|
|
||||||||
Animal: DNA Viruses |
Department of Medicine, University of Cambridge, Level 5, Addenbrookes Hospital, Hills Road, Cambridge CB2 2QQ, UK1
Cardiff School of Biosciences, University of Cardiff, Cardiff, UK2
Author for correspondence: John Sinclair. Fax +44 1223 336846. e-mail js{at}mole.bio.cam.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
(Boldogh et al., 1990
It was reported several years ago that HCMV infection results in stimulation of cellular DNA synthesis (Albrecht et al., 1976
), implying overriding of normal cell cycle control. This effect has been studied recently in greater detail in quiescent fibroblast cells that have been withdrawn reversibly from the cell cycle by serum deprivation or contact inhibition (Bresnahan et al., 1996
; Dittmer & Mocarski, 1997
; Jault et al., 1995
; Morin et al., 1996
; Poma et al., 1996
). In these analyses, infection resulted in cell cycle progression through G1 leading eventually to an arrest of the cell cycle in either late G1 or G2/M (Bresnahan et al., 1996
; Dittmer & Mocarski, 1997
; Jault et al., 1995
; Morin et al., 1996
; Poma et al., 1996
; Wiebusch & Hagemeier, 1999
). Also, in cycling cells, it has been reported that HCMV may block the cell cycle at multiple points, depending on the stage of the cell cycle at which infection occurred (Lu & Shenk, 1996
; Salvant et al., 1998
). To date, all studies on the effects of HCMV infection on the cell cycle of arrested cells have been carried out in quiescent primary fibroblasts. However, in vitro and in vivo, there is good evidence that permissiveness for HCMV infection in a number of cell types is dependent on terminal differentiation (Sinclair & Sissons, 1996
; Soderberg-Naucler et al., 1997
) and terminal differentiation essentially blocks cells in the G0/early G1 phase of the cell cycle (el-Deiry et al., 1995
). So far, there have been no reports analysing the effect of HCMV infection on cells withdrawn irreversibly from the cell cycle by differentiation, a cell type that clearly plays an important role in vivo in HCMV infection (Sinclair & Sissons, 1996
; Soderberg-Naucler et al., 1997
).
Progression through the cell cycle is regulated by cyclins and their associated cyclin-dependent kinases (Cdks). Cdks are only active when complexed with their particular cyclin partner (Cordon-Cardo, 1995
; Pines, 1993
; Sherr, 1993
) and progression through the cell cycle occurs as a result of phosphorylation by Cdks of specific substrate molecules such as the retinoblastoma-susceptibility protein Rb. This in turn results in a specific sequence of cellular events related to the particular stage of the cell cycle. However, although formation of a cyclinCdk complex is a requirement, kinase activity does not simply follow cyclin levels. Other regulatory steps are also involved; these include activation of the cyclinCdk complex by phosphorylation and de-phosphorylation of specific sites on Cdks or inhibition by interaction with so-called Cdk inhibitors such as p21Cip1, p16Ink4 and p27Kip1 (Cordon-Cardo, 1995
; Pines, 1993
; Sherr, 1993
). Generally, high levels of Cdk activity are indicative of cell cycle progression, while terminally differentiated or quiescent cells have low levels of Cdk activity and elevated levels of mitotic inhibitors.
In recent years, it has become clear that many viral oncoproteins act by targetting cell cycle regulatory factors (DeCaprio et al., 1988
; Whyte et al., 1988
). For instance, adenovirus E1A can induce cell cycle progression in G0-arrested cells that have withdrawn from the cell cycle as a result of serum-deprivation or differentiation (Crescenzi et al., 1995
; Rao et al., 1992
; Stein et al., 1990
). In these arrested cells, Rb is hypophosphorylated and, in this underphosphorylated form, Rb binds and inactivates the cellular transcription factor E2F. As E2F activates expression of a number of S phase genes, Rb plays a major role in repressing gene expression associated with the S phase of the cell cycle. Induction of cell cycle progression by E1A is believed, in part, to be due to the fact that E1A interacts physically with members of the Rb family of proteins (Hu et al., 1990
; Whyte et al., 1989
). This results in a release of functional E2F transcription factor, which would normally be kept in an inactive form by interaction with Rb family proteins during G0. This release of E2F then results in the expression of E2F-dependent S phase genes. More recently, it has also been reported that, as well as targetting Rb directly to release active E2F, adenovirus E1A can interact directly with Cdk inhibitors, such as p27Kip1, resulting in p27Kip1 inactivation and Rb phosphorylation, which can overcome TGF-
-mediated cell cycle arrest (Mal et al., 1996b
). Similarly, human papillomavirus (HPV) E7 has been shown to prevent inhibition of Cdk activity by both p21Cip1 and p27Kip1 (Funk et al., 1997
; Keblusek et al., 1999
; Zerfass-Thome et al., 1996
).
We and others have reported previously that E1A and IE86 have a number of properties in common. For instance, IE86 is also known to interact physically and functionally with Rb and p53 (Hagemeier et al., 1994
; Muganda et al., 1994
; Poma et al., 1996
; Sommer et al., 1994
; Speir et al., 1994
) in an manner analogous to the known interaction of adenovirus E1A with Rb. As discussed above, such interactions would be consistent with inducing progression through G1 into early S phase. Consequently, we have asked what effect HCMV infection has on cells that have withdrawn irreversibly from the cell cycle due to differentiation and, if HCMV does advance the cell cycle in these cells, whether IE86 plays a similar role to E1A in targetting inhibitors of Cdks. Here, we show that, in cells arrested irreversibly in G0 as a result of terminal differentiation, HCMV is able to induce cell functions associated with progression of the cell cycle through G1 into early S phase and that this is correlated with a direct physical and functional interaction between the HCMV 86 kDa IE86 protein and the Cdk inhibitor p21Cip1.
| Methods |
|---|
|
|
|---|
Cell culture and virus infection.
Immunfluorescence.
MRC5 or T2+RA cells were infected with HCMV for 24, 48, 72 and 96 h. Cells were fixed in 4% paraformaldehyde for 15 min, permeabilized in 70% ethanol at -20 °C and then stained with mouse monoclonal antibodies to UL69 (Winkler et al., 1994
), a 55 kDa viral late protein (Chemicon) or IE72 (Biosys). Antibodies were detected by using anti-mouse FITC conjugate.
Analysis of DNA content.
Infected or uninfected cells were fixed in 70% ice-cold ethanol, treated briefly with RNase and stained with propidium iodide (PI) as described previously (Poma et al., 1996
).
Infected or uninfected cells were also treated for 24 h with 10 µM 5-bromo-2'-deoxyuridine (BrdU) at 24 h post-infection (p.i.). Cells were then harvested and total DNA was isolated. DNA was restricted with SmaI and separated on 0·6% agarose gels and DNA fragments were transferred to nitrocellulose by blotting. Blots were then probed with a monoclonal antibody to BrdU (Harlan Sera Laboratories) and antibody was detected by chemiluminescence with an ECL detection kit, as detailed by the manufacturer (Amersham).
Western blotting.
Infected or uninfected cells were harvested by scraping, washed once in ice-cold PBS and resuspended in SDSPAGE sample buffer. Protein samples were separated on 10 or 15% polyacrylamide gels, blotted onto nitrocellulose and probed with monoclonal antibodies to Rb protein (Santa Cruz) or a monoclonal antibody that recognizes exon 2 of the HCMV IE72 and IE86 proteins (Hayhurst et al., 1995
).
GST-fusion proteins.
pGEX-3X.IE2, used to generate recombinant IE86 protein, has been described previously (Caswell et al., 1993
). pGST-p21, p-GST-p21N and pGST-p21C were gifts of A. Dutta and have also been described previously (Chen et al., 1996
). GSTp27kip1 was a gift of Tony Hunter (Mal et al., 1996b
). Recombinant GST or GST-fusion proteins were purified by using glutathioneSepharose beads and eluted with glutathione (Smith & Johnson, 1988
).
GST-fusion protein interaction assays.
Proteinprotein interaction assays were carried out exactly as described previously (Caswell et al., 1993
). Vectors to generate [35S]methionine-labelled IE72, IE86, gelsolin and E1A (13S) by coupled in vitro transcription/translation (Promega) have also been described previously (Caswell et al., 1993
).
Immunoprecipitations and histone H1 kinase assays.
Total cellular extracts were prepared from undifferentiated or differentiated cells in EBC buffer as described previously (Hagemeier et al., 1994
). Extracts were immunoprecipitated for 23 h at 4 °C with anti-Cdk2, anti-CdK4, anti-cyclin E or anti-cyclin A antibodies (Santa Cruz) followed by incubation at 4 °C for 1 h with protein ASepharose (Pharmacia). Immunoprecipitates were then assayed for their kinase activity by using histone H1 as substrate, essentially as described previously (Mal et al., 1996b
).
Yeast two-hybrid interaction assay.
Experiments were carried out using the Matchmaker yeast two-hybrid system (Clontech) with expression vectors that had been modified in the multiple cloning site. Plasmid pGAD424 was digested with EcoRI and BamHI and then ligated with a double-stranded adaptor of sequence 5' AATTTGGGATCCCCGGGAATTC 3' (sense strand) and 5' GATCGAATTCCCGGGGATCCCA 3' (antisense strand). The recombinant plasmid, pGAD425, was then digested with BamHI and EcoRI and ligated with a BamHIEcoRI IE2 cDNA fragment from pGEX3X-IE2 (Caswell et al., 1993
) to generate pGAD-IE2. Similarly, pGAD-IE1 was made by cloning the BamHIEcoRI IE1 cDNA fragment from pGEX3X-IE1 (Caswell et al., 1993
) into pGAD425. The GAL4 DNA-binding domainp21 fusion was made by digestion of pGST-p21 (Chen et al., 1996
) with BamHI and SalI and cloning of the p21 cDNA fragment into the BamHI and SalI sites of pGBT10, which has been described previously (Caswell et al., 1996
). pGBT10-IE86 has also been described previously (Caswell et al., 1996
). Other plasmids used were supplied with the Matchmaker kit. Yeast transformations and quantitative liquid
-galactosidase assays were carried out in Saccharomyces cerevisiae strain SFY526 exactly as described by the manufacturers of the kit.
| Results |
|---|
|
|
|---|
|
In order to rule out that this apparent increase in cells in S phase was due to viral DNA replication, we examined the extent of viral DNA replication directly in infected T2+RA cells at 48 h p.i. Fig. 2
shows that primary fibroblast cells (MRC5) infected for 48 h with HCMV and labelled with BrdU gave rise to specific viral DNA restriction fragments when analysed by Southern blot detection for BrdU-labelled DNA with an anti-BrdU antibody. This confirms high levels of viral DNA replication in these fibroblast cells, as expected. In contrast, however, T2+RA cells showed no such viral DNA replication at 2448 h p.i., consistent with the known extended virus life cycle in these cells (Gonczol et al., 1984
). Consequently, the increase in DNA content of T2+RA cells upon infection with HCMV at 48 h p.i. cannot be attributed to viral DNA synthesis.
|
|
|
Fig. 5
confirms the known reduction in cyclin-associated kinases that occurs upon differentiation of T2 cells with RA (Spinella et al., 1999
; Maerz et al., 1998
). As expected, differentiation led to a decrease in Cdk2 activity, which is consistent with the Go/G1 arrest of these cells (Fig. 5a
, lane 2). Similarly, cyclin E-associated kinase activity (Fig. 5b
, lane 2) as well as Cdk4 and cyclin A-associated kinase activity (Fig. 5c
and d
, respectively; lanes 2) were also reduced in differentiated T2+RA cells, as expected. However, infection with HCMV resulted in a clear increase in functional Cdk2 and cyclin E-associated kinase activity (Fig. 5a
and b
, respectively; lanes 3) as early as 17 h p.i., consistent with cell cycle progression through the G1/S checkpoint. This high level of Cdk2 and cyclin E-associated kinase activity was maintained through the initial 48 h of virus infection.
|
As expected, we have observed that infection of T2+RA cells with HCMV resulted in Cdk4-associated kinase activity that phosphorylated a GSTRb target as early as 17 h p.i. (data not shown). Interestingly, an increase in Cdk4 activity targetting histone H1 also appeared to be induced by HCMV infection (Fig. 5c
), although this induction was only observed at 48 h p.i. We are aware that Cdk4 is not normally associated with H1 kinase activity. We do not know why the immunoprecipitated Cdk4 complex is able to phosphorylate histone H1 at this time of infection. It is possible that a viral product or virus-induced product is able to target Cdk4 during infection, allowing this complex to re-target kinase activity.
HCMV IE86 binds p21Cip1 in vitro
Two classes of inhibitors of cyclinCdks are present in multicellular organisms, the INK family, which includes p15 and p16, and a second family of proteins that includes p21Cip1 and p27Kip1. p27Kip1 and p21Cip1 inhibitors are known to interact with and inhibit Cdk2, Cdk4 and Cdk6, whereas the INK family of inhibitors has no effect on Cdk2 (Pines, 1993
; Sherr, 1993
).
Recently, it has been shown that TGF-
-mediated arrest of mink lung cells in late G1, which is due to inactivation of cyclinCdk complexes by the p27Kip1 inhibitor, can be reversed by adenovirus 12S E1A protein, resulting in cell cycle progression (Mal et al., 1996b
). This reversal of Cdk inhibition has been shown to be mediated by a direct interaction between E1A and p27Kip1 proteins, whereby E1A prevents p27Kip1 from inhibiting the cyclinCdk2 complex. As we and others have shown a number of functional similarities between adenovirus E1A and HCMV IE86, we asked whether IE86 could also interact physically with cyclinCdk inhibitors. We carried out proteinprotein interaction assays with GSTp21 fusion proteins as bait for [35S]methionine-labelled proteins. Fig. 6(a)
shows that, in contrast to adenovirus 12S E1A, which has been shown to interact specifically with p27Kip1 (Mal et al., 1996b
), IE86 interacted specifically with GSTp21 (lane 3) but not with GSTp27 or an additional negative control, GSTIE1. In contrast, experiments using in vitro transcribed and translated cyclin A or Cdk2 showed clear specific binding to both GSTp27 and GSTp21, as expected (data not shown). We observed no such interaction between GSTp21 and a number of negative-control proteins such as gelsolin or HCMV IE1 (lanes 1 and 4, respectively). Interestingly, in our experiments, in which adenovirus 13S E1A protein was used as a positive control, we observed a specific interaction between 13S E1A and GSTp21, but not GSTp27 (lane 2). We observed no interaction between IE86 and GSTp16 (data not shown).
|
IE86 interacts with p21Cip1 in vivo
In order to confirm that the physical interaction between IE86 and p21Cip1 that we observed in vitro also occurred in vivo and that this did not depend upon any other mammalian protein, we analysed the interaction between IE86 and p21Cip1 in a yeast two-hybrid assay. Fig. 7
shows that a two-hybrid system in which full-length IE86 was fused to the GAL4 activation domain and full-length p21 was fused to the GAL4 DNA-binding domain (p21/IE2) resulted consistently in activated
-galactosidase expression. No such activation was observed with a comprehensive panel of controls.
|
|
| Discussion |
|---|
|
|
|---|
HCMV infection of these irreversibly arrested cells induces cell cycle progression through the G1/S phase checkpoint, into early S phase. This occurs as early as 48 h p.i. and is not attributable to viral DNA replication, as the virus life cycle is extended in T2+RA cells and no viral DNA replication could be detected at the time of this advance in cell cycle progression. These T2+RA cells also underwent full productive infection, as determined by the detection of viral DNA replication centres and late viral gene expression.
We also confirmed that, at low m.o.i. at which only 1020% of the cell population was infected with HCMV, induction through the G0/G1 checkpoint correlated with IE expression. This also rules out that the induction occurs in bystander cells as a result of, for instance, mitogen or cytokine induction by virus.
We have analysed the increase in cellular DNA content induced by HCMV infection solely by PI staining and FACS analysis for specific reasons. Recently, Morin et al. (1996)
have shown that HCMV encodes functions that prevent cellular thymidine salvage and that channel exogenous thymidine exclusively into viral DNA. Consequently, the use of thymidine incorporation to analyse cellular DNA synthesis during virus infection is clearly problematic. Similarly, it is established that virus-specific DNA synthesis inhibitors such as gancyclovir and phosphonoformate do have discernible effects on cellular DNA synthesis (Albert & Gudas, 1986
; Ilsley et al., 1995
; Sabourin et al., 1978
), and we have observed inhibition of serum-induced S phase entry of serum-deprived fibroblasts by gancyclovir at concentrations as low as 100 µg/ml (data not shown). Consequently, it may be difficult to interpret results when these drugs are used as a means of analysing cellular DNA synthesis in the absence of viral DNA synthesis. Instead, in our experiments, we have used a cell line in which the HCMV life cycle is extended such that the induction of cell cycle progression through the G1/S phase checkpoint that we observe is quite clearly separated in time from viral DNA synthesis and cannot be attributed to an increase in viral DNA in the cell.
Consistent with observations from experiments using infection of reversibly arrested fibroblast cells (Bresnahan et al., 1996
; Jault et al., 1995
), HCMV infection of irreversibly arrested T2+RA cells resulted in increased Rb phosphorylation and the induction of Cdk2 and cyclin E-associated kinase activity. However, in contrast to observations in infected quiescent fibroblasts (Bresnahan et al., 1996
), we did observe clear induction of cyclin A-associated kinase activity by HCMV, consistent with the induction of the start of cellular DNA synthesis. All these observations are consistent with HCMV inducing cell cycle progression of arrested T2+RA cells through the G1 checkpoint into early S phase. Interestingly, a small but reproducible transient induction of Cdk4-associated kinase activity by HCMV was also observed.
The ability of adenovirus E1A to induce cell cycle progression through the G1/S phase checkpoint of the cell cycle has been shown to be mediated by a direct physical interaction between E1A and the Cdk inhibitor p27Kip1. This interaction prevents p27Kip1-mediated inhibition of cyclin-associated kinases (Mal et al., 1996b
). Because of the many functional similarities between HCMV IE86 and adenovirus E1A, we were prompted to look at whether IE86 could also interact physically with p27Kip1. In contrast to E1A, we observed no interaction between p27Kip1 and IE86. However, we did observe a strong physical interaction between IE86 and the p21Cip1 Cdk inhibitor. This interaction mapped to the N-terminal domain of p21Cip1. Interestingly, the N-terminal domain of p21Cip1 is known to contain domains for binding cyclins and Cdks (Chen et al., 1996
). Consequently, the ability of IE86 to contact p21Cip1 via these cyclin-/Cdk-binding domains would be consistent with the ability of IE86 to prevent p21Cip1 from interacting with cyclinCdk complexes. Although it has been shown that the E7 protein of HPV-16 can associate with p27Kip1 and prevent p27Kip1-mediated inhibition of cyclin E-associated kinase activity (Zerfass-Thome et al., 1996
), a direct functional interaction between E7 and p21Cip1 has also been described more recently (Martin et al., 1998
). In this study, Martin et al. (1998)
showed that the E7 protein of HPV-16 interacted directly with p21Cip1 and prevented p21Cip1-mediated inhibition of cyclin E-associated kinase in cells arrested by DNA damage, so inducing the cell cycle. In contrast to our observations for IE86, the interaction between E7 and p21Cip1 was mapped to the C-terminal PCNA-binding domain of p21Cip1, which resulted in E7 preventing p21Cip1-mediated inhibition of PCNA-dependent DNA replication (Martin et al., 1998
). Consequently, whilst E7 and IE86 both appear to target p21Cip1 in order to prevent Cdk inhibition, the exact mechanisms by which they achieve this appear not to be identical.
The domain of IE86 that interacts with p21Cip1 was also determined. Using GSTIE86 domain fusions, we mapped the p21Cip1 interaction domain of IE86 to the C terminus (amino acids 290579). This region of IE86 has already been shown to be important for the interaction between IE86 and a number of cellular proteins (Caswell et al., 1993
; Hagemeier et al., 1994
).
We confirmed a direct physical interaction between IE86 and p21Cip1 by using a yeast two-hybrid system. This analysis showed clearly that IE86 and p21Cip1 interacted directly in vivo and did not require interactions with any other mammalian protein.
Finally, this physical interaction between IE86 and p21Cip1 was reflected in the ability of purified IE86 protein to recover cyclin-associated kinase activity in arrested cells and to prevent inhibition of cyclin-associated kinases by recombinant p21Cip1. In these experiments, differentiated T2+RA cells regained cyclinCdk2 activity upon the addition of bacterially expressed IE86 in a dose-dependent manner. Similarly, inhibition of cyclinCdk2 activity resulting from addition of bacterially expressed p21Cip1 to extracts from cycling T2 cells was also overcome by the addition of recombinant IE86.
Recently, Wiebusch & Hagemeier (1999)
have shown that IE86 is able to block the cell cycle in permissive osteosarcoma cells in late G1, which is at odds with the apparent effect of virus-expressed IE86 in T2+RA cells. We have not tested the effect of expression of IE86 in isolation in T2+RA cells directly, as transient transfection of T2+RA cells by IE86 expression vectors in our hands results in substantial death of both bystander cells and cells expressing IE86 (data not shown).
Results from a number of laboratories have shown that infection with HCMV of quiescent fibroblast cells that have withdrawn reversibly from the cell cycle as a result of serum starvation or contact inhibition can lead to the induction of cell cycle progression, but that this progression appears to be arrested at G1. In contrast, we show here that, in cells that have withdrawn irreversibly from the cell cycle as a result of terminal differentiation, HCMV can overcome the known G1/S block in these cells. As HCMV infection of arrested cells does not lead to an increase in cell proliferation (data not shown), we presume that infected cells are blocked at a later stage in their cell cycle, as has been suggested for fibroblasts (Jault et al., 1995
; Lu & Shenk, 1996
). This is under investigation.
Our experiments point to a possible role for the IE86 protein in this induction of S phase, which may involve a direct physical and functional interaction between IE86 and the Cdk inhibitor p21Cip1. We presume that, in contrast to reversibly arrested quiescent fibroblasts, in cells arrested irreversibly by terminal differentiation, HCMV must target cellular functions involved in restriction of G1/S phase in order to optimize the cell for high levels of viral DNA replication. Whether this reflects a fundamental difference in the requirements of HCMV infection of irreversibly arrested versus quiescent cells awaits further analysis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Albrecht, T., Nachtigal, M., St Jeor, S. C. & Rapp, F. (1976). Induction of cellular DNA synthesis and increased mitotic activity in Syrian hamster embryo cells abortively infected with human cytomegalovirus.Journal of General Virology 30, 167-177.
Boldogh, I., AbuBakar, S. & Albrecht, T. (1990). Activation of proto-oncogenes: an immediate early event in human cytomegalovirus infection.Science 247, 561-564.
Bresnahan, W. A., Boldogh, I., Thompson, E. A. & Albrecht, T. (1996). Human cytomegalovirus inhibits cellular DNA synthesis and arrests productively infected cells in late G1.Virology 224, 150-160.[Medline]
Buchkovich, K., Duffy, L. A. & Harlow, E. (1989). The retinoblastoma protein is phosphorylated during specific phases of the cell cycle.Cell 58, 1097-1105.[Medline]
Caswell, R., Hagemeier, C., Chiou, C.-J., Hayward, G., Kouzarides, T. & Sinclair, J. (1993). The human cytomegalovirus 86K immediate early (IE) 2 protein requires the basic region of the TATA-box binding protein (TBP) for binding, and interacts with TBP and transcription factor TFIIB via regions of IE2 required for transcriptional regulation.Journal of General Virology 74, 2691-2698.
Caswell, R., Bryant, L. & Sinclair, J. (1996). Human cytomegalovirus immediate-early 2 (IE2) protein can transactivate the human hsp70 promoter by alleviation of Dr1-mediated repression.Journal of Virology 70, 4028-4037.[Abstract]
Chen, P. L., Scully, P., Shew, J. Y., Wang, J. Y. & Lee, W. H. (1989). Phosphorylation of the retinoblastoma gene product is modulated during the cell cycle and cellular differentiation.Cell 58, 1193-1198.[Medline]
Chen, J., Peters, R., Saha, P., Lee, P., Theodoras, A., Pagano, M., Wagner, G. & Dutta, A. (1996). A 39 amino acid fragment of the cell cycle regulator p21 is sufficient to bind PCNA and partially inhibit DNA replication in vivo.Nucleic Acids Research 24, 1727-1733.
Cherrington, J. M. & Mocarski, E. S. (1989). Human cytomegalovirus ie1 transactivates the alpha promoter-enhancer via an 18-base-pair repeat element.Journal of Virology 63, 1435-1440.
Cherrington, J. M., Khoury, E. L. & Mocarski, E. S. (1991). Human cytomegalovirus ie2 negatively regulates alpha gene expression via a short target sequence near the transcription start site.Journal of Virology 65, 887-896.
Colberg-Poley, A. M., Santomenna, L. D., Harlow, P. P., Benfield, P. A. & Tenney, D. J. (1992). Human cytomegalovirus US3 and UL3638 immediate-early proteins regulate gene expression.Journal of Virology 66, 95-105.
Cordon-Cardo, C. (1995). Mutations of cell cycle regulators. Biological and clinical implications for human neoplasia.American Journal of Pathology 147, 545-560.[Abstract]
Crescenzi, M., Soddu, S. & Tato, F. (1995). Mitotic cycle reactivation in terminally differentiated cells by adenovirus infection.Journal of Cellular Physiology 162, 26-35.[Medline]
DeCaprio, J. A., Ludlow, J. W., Figge, J., Shew, J. Y., Huang, C. M., Lee, W. H., Marsilio, E., Paucha, E. & Livingston, D. M. (1988). SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene.Cell 54, 275-283.[Medline]
DeCaprio, J. A., Furukawa, Y., Ajchenbaum, F., Griffin, J. D. & Livingston, D. M. (1992). The retinoblastoma-susceptibility gene product becomes phosphorylated in multiple stages during cell cycle entry and progression.Proceedings of the National Academy of Sciences, USA 89, 1795-1798.
Dittmer, D. & Mocarski, E. S. (1997). Human cytomegalovirus infection inhibits G1/S transition.Journal of Virology 71, 1629-1634.[Abstract]
el-Deiry, W. S., Tokino, T., Waldman, T., Oliner, J. D., Velculescu, V. E., Burrell, M., Hill, D. E., Healy, E., Rees, J. L., Hamilton, S. R. and others (1995). Topological control of p21WAF1/CIP1 expression in normal and neoplastic tissues. Cancer Research 55, 29102919.
Funk, J. O., Waga, S., Harry, J. B., Espling, E., Stillman, B. & Galloway, D. A. (1997). Inhibition of CDK activity and PCNA-dependent DNA replication by p21 is blocked by interaction with the HPV-16 E7 oncoprotein.Genes & Development 11, 2090-2100.
Geist, L. J. & Dai, L. Y. (1996). Cytomegalovirus modulates interleukin-6 gene expression.Transplantation 62, 653-658.[Medline]
Gonczol, E., Andrews, P. W. & Plotkin, S. A. (1984). Cytomegalovirus replicates in differentiated but not in undifferentiated human embryonal carcinoma cells.Science 224, 159-161.
Goodrich, D. W., Wang, N. P., Qian, Y. W., Lee, E. Y. & Lee, W. H. (1991). The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle.Cell 67, 293-302.[Medline]
Griffiths, P. D. & Grundy, J. E. (1988). The status of CMV as a human pathogen.Epidemiology and Infection 100, 1-15.[Medline]
Hagemeier, C., Walker, S., Caswell, R., Kouzarides, T. & Sinclair, J. (1992a). The human cytomegalovirus 80-kilodalton but not the 72-kilodalton immediate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID.Journal of Virology 66, 4452-4456.
Hagemeier, C., Walker, S. M., Sissons, P. J. G. & Sinclair, J. H. (1992b). The 72K IE1 and 80K IE2 proteins of human cytomegalovirus independently trans-activate the c-fos, c-myc and hsp70 promoters via basal promoter elements.Journal of General Virology 73, 2385-2393.
Hagemeier, C., Caswell, R., Hayhurst, G., Sinclair, J. & Kouzarides, T. (1994). Functional interaction between the HCMV IE2 transactivator and the retinoblastoma protein.EMBO Journal 13, 2897-2903.[Medline]
Harel, N. Y. & Alwine, J. C. (1998). Phosphorylation of the human cytomegalovirus 86-kilodalton immediate-early protein IE2.Journal of Virology 72, 5481-5492.
Hayhurst, G. P., Bryant, L. A., Caswell, R. C., Walker, S. M. & Sinclair, J. H. (1995). CCAAT box-dependent activation of the TATA-less human DNA polymerase alpha promoter by the human cytomegalovirus 72-kilodalton major immediate-early protein.Journal of Virology 69, 182-188.[Abstract]
Hinds, P. W., Mittnacht, S., Dulic, V., Arnold, A., Reed, S. I. & Weinberg, R. A. (1992). Regulation of retinoblastoma protein functions by ectopic expression of human cyclins.Cell 70, 993-1006.[Medline]
Hu, Q. J., Dyson, N. & Harlow, E. (1990). The regions of the retinoblastoma protein needed for binding to adenovirus E1A or SV40 large T antigen are common sites for mutations.EMBO Journal 9, 1147-1155.[Medline]
Ilsley, D. D., Lee, S. H., Miller, W. H. & Kuchta, R. D. (1995). Acyclic guanosine analogs inhibit DNA polymerases alpha, delta, and epsilon with very different potencies and have unique mechanisms of action.Biochemistry 34, 2504-2510.[Medline]
Jault, F. M., Jault, J. M., Ruchti, F., Fortunato, E. A., Clark, C., Corbeil, J., Richman, D. D. & Spector, D. H. (1995). Cytomegalovirus infection induces high levels of cyclins, phosphorylated Rb, and p53, leading to cell cycle arrest.Journal of Virology 69, 6697-6704.[Abstract]
Keblusek, P., Dorsman, J. C., Teunisse, A. F. A. S., Teunissen, H., van der Eb, A. J. & Zantema, A. (1999). The adenoviral E1A oncoproteins interfere with the growth-inhibiting effect of the cdk-inhibitor p21CIP1/WAF1.Journal of General Virology 80, 381-390.[Abstract]
Kothari, S., Baillie, J., Sissons, J. G. & Sinclair, J. H. (1991). The 21 bp repeat element of the human cytomegalovirus major immediate early enhancer is a negative regulator of gene expression in undifferentiated cells.Nucleic Acids Research 19, 1767-1771.
LaFemina, R. & Hayward, G. S. (1986). Constitutive and retinoic acid-inducible expression of cytomegalovirus immediate-early genes in human teratocarcinoma cells.Journal of Virology 58, 434-440.
Lu, M. & Shenk, T. (1996). Human cytomegalovirus infection inhibits cell cycle progression at multiple points, including the transition from G1 to S.Journal of Virology 70, 8850-8857.[Abstract]
Maerz, W. J., Baselga, J., Reuter, V. E., Mellado, B., Myers, M. L., Bosl, G. J., Spinella, M. J. & Dmitrovsky, E. (1998). FGF4 dissociates anti-tumorigenic from differentiation signals of retinoic acid in human embryonal carcinomas.Oncogene 17, 761-767.[Medline]
Mal, A., Piotrkowski, A. & Harter, M. L. (1996a). Cyclin-dependent kinases phosphorylate the adenovirus E1A protein, enhancing its ability to bind pRb and disrupt pRbE2F complexes.Journal of Virology 70, 2911-2921.[Abstract]
Mal, A., Poon, R. Y., Howe, P. H., Toyoshima, H., Hunter, T. & Harter, M. L. (1996b). Inactivation of p27Kip1 by the viral E1A oncoprotein in TGF
-treated cells.Nature 380, 262-265.[Medline]
Martin, L. G., Demers, G. W. & Galloway, D. A. (1998). Disruption of the G1/S transition in human papillomavirus type 16 E7-expressing human cells is associated with altered regulation of cyclin E.Journal of Virology 72, 975-985.
Monick, M. M., Geist, L. J., Stinski, M. F. & Hunninghake, G. W. (1992). The immediate early genes of human cytomegalovirus upregulate expression of the cellular genes myc and fos.American Journal of Respiratory Cell and Molecular Biology 7, 251-256.
Morin, J., Johann, S., OHara, B. & Gluzman, Y. (1996). Exogenous thymidine is preferentially incorporated into human cytomegalovirus DNA in infected human fibroblasts.Journal of Virology 70, 6402-6404.[Abstract]
Muganda, P., Mendoza, O., Hernandez, J. & Qian, Q. (1994). Human cytomegalovirus elevates levels of the cellular protein p53 in infected fibroblasts.Journal of Virology 68, 8028-8034.
Nelson, J. A. & Groudine, M. (1986). Transcriptional regulation of the human cytomegalovirus major immediate-early gene is associated with induction of DNase I-hypersensitive sites.Molecular and Cellular Biology 6, 452-461.
Pines, J. (1993). Cyclins and cyclin-dependent kinases: take your partners.Trends in Biochemical Sciences 18, 195-197.[Medline]
Pizzorno, M. C., OHare, P., Sha, L., LaFemina, R. L. & Hayward, G. S. (1988). Trans-activation and autoregulation of gene expression by the immediate-early region 2 gene products of human cytomegalovirus.Journal of Virology 62, 1167-1179.
Pizzorno, M. C., Mullen, M. A., Chang, Y. N. & Hayward, G. S. (1991). The functionally active IE2 immediate-early regulatory protein of human cytomegalovirus is an 80-kilodalton polypeptide that contains two distinct activator domains and a duplicated nuclear localization signal.Journal of Virology 65, 3839-3852.
Poma, E. E., Kowalik, T. F., Zhu, L., Sinclair, J. H. & Huang, E. S. (1996). The human cytomegalovirus IE1-72 protein interacts with the cellular p107 protein and relieves p107-mediated transcriptional repression of an E2F-responsive promoter.Journal of Virology 70, 7867-7877.[Abstract]
Rao, L., Debbas, M., Sabbatini, P., Hockenbery, D., Korsmeyer, S. & White, E. (1992). The adenovirus E1A proteins induce apoptosis, which is inhibited by the E1B 19-kDa and Bcl-2 proteins.Proceedings of the National Academy of Sciences, USA 89, 7742-7746.
Sabourin, C. L., Reno, J. M. & Boezi, J. A. (1978). Inhibition of eucaryotic DNA polymerases by phosphonoacetate and phosphonoformate.Archives of Biochemistry and Biophysics 187, 96-101.[Medline]
Salvant, B. S., Fortunato, E. A. & Spector, D. H. (1998). Cell cycle dysregulation by human cytomegalovirus: influence of the cell cycle phase at the time of infection and effects on cyclin transcription.Journal of Virology 72, 3729-3741.
Sarisky, R. T. & Hayward, G. S. (1996). Evidence that the UL84 gene product of human cytomegalovirus is essential for promoting oriLyt-dependent DNA replication and formation of replication compartments in cotransfection assays.Journal of Virology 70, 7398-7413.[Abstract]
Sherr, C. J. (1993). Mammalian G1 cyclins.Cell 73, 1059-1065.[Medline]
Sinclair, J. & Sissons, P. (1996). Latent and persistent infections of monocytes and macrophages.Intervirology 39, 293-301.[Medline]
Smith, D. B. & Johnson, K. S. (1988). Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.Gene 67, 31-40.[Medline]
Soderberg-Naucler, C., Fish, K. N. & Nelson, J. A. (1997). Reactivation of latent human cytomegalovirus by allogeneic stimulation of blood cells from healthy donors.Cell 91, 119-126.[Medline]
Sommer, M. H., Scully, A. L. & Spector, D. H. (1994). Transactivation by the human cytomegalovirus IE2 86-kilodalton protein requires a domain that binds to both the TATA box-binding protein and the retinoblastoma protein.Journal of Virology 68, 6223-6231.
Speir, E., Modali, R., Huang, E. S., Leon, M. B., Shawl, F., Finkel, T. & Epstein, S. E. (1994). Potential role of human cytomegalovirus and p53 interaction in coronary restenosis.Science 265, 391-394.
Spinella, M. J., Freemantle, S. J., Sekula, D., Chang, J. H., Christie, A. J. & Dmitrovsky, E. (1999). Retinoic acid promotes ubiquitination and proteolysis of cyclin D1 during induced tumor cell differentiation.Journal of Biological Chemistry 274, 22013-22018.
Stein, R. W., Corrigan, M., Yaciuk, P., Whelan, J. & Moran, E. (1990). Analysis of E1A-mediated growth regulation functions: binding of the 300-kilodalton cellular product correlates with E1A enhancer repression function and DNA synthesis-inducing activity.Journal of Virology 64, 4421-4427.
Stenberg, R. M., Depto, A. S., Fortney, J. & Nelson, J. A. (1989). Regulated expression of early and late RNAs and proteins from the human cytomegalovirus immediate-early gene region.Journal of Virology 63, 2699-2708.
Stenberg, R. M., Fortney, J., Barlow, S. W., Magrane, B. P., Nelson, J. A. & Ghazal, P. (1990). Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains.Journal of Virology 64, 1556-1565.
Stinski, M. F., Thomsen, D. R., Stenberg, R. M. & Goldstein, L. C. (1983). Organization and expression of the immediate early genes of human cytomegalovirus.Journal of Virology 46, 1-14.
Wade, M., Kowalik, T. F., Mudryj, M., Huang, E. S. & Azizkhan, J. C. (1992). E2F mediates dihydrofolate reductase promoter activation and multiprotein complex formation in human cytomegalovirus infection.Molecular and Cellular Biology 12, 4364-4374.
Wathen, M. W., Thomsen, D. R. & Stinski, M. F. (1981). Temporal regulation of human cytomegalovirus transcription at immediate early and early times after infection.Journal of Virology 38, 446-459.
Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck, M., Weinberg, R. A. & Harlow, E. (1988). Association between an oncogene and an anti-oncogene: the adenovirus E1A proteins bind to the retinoblastoma gene product.Nature 334, 124-129.[Medline]
Whyte, P., Williamson, N. M. & Harlow, E. (1989). Cellular targets for transformation by the adenovirus E1A proteins.Cell 56, 67-75.[Medline]
Wiebusch, L. & Hagemeier, C. (1999). Human cytomegalovirus 86-kilodalton IE2 protein blocks cell cycle progression in G1.Journal of Virology 73, 9274-9283.
Winkler, M., Rice, S. A. & Stamminger, T. (1994). UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression.Journal of Virology 68, 3943-3954.
Zerfass-Thome, K., Zwerschke, W., Mannhardt, B., Tindle, R., Botz, J. W. & Jansen-Dürr, P. (1996). Inactivation of the cdk inhibitor p27KIP1 by the human papillomavirus type 16 E7 oncoprotein.Oncogene 13, 2323-2330.[Medline]
Received 3 December 1999;
accepted 11 February 2000.
This article has been cited by other articles:
![]() |
I. Jafferji, M. Bain, C. King, and J. H. Sinclair Inhibition of epidermal growth factor receptor (EGFR) expression by human cytomegalovirus correlates with an increase in the expression and binding of Wilms' Tumour 1 protein to the EGFR promoter J. Gen. Virol., July 1, 2009; 90(7): 1569 - 1574. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Sanders, C. L. Clark, C. S. Morello, and D. H. Spector Development of Cell Lines That Provide Tightly Controlled Temporal Translation of the Human Cytomegalovirus IE2 Proteins for Complementation and Functional Analyses of Growth-Impaired and Nonviable IE2 Mutant Viruses J. Virol., July 15, 2008; 82(14): 7059 - 7077. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Upton and S. H. Speck Evidence for CDK-Dependent and CDK-Independent Functions of the Murine Gammaherpesvirus 68 v-Cyclin J. Virol., December 15, 2006; 80(24): 11946 - 11959. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. King, J. Baillie, and J. H. Sinclair Human cytomegalovirus modulation of CCR5 expression on myeloid cells affects susceptibility to human immunodeficiency virus type 1 infection. J. Gen. Virol., August 1, 2006; 87(Pt 8): 2171 - 2180. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Petrik, K. P. Schmitt, and M. F. Stinski Inhibition of Cellular DNA Synthesis by the Human Cytomegalovirus IE86 Protein Is Necessary for Efficient Virus Replication. J. Virol., April 1, 2006; 80(8): 3872 - 3883. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Castillo, F. M. Frame, H. A. Rogoff, M. T. Pickering, A. D. Yurochko, and T. F. Kowalik Human Cytomegalovirus IE1-72 Activates Ataxia Telangiectasia Mutated Kinase and a p53/p21-Mediated Growth Arrest Response J. Virol., September 1, 2005; 79(17): 11467 - 11475. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. White and D. H. Spector Exon 3 of the Human Cytomegalovirus Major Immediate-Early Region Is Required for Efficient Viral Gene Expression and for Cellular Cyclin Modulation J. Virol., June 15, 2005; 79(12): 7438 - 7452. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Reboredo, R. F. Greaves, and G. Hahn Human cytomegalovirus proteins encoded by UL37 exon 1 protect infected fibroblasts against virus-induced apoptosis and are required for efficient virus replication J. Gen. Virol., December 1, 2004; 85(12): 3555 - 3567. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Asmar, L. Wiebusch, M. Truss, and C. Hagemeier The Putative Zinc Finger of the Human Cytomegalovirus IE2 86-Kilodalton Protein Is Dispensable for DNA Binding and Autorepression, Thereby Demarcating a Concise Core Domain in the C Terminus of the Protein J. Virol., November 1, 2004; 78(21): 11853 - 11864. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hertel and E. S. Mocarski Global Analysis of Host Cell Gene Expression Late during Cytomegalovirus Infection Reveals Extensive Dysregulation of Cell Cycle Gene Expression and Induction of Pseudomitosis Independent of US28 Function J. Virol., November 1, 2004; 78(21): 11988 - 12011. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Maglova, W. E. Crowe, and J. M. Russell Perinuclear localization of Na-K-Cl-cotransporter protein after human cytomegalovirus infection Am J Physiol Cell Physiol, June 1, 2004; 286(6): C1324 - C1334. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Baillie, D. A. Sahlender, and J. H. Sinclair Human Cytomegalovirus Infection Inhibits Tumor Necrosis Factor Alpha (TNF-{alpha}) Signaling by Targeting the 55-Kilodalton TNF-{alpha} Receptor J. Virol., June 15, 2003; 77(12): 7007 - 7016. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wiebusch, J. Asmar, R. Uecker, and C. Hagemeier Human cytomegalovirus immediate-early over protein 2 (IE2)-mediated activation of cyclin E is cell-cycle-independent and forces S-phase entry in IE2-arrested cells J. Gen. Virol., January 1, 2003; 84(1): 51 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mauser, E. Holley-Guthrie, A. Zanation, W. Yarborough, W. Kaufmann, A. Klingelhutz, W. T. Seaman, and S. Kenney The Epstein-Barr Virus Immediate-Early Protein BZLF1 Induces Expression of E2F-1 and Other Proteins Involved in Cell Cycle Progression in Primary Keratinocytes and Gastric Carcinoma Cells J. Virol., November 13, 2002; 76(24): 12543 - 12552. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Fairley, J. Baillie, M. Bain, and J. H. Sinclair Human cytomegalovirus infection inhibits epidermal growth factor (EGF) signalling by targeting EGF receptors J. Gen. Virol., November 1, 2002; 83(11): 2803 - 2810. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Erlach, J. Podlech, A. Rojan, and M. J. Reddehase Tumor Control in a Model of Bone Marrow Transplantation and Acute Liver-Infiltrating B-Cell Lymphoma: an Unpredicted Novel Function of Cytomegalovirus J. Virol., February 22, 2002; 76(6): 2857 - 2870. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Flemington Herpesvirus Lytic Replication and the Cell Cycle: Arresting New Developments J. Virol., May 15, 2001; 75(10): 4475 - 4481. [Full Text] |
||||
![]() |
Z. Chen, E. Knutson, A. Kurosky, and T. Albrecht Degradation of p21cip1 in Cells Productively Infected with Human Cytomegalovirus J. Virol., April 15, 2001; 75(8): 3613 - 3625. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |