|
|
||||||||
Insect |
NERC Institute of Virology and Environmental Microbiology, Mansfield Road, Oxford OX1 3SR, UK1
School of Biological and Molecular Sciences, Oxford Brookes University, Gipsy Lane Campus, Oxford OX3 0BP, UK2
Department of Molecular and Cell Biology, University of Aberdeen, Aberdeen AB25 2ZD, UK3
Author for correspondence: Linda King. Fax +44 1865 483242. e-mail laking{at}brookes.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Chitinase genes have been identified in many other baculoviruses (B. Arif & H. Peng, unpublished GenBank accession no. U72030; T. Wu & D. Tribe, unpublished GenBank accession no. U67265; Ahrens et al., 1997
; Kang et al., 1998
; Gomi et al., 1999
; Kuzio et al., 1999
). Comparisons between the available sequence data show a remarkable similarity between the baculovirus chiA genes. An alignment of the predicted amino acid sequences of the AcMNPV chitinase with chitinases from a range of bacteria, yeast and nematodes revealed high similarity (60·5%) with the chiA gene product from the bacterium Serratia marcescens (Hawtin et al., 1995
). The most extensive similarity was observed in the region encompassing the putative active site. This region includes an invariant aspartate separated from an invariant glutamate by three residues. These amino acids are thought to contribute to the active site of family 18 chitinases (Henrissat, 1990
; Kuranda & Robbins, 1991
; Watanabe et al., 1992
). The crystal structure of the S. marcescens chiA gene product has been determined at 2·3
resolution (Perrakis et al., 1994
). The structure of the chiA gene product in a complex with the substrate N,N,N',N'''-tetraacetylochitotetraose has suggested that Glu-315 might be the catalytic residue of the active site. Site-directed mutagenesis of the glutamate (Glu-204) and aspartate (Asp-200) residues in the product of the chiA gene of Bacillus circulans suggested that these residues are essential for chitinase activity (Watanabe et al., 1993
). In addition, the natural substrates of both chitinase and lysozyme are structurally similar. Site-directed mutagenesis of the Asp-35 and Glu-52 codons of chick egg-white lysozyme revealed that mutation of Glu-52 resulted in almost total cessation of activity, while mutation of Asp-35 significantly decreased activity of the enzyme (Malcolm et al., 1989
).
Given the above evidence, it was proposed that Asp-311 and Glu-315 of the AcMNPV chiA gene product might be critical for enzyme activity. However, conclusive proof that these residues constitute the active site of the AcMNPV chitinase cannot be derived from analysis of sequence data. Therefore, the effects of these residues on the activity of the enzyme were investigated by site-directed mutagenesis in a manner similar to that employed by Malcolm et al. (1989)
and Watanabe et al. (1993)
. We also monitored the effect of making these changes on the ability of the chitinase to cause liquefaction in AcMNPV-infected larvae.
| Methods |
|---|
|
|
|---|
Cells and viruses.
Plasmid transfer vectors
pchiA-.lacZ.
An internal portion of the chitinase coding sequence of 828 bp, spanning the putative active site, was obtained by digestion of the plasmid pUC119-PstIM (Hawtin et al., 1995
) with BglII and HindIII to release an 828 bp fragment. This was ligated into pUC118, previously digested with BamHI and HindIII, to yield the plasmid pUC118Chit. A ClaI restriction endonuclease site present in the central region of the putative active site was converted to a BglII site by the insertion of a linker (CGAGATCT). This plasmid was subsequently linearized by digestion with BglII and a lacZ cassette was inserted. The 3·4 kb lacZ cassette comprised the Escherichia coli lacZ coding sequence, under the control of the polyhedrin promoter, and the SV40 terminator sequence. It was obtained by restriction of pAcRP23lacZ (Possee & Howard, 1987
) with BglII and BamHI. Ligation of the lacZ cassette into BglII-digested pUC118Chit produced pchiA-.lacZ (Fig. 1
).
|
GCC; depicted in bold). Sequencing confirmed that the correct nucleotide had been altered and that no further nucleotides had been mutated. This 306 bp fragment was then ligated into ClaI, HindII-restricted pUC118Chit to produce pchiAD311G.
pchiAE315G.
Oligonucleotide primers (5' GTAGACATCGATTGGGGATTTCCG 3' and 5' GTCCAGCCGCGGCCGTACATG 3') amplified a fragment of 402 bp from pUC119-PstIM, which included a mismatch of glutamate to glycine (GAG
GGA; shown in bold). The primers were designed to include ClaI and SacII restriction sites (underlined) at the 5' and 3' ends of the fragment, respectively. This was ligated into pBS.SK+, previously digested with ClaI and SacII. The PCR product was subsequently sequenced to confirm that only the correct mismatched nucleotide had been incorporated. This fragment was then cloned into pUC118Chit that had been double-digested with ClaI and SacII, to produce pchiAE315G (Fig. 1
).
pchiAD311G E315G.
pchiAE315G was digested with ClaI and HindIII and the 306 bp PCR product, containing the mutagenized site for aspartate (see pchiAD311G above), was ligated into this plasmid.
Generation of recombinant baculoviruses AcchiAD311G, AcchiAE315G and AcchiAD311G E315G.
The plasmid pchiA-.lacZ was mixed with AcMNPV DNA and used to co-transfect Sf21 cells (King & Possee, 1992
). The progeny virus was titrated by using plaque assays and stained with X-Gal to identify blue plaques representing recombinants where the lacZ cassette should have been inserted within chiA. Working stocks of this virus, AcchiA-.lacZ, were derived after further rounds of plaque purification to remove parental virus. Genomic DNA prepared from AcchiA-.lacZ was linearized with Bsu361, mixed with pchiAD311G, pchiAE315G or pchiAD311G E315G and used to co-transfect Sf21 cells. The progeny virus was titrated by plaque assay, stained with both X-Gal and neutral red and colourless, polyhedron-positive plaques were selected and subsequently purified to homogeneity. A seed stock of each virus was produced and used to derive working stocks of AcchiAD311G, AcchiAE315G and AcchiAD311G E315G. The structural integrity of the virus genomes was confirmed by restriction enzyme digestion (data not shown).
Enzyme assays.
Sf21 cells were infected at an m.o.i. of 10 p.f.u. per cell or mock-infected, and harvested at the appropriate time post-infection (p.i.). Cell pellets were either sonicated or subjected to three rounds of freezethawing before assaying. Two separate assays were used to monitor chitinase activity. The first was based on measuring activity with 3H-labelled colloidal chitin as a substrate. The labelled chitin was prepared by the method of Molano et al. (1977)
by treating chitosan (molecular mass approximately 750 kDa; Fluka) with [3H]acetic anhydride (Amersham) to yield a product with a spec. act. of approximately 1 µCi/mg. The labelled chitin was stored in 0·2% sodium azide at 4 °C and washed in 50 mM sodium phosphate buffer, pH 6·5, immediately before use. The labelled chitin was resuspended in 50 mM sodium phosphate buffer, pH 6·5, by vortexing prior to the addition of virus-infected cell lysate. After incubation with shaking at 30 °C for 30 min, the reaction was terminated by the addition of 5% trichloroacetic acid. The samples were centrifuged (15000 g; 3 min) and the supernatants were transferred to vials containing scintillation fluid. Radioactivity released from the labelled substrate was quantified by liquid scintillation spectrometry in a Wallac 1217 Rackbeta counter. Samples were also assayed for chitinase activity by using the microtitre plate method of McCreath & Gooday (1992)
as described previously (Hawtin et al., 1995
). This method enables exochitinase, endochitinase or N-acetylglucosaminidase activities to be determined. The substrates used in the assay were 4-methylumbelliferyl glycosides of N-acetylglucosamine oligosaccharides [4MU-(GlcNAc)14] (Sigma). Cell lysates were incubated with the appropriate substrate for 30 min at 37 °C and then the reaction was terminated by the addition of 0·5 M NaOH, and the fluorescence was read immediately. The cysteine protease assay was performed as described by Ohkawa et al. (1994)
. Approximately 3x107 Sf21 cells (either mock-infected or virus-infected at an m.o.i. of 10) of each sample were used in this assay.
SDSPAGE and Western blotting.
SDSPAGE and Western blotting were performed as described previously (King & Possee, 1992
) using antibody dilutions described by Hawtin et al. (1997)
.
Virus infection of insect larvae.
Third instar Trichoplusia ni larvae were maintained on semi-synthetic diet (Hunter et al., 1984
) and were inoculated with virus per os. Each larva (50 per virus dose) was placed into a separate microtitre plate well, containing a single diet plug that had been soaked with a defined number of polyhedra. Control larvae (n=50) were placed into separate microtitre plate wells containing a diet plug soaked with sterile PBS. After 24 h, when the diet plug had been ingested, the larvae were transferred to individual sterile polypots containing virus-free diet. Larvae that had not consumed the contaminated diet plugs after 24 h were discarded.
| Results |
|---|
|
|
|---|
Gly), AcchiAE315G (Glu-315
Gly) and AcchiAD311G E315G (Glu-315
Gly and Asp-311
Gly), in order to determine whether or not these residues are required for chitinase activity.
Assessment of chitinase protein production by AcchiA-.lacZ, AcchiAD311G, AcchiAE315G and AcchiAD311G E315G
Cells infected with AcchiA-.lacZ or AcMNPV or mock infected were harvested at 48 h p.i. The samples were analysed by SDSPAGE followed by Coomassie staining or Western blot analysis. Fig. 2(a)
shows a Coomassie blue-stained gel. A 58 kDa chitinase was seen in the wild-type-infected cell sample but was absent in the AcchiA-.lacZ- and mock-infected samples. The product of the lacZ gene,
-galactosidase, was visible as a 116 kDa protein in AcchiA-.lacZ-infected cell samples. This protein was not detected in wild-type or mock-infected cell samples. Western blot analysis was carried out by using anti-chitinase antiserum. The blot confirmed that the 58 kDa protein detected in the AcMNPV-infected cell sample was chitinase. This protein was not observed in the other samples. However, an approximately 25 kDa protein that cross-reacted with the anti-chitinase antiserum was identified in cells infected with AcchiA-.lacZ (Fig. 2c
). This was probably a truncated protein produced by the initial translation of the 5' region of chitinase, and did not have chitinase activity (data not shown).
|
Cysteine protease activity in virus-infected cells
The integrity of v-cath in AcchiAD311G, AcchiAE315G and AcchiAD311G E315G was assessed by monitoring cysteine protease activity in virus-infected cells. Cathepsin is required for the liquefaction of baculovirus-infected larvae. It was essential to establish that the gene was functional prior to assessing the effect of the mutations within the active site of chitinase on this process. Sf21 cells were infected with the recombinant viruses at 10 p.f.u. per cell. At 40 h p.i., the cells were harvested and assayed for cysteine protease activity (Ohkawa et al., 1994
). Fig. 3
shows the results from three independent assays and demonstrates that the levels of cathepsin activity in cells infected with AcchiAD311G, AcchiAE315G or AcchiAD311G E315G were comparable to the levels detected in wild-type virus-infected cells. Statistical analysis of the data by one-way ANOVA revealed that the differences between the mock-infected and virus-infected cells were significant (P<0·05). However, the variations observed between the different virus-infected cells were not significant (P>0·05). This result indicates that cathepsin was produced to normal levels in cells infected with viruses containing point mutations in the chitinase gene.
|
|
|
Effects of AcchiAD311G, AcchiAE315G and AcchiAD311G E315G on liquefaction of larvae
Analysis of the LD50 values obtained for each virus indicated that there was no significance difference between the viruses with mutations in chiA and AcMNPV. This suggested that the alteration of the residues in the chitinase active site had not affected infectivity (data not shown). However, when a susceptible larva succumbs to AcMNPV infection, liquefaction of the host is observed. Chitinase is required for this process. Therefore, the effects of the mutation of residues of the active site on larval liquefaction were examined. Second instar T. ni larvae were fed diet plugs that had been soaked with either AcMNPV, AcchiAD311G, AcchiAE315G or AcchiAD311G E315G polyhedra (103) or PBS, and were monitored daily for signs of liquefaction and/or death. The experiment was repeated three times and the earliest time to liquefaction of a cohort of infected larvae was recorded for each virus. The results are presented in Table 1
. The larvae were also photographed at appropriate times p.i. to provide a visual record of their appearance (Fig. 6
). Liquefaction was first observed at 7 days p.i. when larvae had been infected with either AcMNPV or AcchiAD311G; prior to this time, no liquefaction was observed in either cohort of larvae. Larvae infected with AcchiAE315G did not begin to liquefy until 9 days p.i. No signs of liquefaction were observed in larvae infected with AcchiAD311G E315G throughout the period of this study.
|
|
| Discussion |
|---|
|
|
|---|
The results of the chitinase assays suggest that altering the glutamate at position 315 of the protein leads to decreased exochitinase activity and also a reduction in the amount of endochitinase activity detected at earlier times p.i. when using substrate 3. Watanabe et al. (1993)
demonstrated that mutagenesis of the glutamate of B. circulans chitinase caused a significant reduction in the amount of chitinase activity detected. The alteration of Glu-315 also resulted in a delay in liquefaction of larvae when compared with wild-type-infected insects. This suggests that Glu-315 is a major determinant of chitinase activity. Mutagenesis of the aspartate residue, position 311, resulted in a reduction of the exochitinase detected. However, this mutation unexpectedly appeared to enhance endochitinolytic activity. This may be a consequence of the fact that the AcMNPV chiA gene product possesses both exo- and endochitinase activities that appear to be carried by a single polypeptide. Liquefaction of AcchiAD311G-infected larvae was observed at the same time as in the AcMNPV-infected larvae. The mutagenesis of both target residues, glutamate and aspartate, resulted in the attenuation of chitinolytic activity. In agreement with this, the larvae infected with AcchiAD311G E315G failed to liquefy. The results indicate that the glutamate and aspartate residues are determinants of chitinase activity and are variably required for liquefaction of the virus-infected host insect.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus.Virology 202, 586-605.[Medline]
Fuchs, R. L., McPherson, S. A. & Drahos, D. J. (1986). Cloning of a Serratia marcescens gene encoding chitinase.Applied and Environmental Microbiology 51, 504-509.
Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus.Journal of General Virology 80, 1323-1337.[Abstract]
Gooday, G. W. (1994). Physiology of microbial degradation of chitin and chitosan. In Biochemistry of Microbial Degradation, pp. 279-312. Edited by C. Ratledge. Dordrecht: Kluwer.
Hawtin, R. E., Arnold, K., Ayres, M. D., Zanotto, P. M. D. A., Howard, S. C., Gooday, G. W., Chappell, L. H., Kitts, P. A., King, L. A. & Possee, R. D. (1995). Identification and preliminary characterization of a chitinase gene in the Autographa californica nuclear polyhedrosis virus genome.Virology 212, 673-685.[Medline]
Hawtin, R. E., Zarkowska, T., Arnold, K., Thomas, C. J., Gooday, G. W., King, L. A., Kuzio, J. A. & Possee, R. D. (1997). Liquefaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded chitinase and cathepsin genes.Virology 238, 243-253.[Medline]
Henrissat, B. (1990). Weak sequence homologies among chitinases detected by clustering analysis.Protein Sequences & Data Analysis 3, 523-526.
Hunter, F. R., Crook, N. E. & Entwistle, P. F. (1984). Viruses as pathogens for the control of insects. In Microbial Methods for Environmental Biotechnology, pp. 323-347. Edited by J. M. Grainger & J. M. Lynch. New York & London: Academic Press.
Kang, W., Tristem, M., Maeda, S., Crook, N. E. & OReilly, D. R. (1998). Identification and characterization of the Cydia pomonella granulovirus cathepsin and chitinase genes.Journal of General Virology 79, 2283-2292.[Abstract]
King, L. A. & Possee, R. D. (1992). The Baculovirus Expression System. A Laboratory Guide. London: Chapman & Hall.
Kuranda, M. J. & Robbins, P. W. (1991). Chitinase is required for cell separation during growth of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 19758-19767.
Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. M. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar.Virology 253, 17-34.[Medline]
McCreath, K. J. & Gooday, G. W. (1992). A rapid and sensitive microassay for determination of chitinolytic activity.Journal of Microbiological Methods 14, 229-237.
Malcolm, B. A., Rosenberg, S., Corey, M. J., Allen, J. S., de Baetselier, A. & Kirsch, J. F. (1989). Site-directed mutagenesis of the catalytic residues Asp-52 and Glu-35 of chicken egg white lysozyme.Proceedings of the National Academy of Sciences, USA 86, 133-137.
Molano, J., Duran, A. & Cabib, E. (1977). A rapid and sensitive assay for chitinase using tritiated chitin.Analytical Biochemistry 83, 648-656.[Medline]
Ohkawa, T., Majima, K. & Maeda, S. (1994). A cysteine protease encoded by the baculovirus Bombyx mori nuclear polyhedrosis virus.Journal of Virology 68, 6619-6625.
Payne, G., Ahl, P., Moyer, M., Harper, A., Beck, J., Meins, F.Jr & Ryals, J. (1990). Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.Proceedings of the National Academy of Sciences, USA 87, 98-102.
Perrakis, A., Tews, I., Dauter, Z., Oppenheim, A. B., Chet, I., Wilson, K. S. & Vorgias, C. E. (1994). Crystal structure of a bacterial chitinase at 2·3
resolution.Structure 2, 1169-1180.[Medline]
Possee, R. D. (1986). Cell-surface expression of influenza virus haemagglutinin in insect cells using a baculovirus vector.Virus Research 5, 43-59.[Medline]
Possee, R. D. & Howard, S. C. (1987). Analysis of the polyhedrin gene promoter of the Autographa californica nuclear polyhedrosis virus.Nucleic Acids Research 15, 10233-10248.
St Leger, R. J., Staples, R. C. & Roberts, D. W. (1993). Entomopathogenic isolates of Metarhizium anisopliae, Beauveria bassiana, and Aspergillus flavus produce multiple extracellular chitinase isozymes.Journal of Invertebrate Pathology 61, 81-84.
Slack, J. M., Kuzio, J. & Faulkner, P. (1995). Characterisation of v-cath, a cathepsin L-like proteinase expressed by the baculovirus Autographa californica multiple nuclear polyhedrosis virus.Journal of General Virology 76, 1091-1098.
Sticher, L., Hofsteenge, J., Milani, A., Neuhaus, J. M. & Meins, F.Jr (1992). Vacuolar chitinases of tobacco: a new class of hydroxyproline-containing proteins.Science 257, 655-657.
Vaughn, J. L., Goodwin, R. H., Tompkins, G. J. & McCawley, P. (1977). The establishment of two insect lines from the insect Spodoptera frugiperda (Lepidoptera: Noctuidae).In Vitro 13, 213-217.[Medline]
Watanabe, T., Oyanagi, W., Suzuki, K. & Tanaka, H. (1990). Chitinase system of Bacillus circulans WL-12 and importance of chitinase A1 in chitin degradation.Journal of Bacteriology 172, 4017-4022.
Watanabe, T., Oyanagi, W., Suzuki, K., Ohnishi, K. & Tanaka, H. (1992). Structure of the gene encoding chitinase D of Bacillus circulans WL-12 and possible homology of the enzyme to other prokaryotic chitinases and class III plant chitinases.Journal of Bacteriology 174, 408-414.
Watanabe, T., Kobori, K., Miyashita, K., Fujii, T., Sakai, H., Uchida, M. & Tanaka, H. (1993). Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 of Bacillus circulans WL-12 as essential residues for chitinase activity.Journal of Biological Chemistry 268, 18567-18572.
Received 16 August 1999;
accepted 28 December 1999.
This article has been cited by other articles:
![]() |
J. J. Hodgson, B. M. Arif, and P. J. Krell Reprogramming the chiA expression profile of Autographa californica multiple nucleopolyhedrovirus J. Gen. Virol., September 1, 2007; 88(9): 2479 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Young, R. M. Simpson, and V. K. Ward Characterization of an exochitinase from Epiphyas postvittana nucleopolyhedrovirus (family Baculoviridae) J. Gen. Virol., December 1, 2005; 86(12): 3253 - 3261. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Saville, A. L. Patmanidi, R. D. Possee, and L. A. King Deletion of the Autographa californica nucleopolyhedrovirus chitinase KDEL motif and in vitro and in vivo analysis of the modified virus J. Gen. Virol., April 1, 2004; 85(4): 821 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Merzendorfer and L. Zimoch Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases J. Exp. Biol., December 15, 2003; 206(24): 4393 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Saville, C. J. Thomas, R. D. Possee, and L. A. King Partial redistribution of the Autographa californica nucleopolyhedrovirus chitinase in virus-infected cells accompanies mutation of the carboxy-terminal KDEL ER-retention motif J. Gen. Virol., March 1, 2002; 83(3): 685 - 694. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |