled, internally conserved, oligonucleotide probe which generates a signal that is measured by the 7700 sequence detection system. Quantification is achieved by generating standard curves from amplified tenfold dilution series of cloned reverse transcripts, in triplicate. The threshold cycle (Ct) was defined by the amplification cycle at which the signal in a particular sample exceeds the background fluorescent intensity. The standard deviation of the replicates was less than 10% for each dilution. To determine the efficiency of amplification and the linearity of the assay, the Ct was plotted against the log target copy number in each case. The linear range was found to be from five copies to greater than 106 copies with a correlation coefficient of 0·99. Negative controls consisting of plasmid DNA lacking the appropriate inserts or PBMC from HIV-seronegative individuals yielded no amplification signal. The sensitivity of this DNA quantification method is one to five copies.

Total nuclear HIV-1 DNA (integrated and unintegrated sequences) was quantified using a two-step technique as follows. First, nuclei were isolated from cells prior to DNA extraction (Higashikubo et al., 1990Down ). Second, quantitative real-time DNA PCR for HIV-1 gag DNA was performed as described above for the quantification of LTR-U3/R DNA, using the same probe but the following primer pair: LTR-U3 (shown above) and gag, 5' GCTTAATACTGACGCTCTCGCA 3'.

To specifically detect integrated HIV-1 DNA, nested PCR was performed by the method of Chun et al. (1997)Down . This method involves the amplification of the junctions of HIV and cellular DNA. First, total DNA extraction from a fivefold dilution series of cells was performed using Dnazol (Gibco) following the manufacturer’s protocol. Next, nested PCR was performed using Alu-5' LTR and Alu-3' LTR primers in the first reaction with the PCR conditions described (Chun et al., 1997Down ). The second amplification of the LTR region was also performed using primers and reaction conditions described (Chun et al., 1997Down ) except the detection and quantification was performed using the 7700 Sequence Detection system rather than the previously published Southern hybridization.

For quantification of viral RNA transcripts, the infected CD4+ cells cultured in the presence or absence of CD8+ cells were washed and extracted for RNA using TRI reagent (Molecular Research Center Inc.) as directed by the manufacturer’s protocol. The highly sensitive method of quantitative kinetic RT–PCR was performed by adding 45 µl of a reaction mix [1x RT Taqman PCR buffer (PE Applied Biosystems), 4·0 mM Mn(O)Ac2, 200 µM dATP, 200 µM dCTP, 200 µM dGTP, 200 µM dTTP, 200 nM upstream primer and 200 nM downstream primer, 100 nM fluorogenic Taqman probe labelled at the 5' end with FAM and at the 3' end with TAMRA, 10 U rTth polymerase] directly to 200 ng of total RNA in 5 µl RNase/DNase-free water (Ambion). Input RNA was normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification (PE Applied Biosystems). Reverse transcription and thermal amplification were performed using the following linked profile: reverse transcription 30 min at 60 °C, cDNA denaturation, 5 min at 95 °C and 40 cycles of denaturation (95 °C for 15 s), and annealing/extension (60 °C for 1 min) in a 7700 sequence detection system (PE Applied Biosystems). Duplicate standard curves with controls for RNA copy number ranging from 101 to 105 copies were run with each optical 96-well plate (PE Applied Biosystems). In addition, controls receiving no template were included with each plate. The sensitivity of this mRNA quantification method is five to ten copies. Primer and probe sequences for gag were previously described (Patterson et al., 1993Down ). The sequences for tat (spanning the major tat splice-donor/acceptor site) and the interleukin-2 receptor-{alpha} (IL-2R{alpha}) were as follows: tat.1 (5' AGACAGCGACGAAGAGCTCCTCA 3'), tat.2 (5' CTAATCGACCGGATCTGTCTCTGTC 3'), tat probe (5' FAM-TTCTCTATCAAAGCAACCCACCTCCCAATC-TAMRA 3'), IL-2R-upstream (5' CGATCTTCCCATCCCACATC 3'), IL-2R-downstream (5' GAAGCGGAGGTCTTTCTCTGC 3'), IL-2R-probe (5' FAM-TCCGGCGCGATGCCAAAAAG-TAMRA 3').

As commonly seen (Mackewicz & Levy, 1992Down ), culturing HIV-infected CD4+ T cells with an equal number of antiviral CD8+ T cells from an asymptomatic HIV-1-infected donor resulted in a marked reduction in virus particle production (RT activity) by 96 h compared to that seen in CD4+ T cells cultured alone (e.g. 3000 vs 109000 c.p.m./ml, respectively). This CD8+-cell-mediated reduction in virus production was not, however, accompanied by a difference in the amount of early reverse transcription products. At 3, 6, 12 and 24 h after the infection period, no appreciable difference was seen in the level of early LTR-U3/R reverse transcripts expressed in the infected CD4+ cells when cultured alone compared to when cultured in the presence of CD8+ cells (Fig. 1Down). The number of DNA copies in the CD4+ cells cultured with CD8+ cells differed by no more than 15% (usually considerably less) from that in the CD4+ cells cultured alone over this time-period. These results indicate that the CD8+ cell antiviral activity did not interfere with the post-virion binding events leading to and including the initiation of reverse transcription.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Effect of CD8+ cell antiviral activity on the expression of early LTR-U3/R HIV DNA in infected CD4+ cells. PHA-stimulated CD4+ T cells from an HIV-seronegative subject were inoculated with HIV-1SF2. After 1 h the cells were trypsinized, washed and cultured alone ({blacksquare}) or with an equal number of antiviral CD8+ cells from an HIV-infected subject ({circ}). At the indicated time-points after the inoculation period, total cellular DNA was extracted from cells and the amount of early HIV reverse transcripts was quantified by PCR using primer pairs specific for HIV LTR-U3/R transcripts as described in the text. The results indicate the mean±SD obtained from three separate PCR amplifications and represent the number of specified copies per 20000 units of {beta}-actin. They are representative of three separate experiments. Quantification of LTR-U3/R transcripts in HIV-1IIIB-infected CEM cells, to serve as a positive control, yielded 3900 copies.

 
Quantification of HIV gag sequences in total nuclear DNA, isolated at the same time-points as above, also revealed no difference between the levels in the infected CD4+ cells cultured alone and in those exposed to CD8+ cells (data not shown). Thus, nuclear maturation of the early transcripts also appears to be unaffected by this antiviral mechanism.

Specific quantification of integrated HIV DNA showed that culturing antiviral CD8+ cells with infected CD4+ cells also did not affect the amount of virus DNA present in the integrated provirus form (Fig. 2Down). Although some variation was observed, the resulting kinetics of provirus appearance in the infected cells was not significantly different in the CD4+ cells cultured alone relative to the CD4+/CD8+ cell cocultures. The apparent lack of an increased number of integrated HIV copies in the control cultures relative to the cocultures at the late time-points of 48 and 96 h, probably results from a balance between the loss of cells that have replicated virus and died, and the addition of cells newly infected by virus spread. Thus, the above results suggest that reverse transcription is not affected by the CD8+ cell antiviral activity and that virus replication proceeds unaffected through proviral integration, but is blocked at some point thereafter.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Effect of CD8+ cell antiviral activity on the level of integrated proviral HIV DNA in CD4+ cells. PHA-stimulated CD4+ T cells from an HIV-seronegative subject were inoculated with HIV-1SF2. After 1 h the cells were trypsinized, washed and cultured alone ({blacksquare}) or with an equal number of antiviral CD8+ cells from an HIV-infected subject ({circ}). At the indicated time-points after the inoculation period, total cellular DNA was extracted from the cells and provirus–cellular DNA junctions were amplified by the method of Chun et al. (1997)Down using primer pairs specific for HIV LTR and gag as described in the text. The results indicate the mean±SE obtained from two separate experiments and represent the number of integrated copies of HIV per 1000 units of {beta}-actin.

 
In order to further evaluate previous observations suggesting that CD8+ cells inhibit the expression of HIV RNA, quantitative kinetic RT–PCR was used to measure the effect of CD8+ cell antiviral activity on the expression of tat and gag mRNA in the infected CD4+ cell cultures described above after 3, 6, 12, 24 and 96 h. By 3 h post-infection, tat and gag transcription was detectable in the infected CD4+ cells cultured alone (Fig. 3Down). The level of both messages increased about 1 log by 12 h and then, in the case of the gag message, another 1 log by 96 h post-infection. Importantly, in agreement with previous studies (Mackewicz et al., 1995Down ), culturing the CD4+ cells with CD8+ cells sharply reduced the level of tat and gag mRNA within 3 h of initiating the coculture (Fig. 3Down). The expression of tat was typically reduced 7- to 30-fold during the course of infection and gag mRNA expression was generally reduced 1–2 logs. The level of GAPDH mRNA as well as IL-2R{alpha} mRNA in treated and untreated CD4+ cells was similar, not varying more than 20% at most time-points (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Kinetics of HIV tat and gag mRNA expression in acutely infected CD4+ T cells. PHA-stimulated CD4+ T cells from an HIV-seronegative subject were inoculated with HIV-1SF2. After 1 h the cells were trypsinized, washed and cultured alone (solid symbols) or with an equal number of antiviral CD8+ cells (open symbols). At the indicated time-points after the inoculation period, RNA was extracted from the cells and analysed by quantitative RT–PCR for the level of HIV tat (circles) and gag (squares) mRNA expression as described in the text. The results are representative of two separate experiments.

 
The results of this study indicate that the in vitro noncytotoxic antiviral activity of CD8+ cells from HIV-infected individuals does not affect the post-binding HIV replicative processes leading to the integration of proviral DNA (Figs 1Up and 2Up). These events would include virus uncoating, reverse transcription, the formation and transport of the preintegration complex to the nucleus, and integration into the host genome. It is possible that in these experiments the virus-inoculated CD4+ cells were not cultured early enough with the CD8+ cells to allow for a detectable effect on early reverse transcription (i.e. LTR-U3/R, the earliest replication event we measured), and events prior to this step. However, previous studies in our laboratory have indicated that culturing PBMC from HIV-infected individuals for 3 days prior to acutely infecting with them with HIV results in the same amount of intracellular gag DNA as in acutely infected PBMC from HIV-seronegative donors whose CD8+ cells lack antiviral activity (Barker et al., 1996Down ). The PBMC from the HIV-infected individuals yielded little or no virus particles, while the PBMC from the HIV-seronegative donors produced high levels of HIV virions. Thus, preculturing CD4+ cells in the presence of antiviral CD8+ cells before infection does not appear to affect any virus replication steps prior to reverse transcription.

This CD8+ cell antiviral response does, however, interrupt the virus replicative cycle soon after HIV provirus becomes integrated. Expression of both early and late HIV RNA messages is suppressed, as indicated by the marked reduction in multiply spliced tat transcripts and full-length unspliced gag transcripts in infected CD4+ T cells upon coculturing with the CD8+ T cells (Fig. 3Up). It is important to note that this reduction in viral RNA could be seen as early as 3 h post-infection. This finding indicates that the antiviral effect occurs early within the first phases of virus replication before viral antigens would be expressed. It suggests that antigen-specific recognition is not involved in the effector phase of this antiviral activity, and perhaps reflects the activity of an antigen (or mitogen)-induced antiviral factor(s) (Levy et al., 1996Down ).

The lack of any effect on the expression of GAPDH and IL-2 receptor mRNA suggests that this CD8+ cell antiviral activity probably does not reflect a global suppressive effect on transcription in the CD4+ cells, but may be specific to the regulation of the transcription of HIV, and possibly other retroviruses (Copeland et al., 1995Down ). These results confirm, in a more quantitative manner, those previously reported using Northern blot analysis (Mackewicz et al., 1995Down ).

How the antiviral CD8+ cells specifically inhibit HIV RNA expression remains to be determined. There is evidence that CD8+ cell antiviral factor(s) can suppress tat-mediated transcription and may do so by interfering with NF-{kappa}B (Chen et al., 1993Down ; Copeland et al., 1995Down ; Sato et al., 1996Down ). Alternatively, suppression of HIV RNA expression may reflect an effect on viral RNA stability, as has been seen with the antiviral effects of IL-10 (Kasama et al., 1994Down ). The elucidation of this regulatory mechanism could potentially lead to a therapeutic treatment targeted at HIV transcription.


   Acknowledgments
 
This work was supported by grant number RO1-AI-30350 and the Women’s Interagency HIV Study (WIHS) grant number 5UO1-AI34994, both from the National Institutes of Health. We thank Dan Mourich for helpful discussions, and Ann Murai and Christine Beglinger for preparation of the manuscript.


   References
TOP
Abstract
Main text
References
 
Barker, E., Bossart, K. N., Locher, C. P., Patterson, B. K. & Levy, J. A. (1996). CD8+ cells from asymptomatic human immunodeficiency virus-infected individuals suppress superinfection of their peripheral blood mononuclear cells.Journal of General Virology 77, 2953-2962.[Abstract/Free Full Text]

Chen, C. H., Weinhold, K. J., Bartlett, J. A., Bolognesi, D. P. & Greenberg, M. L. (1993). CD8+ T lymphocyte-mediated inhibition of HIV-1 long terminal repeat transcription: a novel antiviral mechanism.AIDS Research and Human Retroviruses 9, 1079-1086.[Medline]

Chun, T.-W., Carruth, L., Finzi, D., Shen, X., DiGiuseppe, J. A., Taylor, H., Hermankova, M., Chadwick, K., Margolick, J., Quinn, T. C., Kuo, Y. H., Brookmeyer, R., Zeiger, M. A., Barditch-Crovo, P. & Siliciano, R. F. (1997). Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection.Nature 387, 183-187.[Medline]

Copeland, K. F. T., McKay, P. J. & Rosenthal, K. L. (1995). Suppression of activation of the human immunodeficiency virus long terminal repeat by CD8+ T cells is not lentivirus specific.AIDS Research and Human Retroviruses 11, 1321-1326.[Medline]

Higashikubo, R., Wright, W. D. & Roti, J. L. (1990). Flow cytometric methods for studying isolated nuclei. In Flow Cytometry. Edited by Z. Darzynkiewcz & H. Crissman. New York: Academic Press.

Kasama, T., Strieter, R. M., Lukacs, N. W., Burdick, M. D. & Kunkel, S. L. (1994). Regulation of neutrophil-derived chemokine expression by IL-10.Journal of Immunology 152, 3559-3569.[Abstract]

Levy, J. A., Mackewicz, C. E. & Barker, E. (1996). Controlling HIV pathogenesis: the role of noncytotoxic anti-HIV activity of CD8+ cells.Immunology Today 17, 217-224.[Medline]

Mackewicz, C. & Levy, J. A. (1992). CD8+ cell anti-HIV activity: nonlytic suppression of virus replication.AIDS Research and Human Retroviruses 8, 1039-1050.[Medline]

Mackewicz, C. E., Ortega, H. & Levy, J. A. (1994). Effect of cytokines on HIV replication in CD4+ lymphocytes: lack of identity with the CD8+ cell antiviral factor.Cellular Immunology 153, 329-343.[Medline]

Mackewicz, C. E., Blackbourn, D. J. & Levy, J. A. (1995). CD8+ cells suppress human immunodeficiency virus replication by inhibiting viral transcription.Proceedings of the National Academy of Sciences, USA 92, 2308-2312.[Abstract/Free Full Text]

Patterson, B. K., Till, M., Otto, P., Goolsby, C., Furtado, M. R., McBride, L. J. & Wolinsky, S. M. (1993). Detection of HIV-1 DNA and messenger RNA in individual cells by PCR-driven in situ hybridization and flow cytometry.Science 260, 976-979.[Abstract/Free Full Text]

Patterson, B. K., Jiyamapa, D., Mayrand, E., Hoff, B., Abramson, R. & Garcia, P. M. (1996). Detection of HIV-1 DNA in cells and tissue by fluorescent in situ 5'-nuclease assay (FISNA).Nucleic Acids Research 24, 3656-3658.[Abstract/Free Full Text]

Patterson, B. K., Landay, A., Andersson, J., Brown, C., Behbahani, H., Jiyamapa, D., Burki, Z., Stanislawski, D., Czerniewski, M. A. & Garcia, P. (1998). Repertoire of chemokine receptor expression in the female genital tract: implications for human immunodeficiency virus transmission.American Journal of Pathology 153, 481-490.[Abstract/Free Full Text]

Patterson, B. K., Czerniewski, M., Andersson, J., Sullivan, Y., Su, F., Jiyamapa, D., Burki, Z. & Landay, A. (1999). Regulation of CCR5 and CXCR4 expression by type 1 and type 2 cytokines: CCR5 expression is downregulated by IL-10 in CD4-positive lymphocytes.Clinical Immunology 91, 254-262.[Medline]

Sanchez-Pescador, R., Power, M. D., Barr, P. J., Steimer, K. S., Stempien, M. M., Brown-Shimer, S. L., Gee, W. W., Renard, A., Randolph, A., Levy, J. A., Dina, D. & Luciw, P. A. (1985). Nucleotide sequence and expression of an AIDS-associated retrovirus (ARV-2).Science 227, 484-492.[Abstract/Free Full Text]

Sato, A., Mackewicz, C. E., Gaynor, R. H. & Levy, J. A. (1996). CD8+ T cell culture fluids from HIV infected individuals suppress HIV-1 long terminal repeat (LTR) driven transcription. In XI International AIDS Conference, p. 211. Vancouver, BC, Canada.

Tang, S., Patterson, B. & Levy, J. A. (1995). Highly purified quiescent human peripheral blood CD4+ T cells are infectible by human immunodeficiency virus but do not release virus after activation.Journal of Virology 69, 5659-5665.[Abstract]

Walker, C. M., Moody, D. J., Stites, D. P. & Levy, J. A. (1986). CD8+ lymphocytes can control HIV infection in vitro by suppressing virus replication.Science 234, 1563-1566.[Abstract/Free Full Text]

Received 15 December 1999; accepted 3 February 2000.


This article has been cited by other articles:


Home page
ADRHome page
P.L. Fidel Jr.
Candida-Host Interactions in HIV Disease: Relationships in Oropharyngeal Candidiasis
Advances in Dental Research, April 1, 2006; 19(1): 80 - 84.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. S. Diaz, H. Foster, M. R. Stone, S. Fujimura, D. A. Relman, and J. A. Levy
VCAM-1 Expression on CD8+ Cells Correlates with Enhanced Anti-HIV Suppressing Activity
J. Immunol., February 1, 2005; 174(3): 1574 - 1579.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Geiben-Lynn, M. Kursar, N. V. Brown, M. M. Addo, H. Shau, J. Lieberman, A. D. Luster, and B. D. Walker
HIV-1 Antiviral Activity of Recombinant Natural Killer Cell Enhancing Factors, NKEF-A and NKEF-B, Members of the Peroxiredoxin Family
J. Biol. Chem., January 10, 2003; 278(3): 1569 - 1574.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Geiben-Lynn, N. Brown, B. D. Walker, and A. D. Luster
Purification of a Modified Form of Bovine Antithrombin III as an HIV-1 CD8+ T-cell Antiviral Factor
J. Biol. Chem., October 25, 2002; 277(44): 42352 - 42357.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Geiben-Lynn, M. Kursar, N. V. Brown, E. L. Kerr, A. D. Luster, and B. D. Walker
Noncytolytic Inhibition of X4 Virus by Bulk CD8+ Cells from Human Immunodeficiency Virus Type 1 (HIV-1)-Infected Persons and HIV-1-Specific Cytotoxic T Lymphocytes Is Not Mediated by {beta}-Chemokines
J. Virol., September 1, 2001; 75(17): 8306 - 8316.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mackewicz, C. E.
Right arrow Articles by Levy, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mackewicz, C. E.
Right arrow Articles by Levy, J. A.
Agricola
Right arrow Articles by Mackewicz, C. E.
Right arrow Articles by Levy, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS