J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santti, J.
Right arrow Articles by Hyypiä, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santti, J.
Right arrow Articles by Hyypiä, T.
Agricola
Right arrow Articles by Santti, J.
Right arrow Articles by Hyypiä, T.
Journal of General Virology (2000), 81, 1361-1372.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Molecular epidemiology and evolution of coxsackievirus A9

Juhana Santti1, Heli Harvala1, Leena Kinnunen2 and Timo Hyypiä1,3

MediCity Research Laboratory and Department of Virology, University of Turku, Kiinamyllynkatu 13, FIN-20520 Turku, Finland1
Department of Epidemiology and Health Promotion, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland2
Haartman Institute, Department of Virology, PO Box 21, FIN-00014 University of Helsinki, Helsinki, Finland3

Author for correspondence: Juhana Santti. Fax +358 2 2513303. e-mail juhana.santti{at}utu.fi


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Genetic relationships between 35 clinical isolates of coxsackievirus A9 (CAV9), collected during the last five decades from different geographical regions, were investigated by partial sequencing. Analysis of a 150 nucleotide sequence at the VP1/2A junction region identified 12 CAV9 genotypes. While most of the strains within each genotype showed geographical clustering, the analysis also provided evidence for long-range importation of virus strains. Phylogenetic analysis of a longer region around the VP1/2A junction (approximately 390 nucleotides) revealed that the designated genotypes actually represented phylogenetic lineages. The phylogenetic grouping pattern of the isolates in the analysis of the VP4/VP2 region was similar to that obtained in the VP1/2A region whereas analysis of the 3D region indicated a strikingly different grouping, which suggests that recombination events may occur in the region encoding the nonstructural proteins. Analysis of the deduced amino acid sequences of the VP1 polypeptide demonstrated that the RGD (arginine-glycine-aspartic acid) motif, implicated in the interaction of the virus with integrin, was fully conserved among the isolates.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human enteroviruses, small RNA viruses in the family Picornaviridae, are conventionally subgrouped into polioviruses (PVs; 3 serotypes), coxsackie A viruses (CAVs; 23 serotypes), coxsackie B viruses (CBVs; 6 serotypes), echoviruses (EVs; 28 serotypes) and enteroviruses 68–71, mainly on the basis of their pathogenicity in experimental animals. Division of coxsackieviruses, which are associated with a wide range of human diseases such as meningitis, encephalitis, paralysis, myocarditis, pleurodynia, exanthemas and respiratory illnesses, into A and B subgroups depends on the disease signs and histopathological lesions that occur after inoculation into newborn mice. A proposed new species classification of human enteroviruses is based on genetic relationships between the virus strains (Hyypiä et al., 1997Down ; King et al., 1999Down ). According to sequence homology in the coding and the 3' noncoding region (NCR) of the approximately 7·5 kb ssRNA genome, enteroviruses can be divided into four clusters, A–D (Pöyry et al., 1994Down , 1996Down ; Hyypiä et al., 1997Down ); CAV16 and enterovirus 71 belong to cluster A, CAV9, CBVs and all sequenced EVs form cluster B, CAV21, CAV24 and PVs are found in cluster C while enterovirus 70 represents cluster D. In the 5'NCR, only two molecular groups are observed; group I includes cluster C and D viruses and group II cluster A and B viruses. Findings based on partial sequencing of different genomic regions have demonstrated that all enteroviruses can be similarly classified (Pulli et al., 1995Down ; Huttunen et al., 1996Down ; Oberste et al., 1998Down , 1999Down ).

Enteroviruses, like other RNA viruses, have a high mutation rate due to the lack of proofreading activity during genome replication. It has been estimated that approximately one mutation is generated per newly synthesized genome (Drake et al., 1993Down ). In addition to mutations, recombination is involved in enterovirus evolution. Homologous recombination, which is considered to take place by copy choice (strand switching) (Kirkegaard & Baltimore, 1986Down ), has been demonstrated between PVs of vaccine- and wild-type origin (Cammack et al., 1988Down ; Furione et al., 1993Down ). Recent phylogenetic analysis of complete enterovirus genomes provided evidence suggesting that recombination also occurs between other enteroviruses, and that intraspecies recombination is a relatively frequent event in the evolution of enterovirus genomes (Santti et al., 1999Down ).

The high mutation rate of enteroviruses enables detailed molecular epidemiological studies based on comparison of relatively short regions of the genome. A 150 nucleotide (nt) sequence at the junction of the capsid and nonstructural proteins (90 nt encoding the VP1 capsid protein and 60 nt encoding the 2A protease) has been extensively used in molecular epidemiological studies of PVs, resulting in a large sequence database (Rico-Hesse et al., 1987Down ; Zheng et al., 1993Down ; Huovilainen et al., 1995Down ; Kew et al., 1995Down ; Mulders et al., 1995Down ; Chezzi et al., 1997Down ; Morvan et al., 1997Down ; Fiore et al., 1998Down ). The term ‘genotype’, which is defined as a cluster of genetically related viruses with less than 15% nucleotide divergence across the 150 nt sequence, has been used for discrimination of genetic lineages of PVs, whereas less than 2% nucleotide divergence between strains has been considered to indicate direct epidemiological linkage (Rico-Hesse et al., 1987Down ). It has been demonstrated that within each PV serotype the independent genotypes usually show a distinct geographical distribution, but that occasionally long-distance importation of PV strains occurs. In addition to PVs, the molecular epidemiology of CAV24 variant and enterovirus 70, pathogens which have caused large outbreaks of acute haemorrhagic conjunctivitis, has been studied by partial sequencing (Ishiko et al., 1992Down ; Takeda et al., 1994Down ). Furthermore, regression analysis of genetic distances between isolates has enabled estimation of the time of emergence of these viruses. Partial genomic sequencing has also been applied to the molecular epidemiological analysis of CBV1 (Zoll et al., 1994Down ), CBV4 (Hughes et al., 1993Down ), CBV5 (Kopecka et al., 1995Down ) and enterovirus 71 (Brown et al., 1999Down ), as well as EV30 (Gjøen et al., 1996Down ) which is characteristically involved in epidemics of meningitis.

Analysis of the CAV9 prototype strain (Griggs) revealed that, despite its CAV-like pathogenicity in newborn mice, it is genetically more closely related to CBVs than to other CAVs (Chang et al., 1989Down ; Pulli et al., 1995Down ). However, when compared to CBVs, the CAV9 genome has an apparent insertion of approximately 15 amino acids at the C terminus of the VP1 capsid protein. This insertion contains an RGD (arginine-glycine-aspartic acid) tripeptide, which is known to be the cell attachment motif of a number of adhesive extracellular matrix, blood and cell surface proteins, and is recognized by several integrins (Ruoslahti & Pierschbacher, 1987Down ; Ruoslahti, 1996Down ). In further studies it was demonstrated that the RGD motif, which was found to be fully conserved among five clinical CAV9 strains isolated in the UK over a period of 25 years (Chang et al., 1992Down ), mediates CAV9 attachment to {alpha}v{beta}3 integrin (Roivainen et al., 1991Down , 1994Down ). However, studies on trypsin-treated virus and virus mutants, which lack the RGD motif, indicated that the virus is able to use an RGD-independent pathway in cell entry (Roivainen et al., 1991Down ; Hughes et al., 1995Down ). The C-terminal region of the VP1 capsid protein was also shown to be antigenic by using a peptide-scanning technique, but it was found that the RGD motif itself was poorly immunogenic whereas antibody-binding sites were located at both sites of the motif (Pulli et al., 1998aDown , bDown ).

In this study, 35 clinical isolates of CAV9, collected from different geographical regions during the last five decades, were subjected to molecular analysis. To explore phylogenetic relationships between the isolates in various genomic regions and to analyse variation, in particular at the C terminus of the VP1 protein, three regions, one covering the hypervariable part of the 5'NCR, VP4 gene and part of the VP2 capsid protein-coding region, another covering the junction region of the VP1 capsid protein and 2A protease genes, and the third encoding part of the 3D polymerase, were selected for RT–PCR amplification and direct sequencing.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Viruses.
Thirty-five clinical isolates of CAV9 (Table 1Down) were obtained from the specimen collections of the Departments of Virology at the Universities of Turku and Helsinki (Finland), from the Centers for Disease Control and Prevention (CDC, Atlanta, USA; provided by Steven Oberste and Mark Pallansch), and from the National Institute of Public Health and the Environment (RIVM, The Netherlands; provided by Harrie van der Avoort). Specimens obtained from CDC and RIVM were passaged once in RD (human rhabdomyosarcoma) cells before further analysis. Passage history of the Finnish isolates included one to four rounds in various cell lines. Prior to molecular analysis, all 35 isolates were typed by a microneutralization test using CAV9 type-specific antiserum obtained from the ATCC.


View this table:
[in this window]
[in a new window]
 
Table 1. CAV9 isolates used in the analysis

 
{blacksquare} RNA extraction, RT–PCR and sequencing.
RNA was isolated from 100 µl of specimen using the Ultraspec method (Cinna/Biotecx Laboratories Inc.) with a slightly modified protocol of the manufacturer’s instructions (Santti et al., 1997Down ). cDNA was generated in a 40 µl reaction volume for 1 h at 37 °C using the specific antisense primer (see below) and M-MLV RT (Promega) according to the instructions provided. Ten µl from the cDNA reaction was added to the PCR reaction mixture, which had a total volume of 100 µl and contained 10 mM Tris–HCl (pH 8·8), 50 mM KCl, 1·5 mM MgCl2, 0·1% Triton X-100, 0·2 mM dNTPs, 50 pmol upstream and downstream primers and 1 U of Dynazyme thermostable DNA polymerase (Finnzymes). The reactions were run in a Perkin-Elmer Cetus thermal cycler. The cycle profile included 40 cycles of 2 min denaturation at 94 °C, 2 min annealing at 55 °C and 4 min elongation at 72 °C.

A 652 bp amplicon representing the 5'NCR, VP4 and VP2 capsid protein-coding regions (nt 547–1198; numbering according to the CAV9 Griggs strain; Chang et al., 1989Down ) was obtained using primers 4+ (sense; 5' TACTTTGGGTGTCCGTGTTTC) and 5-n (antisense; 5' GGBAAYTTCCACCACCANCC). The VP1/2A junction region of the genomes was amplified using primers VP1+ (sense; 5' ACCAGAGCTTGGGTGCCGCG) and 2A- (antisense; 5' ACAACACCTTCNCCNCCCAT), which produce a 560 bp amplicon (nt 3180–3739). Two specimens (Net/1/64 and Net/1/79) that did not react with these primers were amplified using primers VP1+n (sense; 5' AACCCCAGCRTNTTYTGGAC) and 2A-n (antisense; 5' GTCTCTRTTRTAATCYTCCCA), which give rise to a 516 bp PCR product (nt 2946–3461). Primers 3D+ (sense; 5' TTTGAYTACWCWGGNTATGATGC) and 3D- (antisense; 5' WGSRTTCTTKGTCCATC) were used to amplify nt 6654–7184 (531 bp), which encode part of the 3D polymerase. The amplicons were purified using the Qiaex II Gel Extraction Kit (Qiagen) and sequenced with fluorescent dye-labelled terminators using an automated DNA Sequencer (Applied Biosystems) according to the manufacturer’s instructions. Primers 5-n, VP1+, VP1+n and 3D+ were used in the sequencing reactions. A schematic representation of the amplification and sequencing strategy is shown in Fig. 1Down.



View larger version (4K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of the amplification and sequencing strategy used for the studied CAV9 isolates. Genome organization is shown on the top (according to Chang et al., 1989Down ). Attachment sites and codes of the oligonucleotide primers are shown below the genome as short arrows; black rectangles indicate the resulting amplicons. The numbers refer to the sizes of the amplicons. Primers used for sequencing are represented as longer arrows. In the amplification of the VP1/2A junction region, PCR products of the expected size were obtained from 33 out of the 35 isolates studied using primers VP1+ and 2A-. The two strains (Net/1/64 and Net/1/79) which failed to react with these primers were successfully amplified using primers VP1+n and 2A-n.

 
{blacksquare} Analysis of the sequence data.
Pairwise nucleotide identities were calculated using the program Gap in the GCG software package (Devereux et al., 1984Down ). Multiple sequence alignments as well as dendrograms for the 5'NCR and the 150 nt sequence at the junction region of the VP1 and 2A genes were generated using the PileUp program (GCG). Bootstrapped phylogenetic trees of 1000 replicates were constructed from the alignments by the neighbour-joining method of Saitou & Nei (1987)Down as implemented in the Clustal X program (Thompson et al., 1997Down ). Sequences reported in this paper have been deposited in GenBank under the following accession numbers: AF166172AF166253 and AF224645AF224661.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
RT–PCR and sequencing
A 500 nt long sequence covering the hypervariable part of the 5'NCR, the VP4 gene and part of the VP2 capsid protein-coding region (nt 655–1154 in CAV9 Griggs strain) was determined for all 35 CAV9 isolates (Fig. 1Up). Sequence of approximately 390 nt, representing the junction region of the VP1 capsid protein and the 2A protease genes (nt 3228–3618), was obtained from 33 of the 35 isolates. The two strains (Net/1/64 and Net/1/79) which failed to react with the first combination of primers (VP1+/2A-) were successfully amplified using alternative primers (VP1+n/2A-n), which resulted in a sequence of 213 nt (nt 3228–3440) that overlapped with those of the other isolates studied. A 441 nt sequence encoding part of the 3D polymerase (nt 6720–7160) was also determined from 29 isolates.

Genotypes found in the analysis of the VP1/2A junction region
PV genotypes have been defined as clusters of related strains with <15% nucleotide divergence in a 150 nt long sequence at the junction region between the VP1 capsid protein and the 2A protease genes (Rico-Hesse et al., 1987Down ). By comparing an analogous region of the CAV9 genome (nt 3258–3407), the studied isolates and the Griggs strain could be assigned to 12 genotypes, which were designated I–XII (Roman numerals) in the chronological order of the isolation of the earliest virus strain in each genotype (Fig. 2Down). The maximum nucleotide divergence between the isolates was 34%, which was seen between strains Net/1/67 and US-MD/1/88. The prototype Griggs strain, which was isolated in the early 1950s, was the only representative of genotype I. Genotype II included the earliest isolates from the Netherlands from 1959–1967, which share a minimum of 89% nucleotide identity, and, in addition, an isolate from Denmark from 1971, which exhibits on average 88% identity with the Dutch isolates. Strains Net/1/59 and Net/1/61 share 98% identity in this genomic region, which is indicative of a direct epidemiological linkage between the isolates. Genotype III was represented by one isolate (Net/1/64) which is distant from all the other strains analysed. An isolate from the Netherlands from 1971 forms genotype IV. It shows 84% nucleotide identity to a geographically and temporally distant isolate from Thailand from 1993 (genotype X).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Dendrogram illustrating sequence relationships among the studied CAV9 isolates and the prototype Griggs strain (Chang et al., 1989Down ) based on analysis of a 150 nt fragment at the VP1/2A junction region (nt 3258–3407; Griggs strain). Genotypes, defined as clusters of related sequences with less than 15% nucleotide divergence, are grouped within brackets and assigned roman numerals I–XII. Less than 2% nucleotide divergence is considered to indicate direct epidemiological linkage.

 
Genotypes V, VI and VIII are geographically the most widespread. Genotype V contains three closely related strains; one from the United States from 1978 and two from the Netherlands from 1973 and 1979, which share a minimum of 97% nucleotide identity. Genotype VI comprises isolates from the United States (1974–1988), Mexico (1975), Honduras (1977), the Netherlands (1979) and Canada (1986). The isolate from the Netherlands and an isolate from North Carolina, USA, from 1983 are the most closely related of these strains sharing 96% nucleotide identity. An isolate from The Netherlands from 1978 represents genotype VII. It shows on average 85% nucleotide identity with genotype V isolates, and could, in principle, also be assigned to this genotype. Genotype VIII contains one isolate from the Netherlands from 1981, one from Canada from 1985 and one from Finland from 1988 which share 87–91% nucleotide identity. Genotype IX contains two strains from Finland from 1983 which show approximately 3% nucleotide divergence (4 mutations/147 positions). These strains were isolated from two patients in a 3 day period.

The largest number of virus strains included in the study originated from Finland. Ten of the isolates, from 1993–1997, represent genotype XI. Strains isolated within each year share a minimum identity of 98% which, again, indicates direct epidemiological linkage. The only isolate from 1995 in this genotype is most closely related to the two isolates from 1993 sharing on average 97% nucleotide identity with these strains. Another isolate from Finland from 1995 represents genotype XII, which is distant from genotype XI but closer to the genotype VIII strains.

Phylogenetic analysis of the isolates
Phylogenetic grouping in the VP4/VP2 region.
To investigate the evolutionary relationships between the CAV9 isolates in the VP4/VP2-coding region, a neighbour-joining tree based on analysis of nt 744–1154 (Griggs strain) of the CAV9 strains together with 11 representatives of other cluster B enteroviruses was constructed (Fig. 3Down). The two strains of CBV3 and CBV4 as well as EV9 clustered together with high bootstrap values. A group consisting of all the CAV9 isolates was supported by a bootstrap value of 61% whereas a subgroup containing all the other CAV9 isolates except the Net/1/64 strain was slightly better supported (74%). In general, virus strains within the CAV9 group segregated similarly to that observed in the analysis of the 150 nt interval at the VP1/2A junction region (Fig. 2Up). Virus groups representing genotypes V, VI, IX and XI were supported by high bootstrap values. However, in the case of genotype II, only the relationship between the Dutch isolates was highly supported (100%; data not shown) whereas the whole group was supported in 63% of the bootstrap replicates. The bootstrap value for the group of strains representing genotype VIII was low (42%; data not shown); only clustering of strains Fin/1/88 and Net/1/81 was significantly supported. Of the remaining genotypes which were all represented by a single isolate, a monophyletic group consisting of genotype IV and X isolates was highly supported. In addition, statistically significant clustering was seen between genotypes I and VI. The maximum nucleotide divergence between the CAV9 isolates was 22%, which was observed between Net/1/64 and Can/1/85 as well as Net/1/67 and Fin/2/93.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Neighbour-joining trees constructed from nucleotide sequences encoding the junction region between the VP1 capsid protein and 2A protease (nt 3228–3618; numbering according to CAV9 Griggs strain; Chang et al., 1989Down ), the VP4 polypeptide and part of the VP2 capsid protein (nt 744–1154) and part of the 3D polymerase (nt 6720–7160) of the studied CAV9 isolates. The prototype CAV9 Griggs strain together with selected representatives of other cluster B enteroviruses were included in the analysis. Strains Net/1/64 and Net/1/79, for which only the sequence of the first 213 nt from the 5' end of the VP1/2A region was determined, were excluded from the analysis of this genomic region. No amplicon was obtained from strains Net/1/67, Net/1/78, Fin/1/83, Fin/2/83, Fin/2/93 and Fin/1/97 in the analysis of the 3D region. Bootstrap probabilities for the major clusters are indicated (only values exceeding 60% of the replicates are shown). Genotypes I–XII, defined by the analysis of a 150 nt sequence covering the VP1/2A junction region (Fig. 2Up), are indicated. The scale for the genetic distances is indicated. Previously published full-length sequences of CAV9 Griggs strain (D00627), CBV1 (M16560), CBV3 Nancy (CBV3N; M33854) and Woodruff (CBV3W; U57056) strains, CBV4 E2 (CBV4E; S76772) and JVB (CBV4J; X05690) strains, CBV5 (X67706), EV6 (U16283), EV9 Barty (EV9B; X92886) and Hill (EV9H; X84981) strains, EV11 (X80059) and EV12 (X79047) were used in the comparisons.

 
VP1/2A region.
A neighbour-joining tree was constructed from the nucleotide sequences encoding the VP1/2A junction region (nt 3228–3618 in the Griggs strain) of the CAV9 strains and other cluster B viruses (Fig. 3Up). The bootstrap analysis revealed that all the CAV9 strains belong to a monophyletic group. The relationship between the two CBV3 strains was also statistically significant whereas the bootstrap values for the groups containing the two CBV4 as well as the two EV9 strains were relatively low (54 and 47%, respectively; data not shown). Analysis of the CAV9 strains revealed a grouping pattern similar to that obtained in the analysis of the 150 nt sequence from the same region (Fig. 2Up) as well as that obtained in the analysis of the VP4/VP2 region (Fig. 3Up). Virus genotypes V, IX and XI were supported by high bootstrap values. In contrast to the results obtained in the analysis of the VP4/VP2 region, the bootstrap value for the virus strains constituting genotype VI was relatively low (59%; data not shown) whereas a larger group containing genotype I and VI viruses was highly supported. Also differently from the VP4/VP2 region, viruses representing genotype VIII formed a monophyletic group that was highly supported by the bootstrap analysis. Furthermore, the relationship between the genotype II strains was also highly supported whereas the relationship between genotype IV and X viruses was not statistically significant (38%; data not shown). Viruses constituting genotypes VIII and XII clustered together showing a high bootstrap value which was consistent with the results obtained in the analysis of the shorter (150 nt) fragment. The maximum nucleotide divergence between the CAV9 isolates in this genomic region was 27%, which was seen between strains Net/1/67 and US-CO/1/74.

3D region.
To examine the evolutionary relationships of the CAV9 isolates at the 3'-terminal part of the genome, sequence encoding part of the 3D polymerase (nt 6720–7160 in Griggs strain) was determined from 29 isolates which represented 10 of the 12 genotypes recognized in the analysis of the VP1/2A region. Phylogenetic analysis of the CAV9 strains together with other representatives of cluster B viruses revealed a strikingly different grouping pattern compared to that obtained in the analysis of the other coding regions (Fig. 3Up). The CAV9 isolates did not cluster together, but they were instead interspersed among the other strains studied. In addition, none of the five genotypes, which were represented by more than one strain, formed monophyletic groups. In contrast, some groups, which contained both CAV9 isolates as well as other members of the enterovirus genus, were highly supported. The analysis also detected the close relationship between the Griggs prototype strain, CBV1, CBV3W and EV9H, that has been reported previously (Santti et al., 1999Down ). The maximum nucleotide divergence between the CAV9 isolates in this genome region was 23% which was seen between strains Net/1/71 and US-MS/1/78.

Amino acid sequence diversity among the isolates
The deduced amino acid sequences of the VP4/VP2, VP1/2A and 3D regions of the studied CAV9 sequences were aligned with the prototype Griggs strain together with eight representatives of other cluster B viruses as well as three antigenic variants (VP1/2A alignment is shown in Fig. 4Down). The VP4/VP2 amino acid sequences were highly conserved among these virus strains. Most of the amino acid differences in the VP4 capsid protein, which in picornaviruses is positioned internally in the virion, were concentrated on a relatively short region of the polypeptide between codons 16–24. Variation in the N terminus of the VP2 capsid protein was limited to 19 of the 68 sites.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4. Alignment of amino acid sequences of the junction region between the VP1 capsid protein and 2A protease of the studied CAV9 isolates. Corresponding regions of CAV9 Griggs strain and 11 other members of species B enteroviruses were also included in the alignment. Dots represent amino acid residues identical to those of the CAV9 Griggs sequence while dashes indicate gaps. Genotypes I–XII, which were defined by the analysis of a 150 nt fragment at the VP1/2A junction region (Fig. 2Up), are indicated on the left. The vertical bar represents the putative cleavage site between individual viral proteins. The highly conserved RGD tripeptide at the C-terminal part of the VP1 capsid protein as well as the conserved histidine and aspartate residues of the 2A protease found near or at the active site of the molecule are shaded.

 
Analysis of the VP1 capsid protein sequences revealed that, when compared to CBV3N, all the studied CAV9 isolates had an extension of 14 or 15 amino acids to the C terminus of the polypeptide (Fig. 4Up). The RGD (arginine-glycine-aspartic acid) tripeptide was fully conserved among the isolates whereas residues surrounding the motif were highly variable. Only glutamine at position -4 (RGD is positions 1–3) and threonine at position +9 were invariant. Moreover, serine at position -3 was almost invariant; only strain Net/1/64 had an alanine substitution at this site. Genotype VI isolates had a leucine to phenylalanine substitution at position +7. Different substitutions were most frequently seen at positions -5, -2, +5 and +6. Four differences were seen at position -5 and, in addition, 18 of the isolates had an apparent deletion at this site. Six different amino acids were seen at position -2, five at position +5 and eight at position +6. The RGD tripeptide was preceded by either a methionine or a leucine. Residues preceding the extension were more conserved among the CAV9 isolates whereas other members of cluster B enteroviruses differed clearly from the CAV9 strains in this region (Fig. 4Up).

Substitutions in the 2A region were relatively evenly distributed (Fig. 4Up). Histidine at position 21 and aspartate at position 39, which together with a cysteine residue form the catalytic triad of the entero- and rhinovirus 2A proteases (Bazan & Fletterick, 1988Down ; Yu & Lloyd, 1991Down ), were fully conserved. Little variation was seen in the 3D polymerase (data not shown). The YGDD sequence, which has been hypothesized to be at or near the catalytic site of the molecule (Kamer & Argos, 1984Down ; Jablonski et al., 1991Down ), was fully conserved among the isolates.

Analysis of the hypervariable region
The hypervariable region, covering approximately 100 nt preceding the polyprotein initiation codon, is the most variable part of the enterovirus genome (Toyoda et al., 1984Down ; Rivera et al., 1988Down ). For example, the nucleotide sequences of the three PV Sabin strains differ from each other by about 50% in this region (Toyoda et al., 1984Down ). It has been suggested that this segment serves as a spacer region between the internal ribosome entry site and the polyprotein initiation codon; the ribosome scans through this region for the initiation site. The lack of stable secondary structures and initiation codons in this region are consistent with this hypothesis (Rivera et al., 1988Down ).

A dendrogram illustrating the relationships of the CAV9 strains in the hypervariable region (corresponds to nt 655–743 of the Griggs strain) is shown in Fig. 5Down. The virus grouping was highly similar to that observed in the analysis of the 150 nt sequence at the VP1/2A junction region. The maximum nucleotide divergence between the isolates was 51%, which was seen between strains Net/1/67 and US-NC/1/83 as well as Net/1/67 and Hon/1/77. Despite the high overall diversity, strains within each VP1/2A region genotype shared >85% nucleotide identity. The strain Den/1/71 was an exception as it showed only 58% nucleotide identity to other genotype II isolates. In addition, strain Net/1/78 was slightly more distant from genotype V strains in this region (75% identity) than in the VP1/2A region (85% identity) whereas genotype VIII and XII viruses shared 85% nucleotide identity in this region.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. Dendrogram showing genetic relationships among the studied CAV9 isolates and the prototype Griggs strain based on analysis of the hypervariable part of the 5'NCR (nt 655–743; Griggs strain). Genotypes I–XII, defined as clusters of strains sharing >85% nucleotide identity across a 150 nt fragment at the VP1/2A junction region (Fig. 2Up), are indicated. Genotypes that show different grouping compared to the analysis of the VP1/2A region are indicated by asterisks.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Molecular techniques have been extensively used to study the epidemiology of polioviruses and the results obtained have had a significant impact on the worldwide efforts to eradicate poliomyelitis (for review, see e.g. Kew et al., 1995Down ). Much less is known about the molecular epidemiology of other enteroviruses. The aim of the present study was to characterize the epidemiology and evolution of coxsackievirus A9, which is one of the most frequently isolated enterovirus serotypes in clinical diseases (Strikas et al., 1986Down ; Hovi et al., 1996Down ). CAV9 strains isolated during the last five decades from different parts of the world were studied by partial genomic sequencing.

Phylogenetic analysis of the CAV9 isolates together with 11 representatives of other cluster B enteroviruses revealed that the CAV9 strains formed a monophyletic group in the VP4/VP2 and VP1/2A regions but not in the 3D region. In the VP1/2A region, the CAV9 group was supported by a bootstrap value of 88% while in the VP4/VP2 region the group was found in 61% of the 1000 bootstrap replicates. These findings are consistent with previous observations that the serotype specificity is reflected in the capsid protein-coding sequence but not necessarily in other parts of the genome (Zoll et al., 1994Down ; Kopecka et al., 1995Down ; Santti et al., 1999Down ). Furthermore, these results correlate well with the findings of Oberste et al. (1998Down , 1999Down ), which indicate that the VP1 sequence represents the serotype identity better than the sequence of the VP4/VP2 junction region does.

The CAV9 isolates could be divided into 12 genotypes using the criteria designated for PVs (Rico-Hesse et al., 1987Down ) that strains sharing >85% identity in a 150 nt sequence at the VP1/2A junction region belong to the same genotype (Table 2Down). While most of the strains within each genotype showed geographical clustering, the analysis also showed evidence of long-distance importation of virus strains. In fact, three out of the six genotypes which were represented by more than one strain contained isolates both from Europe and the Americas. This finding suggests that individual CAV9 genotypes are frequently found over a wide geographical region, although more precise evaluation of geographical distribution of CAV9 genotypes cannot be made from this relatively limited data. For example, it cannot be concluded that genotype XI was geographically restricted to Finland since the study material did not contain any isolates from this time from any other country. It is also difficult to estimate the number of CAV9 genotypes which co-circulate at a given time. However, at least four genotypes were present in the Netherlands from 1978 to 1981. Appearance of several co-circulating genotypes is a typical phenomenon, at least for PVs in endemic countries with low vaccine coverage (Huovilainen et al., 1995Down ), but probably also occurs in other enteroviruses. Reliable estimation of the evolutionary rate of enterovirus genomes is usually complicated by the existence of multiple co-circulating lineages. In rare cases, when the founder virus has been identified, such calculations have, however, been possible. The VP1/2A sequence of PV type 1 introduced into the Andean region of South America in 1980 was estimated to have evolved at a nearly constant rate of 9x10-3 nt substitutions/site/year (Kew et al., 1995Down ). Accordingly, the maximum time for the existence of a given genotype has been evaluated to be approximately 17 years. Interestingly, all CAV9 genotypes found in the present study followed this rule.


View this table:
[in this window]
[in a new window]
 
Table 2. Geographical distribution of CAV9 genotypes

 
Phylogenetic analysis of a longer region (approximately 390 nt) around the VP1/2A junction revealed that the designated genotypes actually represented phylogenetic lineages. The phylogenetic grouping pattern of the CAV9 strains observed in the analysis of the VP4/VP2 region was highly similar to that obtained in the analysis of the VP1/2A region. Differences, which could potentially be due to a recombinant origin of some of the virus strains, were mainly observed in the phylogenetic relatedness of individual genotypes. For example, genotypes VIII and XII were monophyletic in the VP1/2A region but not in the VP4/VP2 region. Similarly, the relationship between genotypes IV and X was highly supported by bootstrap analysis in the VP4/VP2 (100%) region but not in the VP1/2A (38%) region. In the hypervariable region, which precedes the VP4 gene, genotypes VIII and XII clustered together whereas genotypes IV and X did not, which suggests that, if the observed differences were due to recombination, one of the recombination breakpoints could in both cases have been situated near or at the initiation codon. Recombination could also explain the relationship between strain Den/1/71 and other members of genotype II, which in the VP1/2A region form a monophyletic group with a bootstrap value of 99% but in VP4/VP2 the value decreases to 63%, apparently due to the divergence of Den/1/71 from the other strains. Finally, in the hypervariable region Den/1/71 is clearly separated from the other strains of genotype II. The finding of several co-circulating CAV9 genotypes also provides indirect evidence for the possibilities of recombination events.

The different phylogenetic grouping of the CAV9 isolates in the 3D region compared to other genomic regions could most easily be explained by the occurrence of multiple recombination events between members of cluster B. This is supported by a recent analysis of 17 complete enterovirus genomes belonging to cluster B which detected several regions of higher than average sequence homology between individual virus strains, suggesting that intraspecies recombination occurs relatively frequently in the evolution of enterovirus genomes (Santti et al., 1999Down ). This analysis also suggested that most of the putative recombination breakpoints between different serotypes were located at the region encoding the nonstructural proteins. It needs to be kept in mind, however, that the number of completely sequenced enterovirus genomes is still limited and restricted mainly to prototype strains isolated decades ago. More extensive analysis of different isolates may reveal currently undiscovered genetic relationships between and within the genetic clusters.

Previous studies have indicated that the RGD motif found within the C-terminal extension of the VP1 capsid protein of CAV9 (Chang et al., 1989Down ) is functionally significant and plays a role in early virus–cell interactions, because RGD-containing oligopeptides block CAV9 infectivity (Roivainen et al., 1991Down ). Moreover, it has been demonstrated that the RGD motif mediates CAV9 attachment to {alpha}v{beta}3 integrin in GMK cells (Roivainen et al., 1994Down ). Sequence analysis of five temporally highly distinct CAV9 clinical isolates from the UK demonstrated that the motif was fully conserved (Chang et al., 1992Down ). The analysis also identified similarity of the VP1 extension of CAV9 to part of the precursor of human transforming growth factor {beta}1, suggesting that the virus might have acquired this additional sequence by heterologous recombination with cellular sequences.

Previous investigations have also shown that infectivity of CAV9 is not completely abolished by removal of the RGD motif by trypsin (Roivainen et al., 1991Down ) or by mutagenesis (Hughes et al., 1995Down ), which indicates that the virus is able to use an RGD-independent pathway in its entry into the host cell. In the present study, the RGD triplet was found to be fully conserved among 35 CAV9 clinical isolates which suggests that the motif, although not essential for virus viability in cell culture conditions, plays a vital role in replication of the virus in humans. The amino acid residues surrounding the RGD triplet were highly variable among the isolates reflecting a high degree of structural flexibility. As already noted by Chang et al. (1992)Down , the situation resembles that seen in foot-and-mouth disease virus (FMDV), another integrin-binding picornavirus, in which the RGD motif is in a surface-accessible location and forms part of the major antigenic site of the virion (Acharya et al., 1989Down ; Fox et al., 1989Down ; Berinstein et al., 1995Down ). The RGD motif of FMDV has been shown to interact directly with some antiviral neutralizing antibodies (Verdaguer et al., 1995Down ) whereas analysis of CAV9 suggested that antibodies bind most strongly to amino acid residues surrounding the RGD motif while the motif itself is poorly immunogenic (Pulli et al., 1998aDown , bDown ).

In conclusion, the present analysis of the CAV9 isolates provides an overview of the molecular epidemiology and evolution of CAV9. While most strains within each genotype were found to cluster geographically, the analysis also detected long-distance importation of virus strains. Analysis of sequences derived from three different genomic regions demonstrated that the capsid protein but not the nonstructural protein-coding region correlates with the serotype. In addition, the invariant nature of the RGD sequence provides further evidence for its importance in the clinical pathogenesis of CAV9 infection.


   Acknowledgments
 
We thank Steven Oberste, Mark Pallansch and Harrie van der Avoort for providing clinical isolates and Alexander Plyusnin and Glyn Stanway for their comments during the preparation of the manuscript. The study was supported by grants from the Academy of Finland, the Turku University Foundation, the Finnish Cultural Foundation and the Finnish Foundation for Research on Viral Diseases.


   Footnotes
 
The GenBank accession numbers of the sequences reported in this paper are AF166172AF166253 and AF224645AF224661.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Acharya, R., Fry, E., Stuart, D., Fox, G., Rowlands, D. & Brown, F. (1989). The three-dimensional structure of foot-and-mouth disease virus at 2·9 resolution.Nature 337, 709-716.[Medline]

Bazan, J. F. & Fletterick, R. J. (1988). Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications.Proceedings of the National Academy of Sciences, USA 85, 7872-7876.[Abstract/Free Full Text]

Berinstein, A., Roivainen, M., Hovi, T., Mason, P. W. & Baxt, B. (1995). Antibodies to the vitronectin receptor (integrin {alpha}v{beta}3) inhibit binding and infection of foot-and-mouth disease virus to cultured cells.Journal of Virology 69, 2664-2666.[Abstract]

Brown, B. A., Oberste, M. S., Alexander, J. P.Jr, Kennett, M. L. & Pallansch, M. A. (1999). Molecular epidemiology and evolution of enterovirus 71 strains isolated from 1970 to 1998.Journal of Virology 73, 9969-9975.[Abstract/Free Full Text]

Cammack, N., Phillips, A., Dunn, G., Patel, V. & Minor, P. D. (1988). Intertypic genomic rearrangements of poliovirus strains in vaccinees.Virology 167, 507-514.[Medline]

Chang, K. H., Auvinen, P., Hyypiä, T. & Stanway, G. (1989). The nucleotide sequence of coxsackievirus A9; implications for receptor binding and enterovirus classification.Journal of General Virology 70, 3269-3280.[Abstract/Free Full Text]

Chang, K. H., Day, C., Walker, J., Hyypiä, T. & Stanway, G. (1992). The nucleotide sequences of wild-type coxsackievirus A9 strains imply that an RGD motif in VP1 is functionally significant.Journal of General Virology 73, 621-626.[Abstract/Free Full Text]

Chezzi, C., Blackburn, N. K. & Schoub, B. D. (1997). Molecular epidemiology of type 1 polioviruses from Africa.Journal of General Virology 78, 1017-1024.[Abstract]

Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX.Nucleic Acids Research 12, 387-395.

Drake, J. W. (1993). Rates of spontaneous mutation among RNA viruses.Proceedings of the National Academy of Sciences, USA 90, 4171-4175.[Abstract/Free Full Text]

Fiore, L., Genovese, D., Diamanti, E., Catone, S., Ridolfi, B., Ibrahimi, B., Konomi, R., van der Avoort, H. G. A. M., Hovi, T., Crainic, R., Simeoni, P. & Amato, C. (1998). Antigenic and molecular characterization of wild type 1 poliovirus causing outbreaks of poliomyelitis in Albania and neighboring countries in 1996.Journal of Clinical Microbiology 36, 1912-1918.[Abstract/Free Full Text]

Fox, G., Parry, N. R., Barnett, P. V., McGinn, B., Rowlands, D. J. & Brown, F. (1989). The cell attachment site on foot-and-mouth disease virus includes the amino acid sequence RGD (arginine-glycine-aspartic acid).Journal of General Virology 70, 625-637.[Abstract/Free Full Text]

Furione, M., Guillot, S., Otelea, D., Balanant, J., Candrea, A. & Crainic, R. (1993). Polioviruses with natural recombinant genomes isolated from vaccine-associated paralytic poliomyelitis.Virology 196, 199-208.[Medline]

Gjøen, K., Bruu, A.-L. & Ørstavik, I. (1996). Intratypic genome variability of echovirus type 30 in part of the VP4/VP2 coding region.Archives of Virology 141, 901-908.[Medline]

Hovi, T., Stenvik, M. & Rosenlew, M. (1996). Relative abundance of enterovirus serotypes in sewage differs from that in patients: clinical and epidemiological implications.Epidemiology and Infection 116, 91-97.[Medline]

Hughes, M. S., Hoey, E. M. & Coyle, P. V. (1993). A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.Epidemiology and Infection 110, 389-398.[Medline]

Hughes, P. J., Horsnell, C., Hyypiä, T. & Stanway, G. (1995). The coxsackievirus A9 RGD motif is not essential for virus viability.Journal of Virology 69, 8035-8040.[Abstract]

Huovilainen, A., Mulders, M. N., Agboatwalla, M., Pöyry, T., Stenvik, M. & Hovi, T. (1995). Genetic divergence of poliovirus strains isolated in the Karachi region of Pakistan.Journal of General Virology 76, 3079-3088.[Abstract/Free Full Text]

Huttunen, P., Santti, J., Pulli, T. & Hyypiä, T. (1996). The major echovirus group is genetically coherent and related to coxsackie B viruses.Journal of General Virology 77, 715-725.[Abstract/Free Full Text]

Hyypiä, T., Hovi, T., Knowles, N. J. & Stanway, G. (1997). Classification of enteroviruses based on molecular and biological properties.Journal of General Virology 78, 1-11.[Medline]

Ishiko, H., Takeda, N., Miyamura, K., Kato, N., Tanimura, M., Lin, K.-H., Yin-Murphy, M., Tam, J. S., Mu, G.-F. & Yamazaki, S. (1992). Phylogenetic analysis of a coxsackievirus A24 variant: the most recent worldwide pandemic was caused by progenies of a virus prevalent around 1981.Virology 187, 748-759.[Medline]

Jablonski, S. A., Luo, M. & Morrow, C. D. (1991). Enzymatic activity of poliovirus RNA polymerase mutants with single amino acid changes in the conserved YGDD amino acid motif.Journal of Virology 65, 4565-4572.[Abstract/Free Full Text]

Kamer, G. & Argos, P. (1984). Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses.Nucleic Acids Research 12, 7269-7282.[Abstract/Free Full Text]

Kew, O. M., Mulders, M. N., Lipskaya, G. Y., da Silva, E. E. & Pallansch, M. A. (1995). Molecular epidemiology of polioviruses.Seminars in Virology 6, 401-414.

King, A. M. Q., Brown, F., Christian, P., Hovi, T., Hyypiä, T., Knowles, N. J., Lemon, S. M., Minor, P. D., Palmenberg, A. C., Skern, T. & Stanway, G. (1999). Picornaviridae. In Virus Taxonomy: Classification and Nomenclature of Viruses. Seventh Report of the International Committee on Taxonomy of Viruses, pp. 996. Edited by M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carsten, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego: Academic Press.

Kirkegaard, K. & Baltimore, D. (1986). The mechanism of RNA recombination in poliovirus.Cell 47, 433-443.[Medline]

Kopecka, H., Brown, B. & Pallansch, M. (1995). Genotypic variation in coxsackievirus B5 isolates from three different outbreaks in the United States.Virus Research 38, 125-136.[Medline]

Morvan, J. M., Chezzi, C., Gouandjika, I., Reimerink, J. H. J. & van der Avoort, H. G. A. M. (1997). The molecular epidemiology of type 1 poliovirus in Central African Republic.Journal of General Virology 78, 591-599.[Abstract]

Mulders, M. N., Lipskaya, G. Y., van der Avoort, H. G. A. M., Koopmans, M. P. G., Kew, O. M. & van Loon, A. M. (1995). Molecular epidemiology of wild poliovirus type 1 in Europe, the Middle East, and the Indian subcontinent.Journal of Infectious Diseases 171, 1399-1405.[Medline]

Oberste, M. S., Maher, K. & Pallansch, M. A. (1998). Molecular phylogeny of all human enterovirus serotypes based on comparison of sequences at the 5' end of the region encoding VP2.Virus Research 58, 35-43.[Medline]

Oberste, M. S., Maher, K., Kilpatrick, D. R. & Pallansch, M. A. (1999). Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification.Journal of Virology 73, 1941-1948.[Abstract/Free Full Text]

Pöyry, T., Hyypiä, T., Horsnell, C., Kinnunen, L., Hovi, T. & Stanway, G. (1994). Molecular analysis of coxsackievirus A16 reveals a new genetic group of enteroviruses.Virology 202, 982-987.[Medline]

Pöyry, T., Kinnunen, L., Hyypiä, T., Brown, B., Horsnell, C., Hovi, T. & Stanway, G. (1996). Genetic and phylogenetic clustering of enteroviruses.Journal of General Virology 77, 1699-1717.[Abstract/Free Full Text]

Pulli, T., Koskimies, P. & Hyypiä, T. (1995). Molecular comparison of coxsackie A virus serotypes.Virology 212, 30-38.[Medline]

Pulli, T., Lankinen, H., Roivainen, M. & Hyypiä, T. (1998a). Antigenic sites of coxsackievirus A9.Virology 240, 202-212.[Medline]

Pulli, T., Roivainen, M., Hovi, T. & Hyypiä, T. (1998b). Induction of neutralizing antibodies by synthetic peptides representing the C terminus of coxsackievirus A9 capsid protein VP1.Journal of General Virology 79, 2249-2253.[Abstract]

Rico-Hesse, R., Pallansch, M. A., Nottay, B. K. & Kew, O. M. (1987). Geographic distribution of wild poliovirus type 1 genotypes.Virology 160, 311-322.[Medline]

Rivera, V. M., Welsh, J. D. & Maizel, J. V.Jr (1988). Comparative sequence analysis of the 5' noncoding region of the enteroviruses and rhinoviruses.Virology 165, 42-50.[Medline]

Roivainen, M., Hyypiä, T., Piirainen, L., Kalkkinen, N., Stanway, G. & Hovi, T. (1991). RGD-dependent entry of coxsackievirus A9 into host cells and its bypass after cleavage of VP1 protein by intestinal proteases.Journal of Virology 65, 4735-4740.[Abstract/Free Full Text]

Roivainen, M., Piirainen, L., Hovi, T., Virtanen, I., Riikonen, T., Heino, J. & Hyypiä, T. (1994). Entry of coxsackievirus A9 into host cells: specific interactions with {alpha}v{beta}3 integrin, the vitronectin receptor.Virology 203, 357-365.[Medline]

Ruoslahti, E. (1996). RGD and other recognition sequences for integrins.Annual Review of Cell and Developmental Biology 12, 697-715.[Medline]

Ruoslahti, E. & Pierschbacher, M. D. (1987). New perspectives in cell adhesion: RGD and integrins.Science 238, 491-497.[Abstract/Free Full Text]

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees.Molecular Biology and Evolution 4, 406-425.[Abstract]

Santti, J., Hyypiä, T. & Halonen, P. (1997). Comparison of PCR primer pairs in the detection of human rhinoviruses in nasopharyngeal aspirates.Journal of Virological Methods 66, 139-147.[Medline]

Santti, J., Hyypiä, T., Kinnunen, L. & Salminen, M. (1999). Evidence of recombination among enteroviruses.Journal of Virology 73, 8741-8749.[Abstract/Free Full Text]

Strikas, R. A., Andersson, L. J. & Parker, R. A. (1986). Temporal and geographic patterns of isolates of nonpolio enterovirus in the United States, 1970–1983.Journal of Infectious Diseases 153, 346-351.[Medline]

Takeda, N., Tanimura, M. & Miyamura, K. (1994). Molecular evolution of the major capsid protein VP1 of enterovirus 70.Journal of Virology 68, 854-862.[Abstract/Free Full Text]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.Nucleic Acids Research 25, 4876-4882.[Abstract/Free Full Text]

Toyoda, H., Kohara, M., Kataoka, Y., Suganuma, T., Omata, T., Imura, N. & Nomoto, A. (1984). Complete nucleotide sequences of all three poliovirus serotype genomes. Implication for genetic relationship, gene function and antigenic determinants.Journal of Molecular Biology 174, 561-585.[Medline]

Verdaguer, N., Mateu, M. G., Andreu, D., Giralt, E., Domingo, E. & Fita, I. (1995). Structure of the major antigenic loop of foot-and-mouth disease virus complexed with a neutralizing antibody: direct involvement of the Arg-Gly-Asp motif in the interaction.EMBO Journal 14, 1690-1696.[Medline]

Yu, S. F. & Lloyd, R. E. (1991). Identification of essential amino acid residues in the functional activity of poliovirus 2A protease.Virology 182, 615-625.[Medline]

Zheng, D.-P., Zhang, L.-B., Fang, Z.-Y., Yang, C.-F., Mulders, M., Pallansch, M. A. & Kew, O. M. (1993). Distribution of wild type 1 poliovirus genotypes in China.Journal of Infectious Diseases 168, 1361-1367.[Medline]

Zoll, J., Galama, J. & Melchers, W. (1994). Intratypic genome variability of the coxsackievirus B1 2A protease region.Journal of General Virology 75, 687-692.[Abstract/Free Full Text]

Received 13 July 1999; accepted 25 January 2000.


This article has been cited by other articles:


Home page
J. Clin. Microbiol.Home page
P. Susi, L. Hattara, M. Waris, T. Luoma-aho, H. Siitari, T. Hyypia, and P. Saviranta
Typing of Enteroviruses by Use of Microwell Oligonucleotide Arrays
J. Clin. Microbiol., June 1, 2009; 47(6): 1863 - 1870.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. C. M. Leitch, J. Bendig, M. Cabrerizo, J. Cardosa, T. Hyypia, O. E. Ivanova, A. Kelly, A. C. M. Kroes, A. Lukashev, A. MacAdam, et al.
Transmission Networks and Population Turnover of Echovirus 30
J. Virol., March 1, 2009; 83(5): 2109 - 2118.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
O. Heikkila, P. Susi, G. Stanway, and T. Hyypia
Integrin {alpha}V{beta}6 is a high-affinity receptor for coxsackievirus A9
J. Gen. Virol., January 1, 2009; 90(1): 197 - 204.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
A. Mirand, C. Henquell, C. Archimbaud, M. Chambon, F. Charbonne, H. Peigue-Lafeuille, and J.-L. Bailly
Prospective Identification of Enteroviruses Involved in Meningitis in 2006 through Direct Genotyping in Cerebrospinal Fluid
J. Clin. Microbiol., January 1, 2008; 46(1): 87 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Mirand, C. Henquell, C. Archimbaud, H. Peigue-Lafeuille, and J.-L. Bailly
Emergence of recent echovirus 30 lineages is marked by serial genetic recombination events
J. Gen. Virol., January 1, 2007; 88(1): 166 - 176.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Simmonds
Recombination and Selection in the Evolution of Picornaviruses and Other Mammalian Positive-Stranded RNA Viruses
J. Virol., November 15, 2006; 80(22): 11124 - 11140.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M.-C. Kim, Y.-K. Kwon, S.-J. Joh, A. M. Lindberg, J.-H. Kwon, J.-H. Kim, and S.-J. Kim
Molecular analysis of duck hepatitis virus type 1 reveals a novel lineage close to the genus Parechovirus in the family Picornaviridae.
J. Gen. Virol., November 1, 2006; 87(Pt 11): 3307 - 3316.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
Y. N. Zhao, D. S. Perlin, S. Park, R. J. Jiang, L. Chen, Y. Chen, R. Gardiner, and Q. W. Jiang
FDJS03 Isolates Causing an Outbreak of Aseptic Meningitis in China That Evolved from a Distinct Echovirus 30 Lineage Imported from Countries of the Commonwealth of Independent States
J. Clin. Microbiol., November 1, 2006; 44(11): 4142 - 4148.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Simmonds and J. Welch
Frequency and Dynamics of Recombination within Different Species of Human Enteroviruses
J. Virol., January 1, 2006; 80(1): 483 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. N. Lukashev, V. A. Lashkevich, O. E. Ivanova, G. A. Koroleva, A. E. Hinkkanen, and J. Ilonen
Recombination in circulating Human enterovirus B: independent evolution of structural and non-structural genome regions
J. Gen. Virol., December 1, 2005; 86(12): 3281 - 3290.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
L. Li, Y. He, H. Yang, J. Zhu, X. Xu, J. Dong, Y. Zhu, and Q. Jin
Genetic Characteristics of Human Enterovirus 71 and Coxsackievirus A16 Circulating from 1999 to 2004 in Shenzhen, People's Republic of China
J. Clin. Microbiol., August 1, 2005; 43(8): 3835 - 3839.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. S. Oberste, S. M. Michele, K. Maher, D. Schnurr, D. Cisterna, N. Junttila, M. Uddin, J.-J. Chomel, C.-S. Lau, W. Ridha, et al.
Molecular identification and characterization of two proposed new enterovirus serotypes, EV74 and EV75
J. Gen. Virol., November 1, 2004; 85(11): 3205 - 3212.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. S. Oberste, K. Maher, D. Schnurr, M. R. Flemister, J. C. Lovchik, H. Peters, W. Sessions, C. Kirk, N. Chatterjee, S. Fuller, et al.
Enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses
J. Gen. Virol., September 1, 2004; 85(9): 2577 - 2584.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. H. Williams, T. Kajander, T. Hyypia, T. Jackson, D. Sheppard, and G. Stanway
Integrin {alpha}v{beta}6 Is an RGD-Dependent Receptor for Coxsackievirus A9
J. Virol., July 1, 2004; 78(13): 6967 - 6973.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. N. Lukashev, V. A. Lashkevich, G. A. Koroleva, J. Ilonen, and A. E. Hinkkanen
Recombination in uveitis-causing enterovirus strains
J. Gen. Virol., February 1, 2004; 85(2): 463 - 470.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
S. N. Bennett, E. C. Holmes, M. Chirivella, D. M. Rodriguez, M. Beltran, V. Vorndam, D. J. Gubler, and W. O. McMillan
Selection-Driven Evolution of Emergent Dengue Virus
Mol. Biol. Evol., October 1, 2003; 20(10): 1650 - 1658.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Harvala, H. Kalimo, G. Stanway, and T. Hyypia
Pathogenesis of coxsackievirus A9 in mice: role of the viral arginine-glycine-aspartic acid motif
J. Gen. Virol., September 1, 2003; 84(9): 2375 - 2379.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Brown, M. S. Oberste, K. Maher, and M. A. Pallansch
Complete Genomic Sequencing Shows that Polioviruses and Members of Human Enterovirus Species C Are Closely Related in the Noncapsid Coding Region
J. Virol., August 15, 2003; 77(16): 8973 - 8984.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. M. Lindberg, P. Andersson, C. Savolainen, M. N. Mulders, and T. Hovi
Evolution of the genome of Human enterovirus B: incongruence between phylogenies of the VP1 and 3CD regions indicates frequent recombination within the species
J. Gen. Virol., May 1, 2003; 84(5): 1223 - 1235.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
G. Oprisan, M. Combiescu, S. Guillot, V. Caro, A. Combiescu, F. Delpeyroux, and R. Crainic
Natural genetic recombination between co-circulating heterotypic enteroviruses
J. Gen. Virol., September 1, 2002; 83(9): 2193 - 2200.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Harvala, H. Kalimo, L. Dahllund, J. Santti, P. Hughes, T. Hyypia, and G. Stanway
Mapping of tissue tropism determinants in coxsackievirus genomes
J. Gen. Virol., June 1, 2002; 83(7): 1697 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Palacios, I. Casas, D. Cisterna, G. Trallero, A. Tenorio, and C. Freire
Molecular Epidemiology of Echovirus 30: Temporal Circulation and Prevalence of Single Lineages
J. Virol., April 16, 2002; 76(10): 4940 - 4949.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Boonyakiat, P. J. Hughes, F. Ghazi, and G. Stanway
Arginine-Glycine-Aspartic Acid Motif Is Critical for Human Parechovirus 1 Entry
J. Virol., October 15, 2001; 75(20): 10000 - 10004.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Joki-Korpela, M. Roivainen, H. Lankinen, T. Pöyry, and T. Hyypiä
Antigenic properties of human parechovirus 1
J. Gen. Virol., July 1, 2000; 81(7): 1709 - 1718.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santti, J.
Right arrow Articles by Hyypiä, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santti, J.
Right arrow Articles by Hyypiä, T.
Agricola
Right arrow Articles by Santti, J.
Right arrow Articles by Hyypiä, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS