|
|
||||||||
Animal: RNA Viruses |
Division of Gastroenterology and Hepatology, University Hospital, 24 rue Micheli-du-Crest, 1211 Geneva, Switzerland1
Swiss Institute of Bioinformatics2 and Division of Clinical Pathology3, CMU, 1 rue Michel-Servet, 1211 Geneva, Switzerland
Author for correspondence: Francesco Negro (at University Hospital). Fax +41 22 3729366. e-mail Francesco.Negro{at}dim.hcuge.ch
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Specific criteria have been established to standardize and facilitate type assignment once new sequences are obtained from HCV isolates across the world. According to these criteria, six clades are now recognized, which correspond to the former genotypes 16; genotypes 79 and 11 (Tokita et al., 1994a
, 1995
) have been reassigned to clade 6, and genotype 10 (Tokita et al., 1996
) has been reassigned to clade 3, based on phylogenetic analysis rather than sequence identity (Mizokami et al., 1996
; Simmonds et al., 1996
; de Lamballerie et al., 1997
; Robertson et al., 1998
). Although the classification of new HCV sequences should be preferably based on complete genome sequences, tentative clade/subtype assignments can be made based on phylogenetic analysis of nucleotide sequences of at least two coding regions (Robertson et al., 1998
). The precise subtype assignment of HCV isolates has not only taxonomic consequences, but may help in guiding the clinician in the decision- making process, especially before antiviral treatment (Poynard et al., 1998
; McHutchison et al., 1998
). Although the gold standard in type assignment is sequence analysis, the more widely used assays currently available in the clinical setting are a line-probe assay (INNO-LIPA; Innogenetics), RFLP analysis of sequences in the 5 UTR of the HCV genome (Davidson et al., 1995
), and an RTPCR assay amplifying the nucleocapsid-encoding region of HCV in a type-dependent manner (Okamoto et al., 1992
). These assays allow the correct identification of the HCV genotype (and in some cases the subtype) in more than 90% of cases. Controversies over the clade determination in some cases can be solved by direct sequencing.
We report here the sequence and phylogenetic analyses of three HCV isolates from Somalia, for whom genotype assignment gave conflicting results based on two of the above-mentioned conventional techniques.
| Methods |
|---|
|
|
|---|
Patients. Patient 2 was a 57-year-old man without risk factors for HCV infection and had, at liver biopsy, moderate necroinflammatory activity with portal, focally extensive fibrosis (A2F2). Serum HCV RNA level was 1·6x106 genome equivalents/ml.
Patient 3, a 50-year-old woman, was a registered nurse in Mogadishu. In 1977, on occasion of her first delivery, she had received a blood transfusion. There were no other risk factors for HCV infection, but she reported that one of her sisters had died of an unspecified liver disease. She underwent a liver biopsy showing the presence of moderate necroinflammation with portal, focally extensive fibrosis (A2F2). Her serum HCV RNA level was 2·235x105 genome equivalents/ml.
All three patients were treated with
-IFN (3 million units, three times a week), but they all failed to respond (i.e. persisting HCV RNA in serum after 12 weeks of treatment).
Genotype assignment by conventional assays.
Patients genotype was tested by line-probe assay (INNO-LIPA; Innogenetics) and verified by RFLP analysis of sequences amplified in the 5 UTR (Davidson et al., 1995
).
Amplification and sequencing of liver- derived HCV RNA.
Total liver RNA was extracted (Chomczynski & Sacchi, 1987
) and reverse-transcribed using random hexamers and AMV reverse transcriptase (Promega Biotech). The cDNA was then amplified in three separate reactions to obtain amplicons corresponding to the core, envelope 1 (E1) and part of the non-structural 5b (NS5b) regions. Primer selection was based on different approaches. For the core- encoding region, we used a universal genomic primer 5UTR43S (5' GGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTG 3'), which spans positions -43 to -5 of most known HCV isolates (numbering according to Choo et al., 1991
). The sequence of the antigenomic primer 3aASE1 (5' ACAGTCGTTGGTAACGGCGTAGAGGCCGGAGGTGTTCCG 3'), spanning positions 621583, was chosen by alignment of different sequences of HCV clade 3, based on the provisional assignment of our isolates to this clade upon sequencing of the 5' UTR obtained for RFLP analysis (see Results). PCR conditions were two 35-cycle rounds of PCR using 1·25 U Pfu polymerase (Promega) and the above primers. After a 5 min hot start at 95 °C, each cycle consisted of a denaturation step at 94 °C for 30 s, an annealing step at 55 °C for 45 s and an elongation step at 72 °C for 2 min. For the E1 region, primer sequences were deduced from the alignment of the core sequences of patients belonging to clade 3. The outer genomic primer 3aCORE461 had the sequence 5' GCGTGAGGGCCCTTGAAGACGGGATAAATTTCGCAACAGG 3', spanning positions 461500, whereas the outer antigenomic primer 3aE2110 had the sequence 5' ATGGAVTCATTGCAGTTCAGGGCAGTACTGTTGATGTGCC 3', spanning positions 12981259. For the second round of amplification, we chose the genomic primer 3aCORE476 (5' AAGACGGGATAAATTTCGCAACAGGGAACTTGCCCGGTTG 3'), covering positions 476515, and the antigenomic primer 3aE297 (5' AGTTCAGGGCAGTACTGTTGATGTGCCACGAGCCATTGGT 3'), covering positions 12851246. PCR conditions were the same as those used for amplification of the core-encoding region. For amplification of the NS5b region, we used the primers and conditions reported by Mellor et al. (1995)
, with some exceptions: among the inner four genomic primers tested, we chose primer 554 since it gave the most consistent results; the annealing temperature was 55 °C instead of 45 °C; and the number of cycles was 35 instead of 30 for each round.
PCR products were purified with the Wizard DNA PCR Preps purification system (Promega) and directly sequenced using standard protocols for the ABI 377 automated sequencer. Primers used for the sequencing reactions (both directions) were the same as those used for the PCR amplifications.
Sequence and phylogenetic analyses.
Sequences were first aligned by multiple sequence alignment with hierarchical clustering, using the MultAlin algorithm (Corpet, 1988
). All subsequent phylogenetic analyses were carried out using the PHYLIP package (Felsenstein, 1993
). Evolutionary distances were estimated with the DNADIST program. Unrooted trees with all branch lengths drawn to scale were constructed using the NEIGHBOR program. The robustness of the grouping was tested by the bootstrap resampling procedure; the values obtained for the tree drawn with programs SEQBOOT, DNADIST, NEIGHBOR and CONSENS were reported on the tree showing evolutionary distances. Neighbour-joining trees with 1000 replicates were used in the bootstrap analysis and values above 700 (70%) were considered to support the grouping (Robertson et al. , 1998
). Representative sequences from the six different HCV clades were chosen among those reported in the GenBank or EMBL databases and compared with the corresponding sequences of the three Somali isolates. We analysed the complete core-encoding region (573 nt), the complete E1-encoding region (576 nt) and the 222 nt portion of NS5b region (position 79758196; numbering according to Choo et al., 1991
). Phylogenetic analysis was carried out using 51, 48 and 49 (not including the Somali isolates) different sequences for the core, E1 and NS5b regions, respectively. Trees representing clade 3 alone (for each region) were constructed with the same sequences used for the main trees, plus two, three and six additional sequences for the core, E1 and NS5b regions, respectively. Names of the isolates used in the present analyses are as follows (accession numbers are given in parentheses).
Core region.
Clade 1: US11 (U10232); DR4 (U10196); HC-G9 (D14853); DK1 (U10193); HK3 (U10199); HK4 (U10200); YS117 (D16189). Clade 2: NE92 (L29631); S83 (U10211); T4 (U10228); T9 (U10230); T2 (U10226); SW3 (U10224); DK11 (U10190); T8 (U10229). Clade 3: S2 (U10208); NE125 (D14203); DK12 (U10191); HK10 (U10197); Th85 (D14307); S52 (U10210); US114 (D14309); NE048 (D16612); NE274 (D16620); NE145 (D16618); HCV-TR (D49374); NE137 (D16616); JK030 (D49747); JK049 (D49749); JK055 (D49750); JK070 (D49750); QC29 (U33437). Clade 4: Z7 (U10239); Z6 (U10238); CAM600 (L29589); Z4 (U10236); Z5 (U10237); Z1 (U10235). Clade 5: SA4 (U10218); SA7 (U10221); SA13 (U10215); BE95 (L29577). Clade 6: VN530 (D88471); VN507 (D88470); VN004 (D88465); VN085 (D88466); VN571 (D88476); VN569 (D88475); VN538 (D88473); VN540 (D88474); VN843 (D88478); VN998 (D31971); VN235 (D88467); VN405 (D17472). Somali isolates: SOM1 (AF216792); SOM2 (AF216793); SOM3 (AF216794).
E1 region.
Clade 1: HK3 (L16660); HCV-JT (D11168); HN3 (X76414); YS117 (D16189); HC-G9 (D14853); US11 (L16676); DR4 (L16633); SW1 (L16671); DK1 (L16629). Clade 2: T4 (L16674); T9 (L16675); T2 (L16673); S83 (L16641); HN4 (X76415); SW3 (L16672); DK11 (L16655); T8 (L16649). Clade 3: US114 (D14309); S2 (L16639); Th85 (D14307); DK12 (L16630); S52 (L16640); NE274 (D16620); NE048 (D16612); NE145 (D16618); HCV-TR (D49374); NE137 (D166616); NE125 (D14203); JK030 (D49747); JK049 (D49749); JK055 (D49750); JK070 (D49752). Clade 4: Z1 (L16677); Z4 (L11652); Z6 (L16678); Z7 (L16653); DK13 (L16656). Clade 5: SA1 (L16642); SA4 (L16669); SA5 (L16644); SA6 (L16670). Clade 6: VN507 (D88470); VN531 (D88472); VN405 (D88468); VN085 (D88466); VN004 (D88465); VN569 (D88475); VN538 (D88473); VN540 (D88474); VN998 (D31971); VN235 (D88467). Somali isolates: SOM1 (AF216786); SOM2 (AF216787); SOM3 (AF216788).
NS5b region.
Clade 1: HC-G9 (D14197); YS117 (D14196); Td34/92 (D26389); T1801 (L23439); US17 (L23438); 4TY4 (L23447). Clade 2: HC-J5 (D10076); SAC640 (L23448); T104 (L23450); NE92 (L29634); ARG8 (L23458); T983 (L23460); HCV-K2B (D10649). Clade 3: NE048 (D16613); NE145 (D16619); NE274 (D16621); US114 (D14310); T-7 (D10079); HEM26 (D14312); T-1 (D10078); Eb-1 (D10130); T1787 (L23467); T-10 (D10081); NE137 (D16617); HCV-TR (D49374); NE125 (D16615); Td-35/93 (D37898); IND1751 (X91417); IND1452 (X91418); S. T. (D10585); JK030 (D49762); JK049 (D49764); JK055 (D49765); JK070 (D49767). Clade 4: CAM600 (L29590); GB358 (L29607); EG-13 (L23469); EG-19 (L23470); G22 (L29596); GB438 (L29611). Clade 5: BE96 (L29584); 34REV (L23474). Clade 6: VN787 (D87364); VN540 (D87361); VN998 (D30797); VN235 (D87354); VN506 (D87356); VN569 (D87362); BB9 (D28542); B4/92 (D28543); VN531 (D87359); VN530 (D87358); VN405 (D88468); VN085 (D87353); VN004 (D87352). Somali isolates: SOM1 (AF216789); SOM2 (AF216790); SOM3 (AF216791).
| Results |
|---|
|
|
|---|
|
|
Sequence analysis of the core and E1 regions
As far as the core region is concerned, FASTA analysis showed that isolate QC29 (Bernier et al., 1996
) had the highest sequence similarity with the three Somali isolates, 95% similarity with SOM1 and SOM3, and 96% similarity with SOM2. The second highest level of similarity was with isolate JK049 (Tokita et al., 1996
), 87% with SOM1 and SOM3, and 86% with SOM2. As quoted above, isolate QC29 was found in another Somali patient in Montreal, Canada, but its genotype assignment was withheld pending acquisition of further sequence data and the identification of additional isolates (D. Murphy, personal communication). JK049 is an isolate from Jakarta, Indonesia, initially referred to as belonging to a new genetic group named 10a (Tokita et al., 1996
) and later assigned to a distinct subtype within clade 3 (Mizokami et al., 1996
; Simmonds et al., 1996
; de Lamballerie et al., 1997
; Robertson et al., 1998
). Phylogenetic analysis showed that our three Somali isolates, together with isolate QC29, form a distinct cluster within clade 3 (Fig. 3a
), and bootstrap values of 100% over 1000 replicates, assigned to this cluster, support this grouping. The tree indicates a close relatedness with the group formerly referred to as type 10a mentioned above. Phylogenetic analysis performed within clade 3 only (Fig. 3b
) confirms the degree of relatedness between different subtypes and the separate branching of the Somali isolates, with bootstrap values of 100% over 1000 replicates.
|
|
|
| Discussion |
|---|
|
|
|---|
HCV clade 3, together with clade 6, includes a great number of subtypes characterized by extensive sequence variability. Most recently discovered HCV (sub)types have been in fact assigned to those two clades, such as genotypes 7, 8, 9 and 11 (assigned to clade 6) and genotype 10 (assigned to clade 3). The close phylogenetic relatedness of the three present Somali isolates with HCV sequences found in geographically distant areas, such as the Indian subcontinent (Tokita et al., 1994b
; Valliammai et al., 1995
; Panigrahi et al., 1996
) or Indonesia (Tokita et al., 1996
; Hotta et al., 1994
) is puzzling. However, an Indian minority is present in major coastal cities of East African countries, including Somalia, and HCV could have originated from this source and spread to the indigenous Somali population, possibly via nosocomial or traditional medical procedures. Due to the sequence divergence, we postulate that branching of subtype 3h from an ancestor common to other Indian/Indonesian subtypes may have occurred a long time ago, but the exact modalities (i.e. where, when and how) which led to the differentiation of the Somali subtype can only be the object of speculation, until more sequences from these areas are available for study. However, we cannot exclude the possibility that the close relatedness of subtype 3h with type 10a is only apparent, since it was based on sequence analysis of the core and E1 regions, but not the NS5b region. Subtype 3h may in fact form an intermediate genetic group (like 10a) between another clade 3 subtype and another HCV clade further sequence data may confirm or dismiss this hypothesis. Pending the availability of more complete sequence data, the evolution of virus subtypes within clade 3 may follow unexpected routes, making every speculation premature at the present time.
We are fully aware that a definitive subtype assignment of novel HCV sequences may only be based on full genomic sequencing. In fact, the minimal length of the subgenomic fragments sufficient to correctly classify new HCV (sub)types is controversial. Different studies have been performed on part or complete nucleotide sequences of the core-encoding region (Mellor et al., 1995
; Panigrahi et al., 1996
; Bukh et al., 1994
), the E1 region (Bukh et al., 1993
; Simmonds et al., 1994
), the NS4 region (Bhattacherjee et al., 1995
) and various lengths of nucleotide fragments within the NS5b-encoding region (Simmonds et al., 1993
, 1994
; Apichartpiyakul et al., 1994
; Valliammai et al., 1995
; Mellor et al., 1995
). However, other authors have suggested that a precise classification may require analysis of longer fragments (Stuyver et al., 1994
), if not analysis of the complete genome sequence (Tokita et al., 1994a
). Sequence similarity or evolutionary distance analyses have yielded identical results, namely the existence of six different groupings; these are irrespective of the region being analysed. The major determinant is the number and the representativity of the sequences considered, rather than the choice of more accurate subgenomic regions for the classification of HCV genotypes (Mellor et al., 1995
). In keeping with this assumption, and following the aforementioned guidelines (Robertson et al., 1998
), we restrained our present analysis to the three subgenomic regions encoding the core, E1 and (partially) NS5b proteins, pending further sequence data. Incidentally, the drawing of the HCV clade 3 phylogenetic tree underscores a certain degree of confusion in the nomenclature of the subtypes reported so far, and underlines the need for a proper reclassification based on stringent and homogeneous criteria.
Finally, we are concerned about the failure to correctly identify the virus genotype in all three cases by conventional typing assays. A single mutation at position 204 within the 5' UTR shifted the type assignment (by the line-probe assay) from genotype 5a (SOM1 and SOM3) to 1b (SOM2). When we performed the sequence analysis, it turned out that none of isolates had been correctly typed. Moreover, RFLP analysis gave a unique restriction pattern, common to all three isolates, which was incompatible with the HCV sequences reported in the literature. Correct virus genotyping has proven to be critical for determining optimal treatment duration (Poynard et al., 1998
) and may also be important when interpreting anatomo-clinical correlations (Rubbia-Brandt et al., 2000
). We did not test the Somali sera with other assays, such as the serotyping assay (commercially unavailable in Switzerland), although it may be worth trying. For the sake of cost and simplicity, we favoured RFLP analysis, since, in case of dubious results, it leads directly towards a direct sequencing analysis, which is the gold standard procedure for HCV genotyping (Gretch, 1997
). In this respect, the impossibility of assigning a virus type (as with RFLP) is obviously better than a wrong assignment (as was the case with the line-probe assay). For future reference, the unique restriction pattern of subtype 3h may help to identify this subtype in other patients. Further work is however needed to confirm and extend our above findings, as well as to clarify the phylogenetic history of this novel HCV subtype from Somalia.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bedossa, P. & Poynard, T. (1996). An algorithm for the grading of activity in chronic hepatitis C. The METAVIR Cooperative Study Group.Hepatology 24, 289-293.[Medline]
Bernier, L., Willems, B., Delage, G. & Murphy, D. G. (1996). Identification of numerous hepatitis C virus genotypes in Montreal, Canada.Journal of Clinical Microbiology 34, 2815-2818.[Abstract]
Bhattacherjee, V., Prescott, L. E., Pike, I., Rodgers, B., Bell, H., El-Zayadi, A. R., Kew, M. C., Conradie, J., Lin, C. K., Marsden, H., Saeed, A. A., Parker, D., Yap, P.-L. & Simmonds, P. (1995). Use of NS-4 peptides to identify type-specific antibody to hepatitis C virus genotypes 1, 2, 3, 4, 5 and 6.Journal of General Virology 76, 1737-1748.
Bukh, J., Purcell, R. H. & Miller, R. H. (1993). At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative E1 gene of isolates collected worldwide.Proceedings of the National Academy of Sciences, USA 90, 8234-8238.
Bukh, J., Purcell, R. H. & Miller, R. H. (1994). Sequence analysis of the core gene of 14 hepatitis C virus genotypes.Proceedings of the National Academy of Sciences, USA 91, 8239-8243.
Cha, T. A., Beall, E., Irvine, B., Kolberg, J., Chien, D., Kuo, G. & Urdea, M. S. (1992). At least five related, but distinct, hepatitis C viral genotypes exist.Proceedings of the National Academy of Sciences, USA 89, 7144-7148.
Chayama, K., Tsubota, A., Koida, I., Arase, Y., Saitoh, S., Ikeda, K. & Kumada, H. (1994). Nucleotide sequence of hepatitis C virus (type 3b) isolated from a Japanese patient with chronic hepatitis C.Journal of General Virology 75, 3623-3628.
Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Analytical Biochemistry 162, 156-159.[Medline]
Choo, Q. L., Richman, K. H., Han, J. H., Berger, K., Lee, C., Dong, C., Gallegos, C., Coit, D., Medina-Selby, R., Barr, P. J., Weiner, A., Bradley, D. W., Kuo, G. & Houghton, M. (1991). Genetic organization and diversity of the hepatitis C virus.Proceedings of the National Academy of Sciences, USA 15, 2451-2455.
Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering.Nucleic Acids Research 16, 10881-10890.
Davidson, F. & Simmonds, P. (1998). Determination of HCV genotypes by RFLP. In Hepatitis C Protocols, pp. 175-181. Edited by J. Y.-N. Lau. Totowa, NJ: Humana Press.
Davidson, F., Simmonds, P., Ferguson, J. C., Jarvis, L. M., Dow, B. C., Follett, E. A. C., Seed, C. R. G., Krusius, T., Lin, C., Medgyesi, G. A., Kiyokawa, H., Olim, G., Duraisamy, G., Cuypers, T., Saeed, A. A., Teo, D., Conradie, J., Kew, M. C., Lin, M., Nuchaprayoon, C., Ndimbie, O. K. & Yap, P. L. (1995). Survey of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5' non-coding region.Journal of General Virology 76, 1197-1204.
de Lamballerie, X., Charrel, R. N., Attoui, H. & De Micco, P. (1997). Classification of hepatitis C virus variants in six major types based on analysis of the envelope 1 and nonstructural 5B genome regions and complete polyprotein sequences.Journal of General Virology 78, 45-51.[Abstract]
Felsenstein, J. (1993). PHYLIP inference package version 3.5. University of Washington, Seattle: Department of Genetics.
Gretch, D. R. (1997). Diagnostic tests for hepatitis C.Hepatology 26, 43S-47S.[Medline]
Hotta, H., Handajani, R., Lusida, M. I., Soemarto, W., Doi, H., Miyajima, H. & Homma, M. (1994). Subtype analysis of hepatitis C virus in Indonesia on the basis of NS5b region sequences.Journal of Clinical Microbiology 32, 3049-3051.
Inchauspe, G., Zebedee, S., Lee, D. H., Sugitani, M., Nasoff, M. & Prince, A. M. (1991). Genomic structure of the human prototype strain H of hepatitis C virus: comparison with American and Japanese isolates.Proceedings of the National Academy of Sciences, USA 88, 10292-10296.
McHutchison, J. G., Gordon, S. C., Schiff, E. R., Shiffman, M. L., Lee, W. M., Rustgi, V. K., Goodman, Z. D., Ling, M. H., Cort, S. & Albrecht, J. K. (1998). Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. Hepatitis Interventional Therapy Group.New England Journal of Medicine 339, 1485-1492.
Mellor, J., Holmes, E. C., Jarvis, L. M., Yap, P. L., Simmonds, P. & The International HCV Collaborative Study Group (1995). Investigation of the pattern of hepatitis C virus sequence diversity in different geographical regions: implications for virus classification. Journal of General Virology 76, 24932507.
Mizokami, M., Gojobori, T., Ohba, K., Ikeo, K., Ge, X. M., Ohno, T., Orito, E. & Lau, J. Y. (1996). Hepatitis C virus types 7, 8 and 9 should be classified as type 6 subtypes.Journal of Hepatology 24, 622-624.[Medline]
Okamoto, H., Sugiyama, Y., Okada, S., Kurai, K., Akahane, Y., Sugai, Y., Tanaka, T., Sato, K., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1992). Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources.Journal of General Virology 73, 673-679.
Panigrahi, A. K., Roca, J., Acharya, S. K., Jameel, S. & Panda, S. K. (1996). Genotype determination of hepatitis C virus from Northern India: identification of a new subtype.Journal of Medical Virology 48, 191-198.[Medline]
Poynard, T., Marcellin, P., Lee, S. S., Niederau, C., Minuk, G. S., Ideo, G., Bain, V., Heathcote, J., Zeuzem, S., Trepo, C. & Albrecht, J. (1998). Randomised trial of interferon alpha2b plus ribavirin for 48 weeks or for 24 weeks versus interferon alpha2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group.Lancet 352, 1426-1432.[Medline]
Robertson, B., Myers, G., Howard, C., Brettin, T., Bukh, J., Gaschen, B., Gojobori, T., Maertens, G., Mizokami, M., Nainan, O., Netesov, S., Nishioka, K., Shin-I, T., Simmonds, P., Smith, D., Stuyver, L. & Weiner, A. (1998). Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses: proposals for standardization.Archives of Virology 143, 2493-2503.[Medline]
Rubbia-Brandt, L., Quadri, R., Abid, K., Giostra, E., Male, P.-J., Mentha, G., Spahr, L., Zarski, J.-P., Borisch, B., Hadengue, A. & Negro, F. (2000). Hepatocyte steatosis is a cytopathic effect of hepatitis C virus genotype 3. Journal of Hepatology (in press).
Simmonds, P., Holmes, E. C., Cha, T.-A., Chan, S.-W., McOmish, F., Irvine, B., Beall, E., Yap, P. L., Kolberg, J. & Urdea, M. S. (1993). Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region.Journal of General Virology 74, 2391-2399.
Simmonds, P., Smith, D. B., McOmish, F., Yap, P. L., Kolberg, J., Urdea, M. S. & Holmes, E. C. (1994). Identification of genotypes of hepatitis C virus by sequence comparison in the core, E1 and NS-5 region.Journal of General Virology 75, 1053-1061.
Simmonds, P., Mellor, J., Sakuldamrongpanich, T., Nuchaprayoon, C., Tanprasert, S., Holmes, E. C. & Smith, D. B. (1996). Evolutionary analysis of variants of hepatitis C virus found in South-East Asia: comparison with classifications based upon sequence similarity.Journal of General Virology 77, 3013-3024.
Stuyver, l., Vanarherm, W., Wyseur, A., Hernandez, F., Delaporte, E. & Maertens, G. (1994). Classification of hepatitis C virus based on phylogenetic analysis of the envelope 1 and nonstructural 5b regions and identification of five additional subtypes.Proceedings of the National Academy of Sciences, USA 91, 10134-10138.
Tokita, H., Okamoto, H., Tsuda, F., Song, P., Nakata, S., Chosa, T., Iizuka, H., Mishiro, S., Miyakawa, Y. & Mayumi, M. (1994 a). Hepatitis C virus variants from Vietnam are classifiable into the seventh, eight and ninth major groups.Proceedings of the National Academy of Sciences, USA 91, 11022-11026.
Tokita, H., Shrestha, S. M., Okamoto, H., Sakamoto, M., Horikita, M., Iizuka, H., Shrestha, S., Miyakawa, Y. & Mayumi, M. (1994b). Hepatitis C virus variants from Nepal with novel genotypes and their classification into the third major group.Journal of General Virology 75, 931-936.
Tokita, H., Okamoto, H., Luengrojanakul, P., Vareesangthip, K., Chainuvati, T., Iizuka, H., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1995). Hepatitis C virus variants from Thailand classifiable into five novel genotypes in the sixth (6b), seventh (7c, 7d) and ninth (9b, 9c) major genetic groups.Journal of General Virology 76, 2329-2335.
Tokita, H., Okamoto, H., Iizuka, H., Kishimoto, J., Tsuda, F., Lesmana, L. A., Miyakawa, Y. & Mayumi, M. (1996). Hepatitis C virus variants from Jakarta, Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth (10a) and eleventh (11a) genetic groups.Journal of General Virology 77, 293-301.
Valliammai, T., Thyagarajan, S. P., Zuckerman, A. J. & Harrison, T. J. (1995). Diversity of genotypes of hepatitis C virus in southern India.Journal of General Virology 76, 711-716.
Received 22 December 1999;
accepted 29 February 2000.
This article has been cited by other articles:
![]() |
J.-F. Cantaloube, P. Gallian, H. Attoui, P. Biagini, P. De Micco, and X. de Lamballerie Genotype Distribution and Molecular Epidemiology of Hepatitis C Virus in Blood Donors from Southeast France J. Clin. Microbiol., August 1, 2005; 43(8): 3624 - 3629. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Corbet, J. Bukh, A. Heinsen, and A. Fomsgaard Hepatitis C Virus Subtyping by a Core-Envelope 1-Based Reverse Transcriptase PCR Assay with Sequencing and Its Use in Determining Subtype Distribution among Danish Patients J. Clin. Microbiol., March 1, 2003; 41(3): 1091 - 1100. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |