|
|
||||||||
Insect |
Interdepartmental Graduate Program in Genetics1 and Department of Entomology2, University of California, Riverside, CA 92521, USA
Author for correspondence: Brian Federici (at Department of Entomology). Fax +1 909 787 3086 or 3681. e-mail brian.federici{at}ucr.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The molecular basis for the differences in tissue tropism and host range of AcMNPV and TnGV is unknown. However, recent studies of putative baculoviral helicases suggest that these enzymes are one of the key determinants of host range (Lu & Carstens, 1991
; Lu & Miller, 1995
; Kool et al., 1995
; Ahrens & Rohrmann, 1996
; Heldens et al., 1997
). For example, changes in a few amino acids, or even in only one, in the AcMNPV helicase (P143) enable AcMNPV to replicate in cells and larvae of Bombyx mori, a host which does not support AcMNPV replication normally (Maeda et al., 1993
; Croizier et al., 1994
; Kamita & Maeda, 1997
; Argaud et al., 1998
). In addition, although the AcMNPV and Bombyx mori (Bm)NPV helicases are 96% identical (Kamita & Maeda, 1997
), the AcMNPV helicase inhibits BmNPV replication completely in B. mori cells (Kamita & Maeda, 1993
).
Although studies of putative NPV DNA helicases have shown that they are involved in replication and host range determination, nothing is known about the function of GV helicases. At present, the putative helicase (P137) of TnGV is the only GV helicase described (Bideshi et al., 1998
). Its amino acid sequence differs significantly (26·429·8% identical and 4454% similar) from NPV homologues. Despite the marked differences between TnGV P137 and AcMNPV P143, both function effectively during replication of their encoding genomes in larvae of the cabbage looper, T. ni. These observations raise the questions of whether p137 encodes a functional helicase that can support replication of AcMNPV in T. ni cells and larvae, and if so, whether P137 can affect the host range and tissue tropism of AcMNPV.
In the present study, we show that P137 was unable to support replication and occlusion, in either T. ni cells in vitro or in larvae, of a recombinant AcMNPV deficient in native helicase function. In addition, we show that co-synthesis of TnGV P137 and AcMNPV P143 did not inhibit replication of AcMNPV in T. ni cells or larvae. These results provide evidence that host and AcMNPV proteins which combine to form the replication complex cannot do so when P137 is substituted for P143. We also describe a rapid method for disrupting AcMNPV genes in E. coli using a recombinant AcMNPV (bacmid) capable of replicating in this bacterial host. Compared to conventional methods using virion plaque purification in insect cells, the bacmid system reduces significantly the time required for obtaining AcMNPV recombinants. This method could be particularly useful for recovering recombinants with deletions in genes essential for virus replication and pathogenesis because such recombinants are unlikely to be purified from insect cells or larvae in the absence of a helper virus.
| Methods |
|---|
|
|
|---|
Virus, bacterial strains and transformation.
or in E. coli DH10BAC (Gibco BRL). Bacterial cells were transformed by electroporation using an Electro Cell Manipulator (BTX Electroporation System) set at 2·5 kV, 50 µF, 129
. Transformants were allowed to recover in SOC medium (Ausubel et al., 1994
AcMNPV bacmids expressing polh and p137 under control of the p143 promoter.
The polyhedrin gene (polh), which the manufacturer deleted from the AcMNPV bacmid expression vector, was re-introduced by site-specific transposition using the transfer vector pFastBac (Gibco BRL) (Fig. 1A
). To delete the polyhedrin promoter in pFastBac, the plasmid was digested with SnaBI and BamHI, filled with dNTPs and Klenow and ligated to generate pFBd2. The 1·4 kb EcoRVAseI fragment of AcMNPV (nucleotide positions 44255818; Ayres et al., 1994
) containing the polh gene was cloned into the filled HindIII site in pFBd2 to generate pFBdP-4 (Fig. 1B
).
|
The region of the TnGV genome encoding P137 (positions 5284509) (Bideshi et al., 1998
) was cloned downstream from the p143 promoter in pFastBac to generate pHHUP-5. The 4 kb EcoRIPstI fragment of pHHUP-5 was cloned into the same position in pFBdP-4 to generate pHH-7 (Fig. 1C
).
Site-specific transposition using pFBdP-4 and pHH-7, and selection of recombinant AcMNPV bacmids AcBacP+ (p143+ polh+ kanR chlS) and AcHB-21 (p143+ p137 under control of the p143 promoter, polh+ kanR chlS) were performed according to the manufacturers protocol (Gibco BRL).
DNA and RNA probes.
The 1·2 kb BspHIXmnI fragment of pBCSK(-) (Stratagene) containing the chloramphenicol resistance gene (CHL probe), coding sequences of p143 (P143 probe), the 2·0 kb BamHINruI fragment of p143 (
P143 probe) containing the N-terminal coding region of P143 and the AcMNPV genomic DNA were labelled using a Dig DNA labelling and Detection kit (Boehringer Mannheim) according to the manufacturers protocol. Synthesis of the radiolabelled TnGV p137-antisense RNA probe and p143-antisense RNA probe using pAcBS-2 (see below) was performed as described by Bideshi et al. (1998)
.
Disruption of the p143 gene in E. coli BJ5183.
The AcMNPV p143 open reading frame (Lu & Carstens, 1991
) was obtained by PCR with primers (Genosys) 143-1 (5 ccggatccATGATTGACAACATTTTACAATTT 3) and 143-2 (5 tgcgaattcGCCGCTGTCCGAACGAGAGGTGC 3) initiating 3870 nucleotides downstream of the translation start codon, cleaved with EcoRI and BamHI, and ligated into the same sites in pBlueScript SK(+) (Stratagene) to generate pAcBS-2. The chloramphenicol resistance gene in pBCSK(-) was obtained as a filled 1·2 kb BspHIXmnI fragment and ligated into the filled SalIXbaI sites in pHHUP-5 to generate pHCC-1. The 1·9 kb NruIHindIII fragment in pAcBS-2, which lacked more than half of the N-terminal coding sequences of P143, was cloned into the filled XhoI and HindIII sites in pHCC-1 to generate pHHN-6 (Fig. 1D
).
The E. coli BJ5183 strain was transformed with AcHB-21, which contains polh, and the sequence encoding the TnGV P137 under control of the AcMNPV p143 promoter. The resulting strain (E. coli-AcHBM) was transformed with the 3·4 kb EcoRI fragment in pHNN-6 containing the CHL-disrupted AcMNPV p143 gene (Fig. 1D
). Bacterial cells were recovered overnight in SOC and plated onto LB agar with 30 µg/ml kanamycin and 15 µg/ml chloramphenicol (LB-KC). Plates were incubated at 37 °C for a maximum of 72 h. Disruption of the p143 gene in an AcHB-21 bacmid recombinant (AcHBMH5) that was resistant to kanamycin and chloramphenicol was confirmed by PCR analysis and Southern blot hybridization with the CHL, P143 and
P143 probes.
Transfection of insect cells and detection of viral DNA.
DNAs were purified using a Nucleobond AX kit (Clontech). Cells of Trichoplusia ni (BTI-TN-5B1-4; Invitrogen), Spodoptera frugiperda (SF21 and SF9; Pharmingen) and Spodoptera exigua SEC and SE1 (Gelernter & Federici, 1986
), were transfected with approximately 2 µg of AcBac-P+, AcHB-21, AcHBMH5, 2 µg of AcHBMH5 and 4 µg of a plasmid containing the AcMNPV EcoRI-D with the p143 gene (Ayres et al., 1994
), or with a mock control, using Cellfectin liposome reagent (Gibco BRL). Cell cultures were incubated at 28 °C for 36 days, after which media were collected and used to infect insect cells. To maintain proliferation of the monolayers of mock- and AcHBMH5-transfected cells, aliquots of the cell culture were transferred to fresh medium.
The presence of recombinant AcMNPV bacmid DNA was detected by PCR. DNA was isolated from insect cells or budded virions as described by OReilly et al. (1994)
, and then the 1·6 kb region of the AcMNPV genome containing the p35 gene (Ayres et al., 1994
) was amplified by PCR using primers P35-1 (5 TGCCGTCGAGCAAGTTTATATTCTT 3, nucleotide position 115999) and P35-3 (5 GCATTACAAGTAGAATTCTACTCGTAAAG 3, nucleotide position 117598).
RNA analysis.
RNA samples were collected from BTI-TN-5B1-4 cells transfected or infected with AcBacP+, AcHB-21 and AcHBMH5 using the TRIzol reagent (Gibco BRL). Five µg of RNA was dot-blotted onto a nylon membrane and hybridized with the radiolabelled p137- and p143-antisense RNA probes, and with the digoxigenin-labelled AcMNPV genomic probe.
Insect inoculation.
Larvae of T. ni were grown on a semi-defined medium (Shorey & Hale, 1965
). Two µg of AcHB-21 or AcHBMH5 DNA was mixed with 6 µl of Cellfectin reagent and 300 µl of Graces insect cell culture medium (Gibco BRL). Three separate injections of ten early fourth instar larvae, each with 3 µl of the mixture, were performed within a 5 min period using a Microapplicator model M microinjector (Instrumentation Specialities Company, Inc.). Ten larvae were mock-transfected with Graces insect medium. In addition, 2 ml of cell culture medium from transfection experiments with AcHB-21, AcHBMH5 or mock-transfected BTI-TN-5B1-4 cells was collected 6 days after incubation and spun at 15000 g for 20 min and pellets were resuspended in 300 µl of Graces insect medium. Twenty larvae were microinjected with 3 µl of each suspension.
| Results |
|---|
|
|
|---|
P143 probes (Fig. 2A
P143 probe, whereas the 4·2 kb PCR product from AcHB-21, obtained with the same primers, hybridized with the
P143 probe, but not with the CHL probe [Fig. 2B
|
P143 probe [(Fig. 2B
|
TnGV p137 is unable to substitute for AcMNPV p143 function
When TnGV p137 was substituted for AcMNPV p143 in AcHBMH5, no occlusion bodies were observed in BTI-TN-5B1-4, SF21, SF9, SE-C or SE-1 cells, even as late as 12 days post-transfection (data not shown). The morphology and growth of cells transfected with AcHBMH5 were similar to those of the mock-transfected control. In both, the cells were completely confluent by 46 days post-transfection. Cells transfected with AcHB-21 or AcBacP+ produced polyhedra within 3 days, and the cell density was approximately 2-fold lower than cells transfected with AcHBMH5 due to the spread of infection, which limited cell proliferation.
In addition, occlusions were not observed in cells treated with medium collected from the initial transfection with AcHBMH5 (data not shown). However, occlusions were observed after 58 days in cells co-transfected with AcHBMH5 and a plasmid containing AcMNPV p143, indicating that the latter gene was expressed, and P143 supported AcMNPV replication.
Using the P35-1 and P35-3 primers, designed to amplify a 1·6 kb fragment containing the p35 (Ayres et al., 1994
) gene of AcMNPV, AcHB-21 and AcHBMH5 DNAs were detected in BTI-TN-5B1-4 cells from 3 and 5 days post-transfection (Fig. 3
, lanes 25). However, the 1·6 kb PCR product was not detected 12 days post-transfection of cells with AcHBMH5 (Fig. 3A
, lane 6). In addition, the 1·6 kb fragment was not detected in the supernatant of cell transfected with AcHBMH5 (Fig. 3B
, lanes 14), indicating a lack of budded virions. The 1·6 kb fragment was obtained by PCR from similar preparation of supernatants of cells transfected with AcHB-21 (Fig. 3
, lane 5).
AcHBMH5 transcripts were detected until 48 h post-transfection, but not 96 h, whereas AcHB-21 transcripts were detected at 18, 48 and 96 h post-transfection (Fig. 4
) of BTI-TN5-B1-4 cells.
|
Co-expression of p143 and p137 does not inhibit AcMNPV replication
Dot-blot analysis of RNAs collected from cells infected with AcBacP+, which lacked TnGV p137, and AcHB-21, which contained the sequences encoding the TnGV P137 under control of the p143 promoter, showed that the p143 gene was expressed during virus replication in BTI-TN-5B1-4 cells (Fig. 5A
). The p137 gene was also detected in BTI-TN-5B1-4 cells infected with AcHB-21 (Fig. 5B
).
|
| Discussion |
|---|
|
|
|---|
The results obtained in our substitution experiments were consistent with how helicases function in the replication of viral DNA. Viral DNA replication generally involves a set of highly ordered proteinDNA and proteinprotein interactions that lead to the assembly of a functional replication complex. Among these interactions is the recruitment of DNA polymerase by the pre-replicative helicasesprimase complex at the origin(s) of DNA replication. The complexity of these interactions in large DNA viruses is illustrated by the pre-replicative complex of herpes simplex virus type 1 (HSV-1). In this virus, the origin-binding protein (UL9), a DNA helicase (Bruckner et al., 1991
), binds to the HSV-1 genome with the concomitant binding of the helicaseprimase components (UL5, UL8, UL52) and the single-stranded DNA-binding protein ICP8 (Liptak et al., 1996
). The UL5 protein requires UL52 for helicase and primase activity (Dodson et al., 1989
; Dodson & Lehman, 1991
). Similar proteinprotein interactions are likely to occur in baculoviruses. However, with the exception of the AcMNPV and Orgyia pseudotsugata MNPV replication proteins (Kool et al., 1994
, 1995
; Lu & Miller, 1995
; Ahrens & Rohrmann, 1996
), the proteins involved in baculovirus replication complexes remain unknown. Based on its deduced amino acid sequence, TnGV P137 is probably one of these proteins, but more definitive evidence is required before such a conclusion can be drawn.
Finally, in the present study the utility of a method for the rapid disruption of AcMNPV bacmid genes in E. coli BJ5183 was demonstrated (Hanahan, 1983
; Chartier et al., 1996
). As AcMNPV strains with non-temperature-sensitive lethal mutations cannot be recovered by plaque purification techniques in the absence of helper virus, this method could prove practical for inactivating genes such as p143 or cis-elements such as hr sequences (Leisy et al., 1995
; Pearson & Rohrmann, 1995
; Kool et al., 1993
; Ayres et al., 1994
) that may be essential for virus replication and pathogenesis.
The accompanying paper (Bideshi & Federici, 2000
) reports the DNA-independent ATPase activity of the TnGV DNA helicase.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Argaud, O., Croizier, l., Ferber-Lopez, M. & Croizier, G. (1998). Two key mutations in the host-range specificity domain of the p143 gene of Autographa californica nucleopolyhedrovirus are required to kill Bombyx mori larvae. Journal of General Virology 79, 931-935.[Abstract]
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1994). Current Protocols in Molecular Biology, vol. 1. New York: John Wiley and Sons.
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605.[Medline]
Bideshi, D. K. & Federici, B. A. (2000). DNA-independent ATPase activity of the Trichoplusia ni granulovirus DNA helicase. Journal of General Virology 81, 1601-1604.
Bideshi, D. K., Hice, R. H., Ge, B. & Federici, B. A. (1998). Molecular characterization and expression of the Trichoplusia ni granulovirus helicase gene. Journal of General Virology 79, 1309-1319.[Abstract]
Bruckner, R. C., Crute, J. J., Dodson, M. S. & Lehman, I. R. (1991). The herpes simplex virus 1 origin binding protein, a DNA helicase. Journal of Biological Chemistry 266, 2669-2674.
Chartier, C., Degryse, E., Gantzer, M., Dieterle, A., Pavirani, A. & Mehtali, M. (1996). Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. Journal of Virology 70, 4805-4810.[Abstract]
Croizier, G., Croizier, L., Argaud, O. & Poudevigne, D. (1994). Extension of Autographa californica nuclear polyhedrosis virus host range by interspecific replacement of a short DNA sequence in the p143 helicase gene. Proceedings of the National Academy Sciences, USA 91, 48-52.
Dodson, M. S. & Lehman, I. R. (1991). Association of DNA helicase and primase activities with a subassembly of the herpes simplex virus 1 helicaseprimase composed of UL5 and UL52 gene products. Proceedings of the National Academy of Sciences, USA 88, 1105-1109.
Dodson, M. S., Crute, J. J., Bruckner, R. C. & Lehman, I. R. (1989). Overexpression and assembly of the herpes simplex virus type 1 helicaseprimase in insect cells. Journal of Biological Chemistry 264, 20835-20838.
Federici, B. A. (1993). Viral pathobiology in relation to insect control. In Parasites and Pathogens of Insects, pp. 81-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San Diego: Academic Press.
Gelernter, W. D. & Federici, B. A. (1986). Continuous cell line from Spodoptera exigua (Lepidoptera: Noctuidae) that supports replication of nuclear polyhedrosis viruses from Spodoptera exigua and Autographa californica. Journal of Invertebrate Pathology 48, 199-207.
Hanahan, D. (1983). Studies on the transformation of Escherichia coli with plasmids. Journal of Molecular Biology 166, 557-580.[Medline]
Heldens, J. G. M., Liu, Y., Zuidema, D., Goldbach, R. W. & Vlak, J. (1997). Characterization of a putative Spodoptera exigua multicapsid nucleopolyhedrovirus helicase gene. Journal of General Virology 78, 3101-3114.[Abstract]
Kamita, G. S. & Maeda, S. (1993). Inhibition of Bombyx mori nuclear polyhedrosis virus (NPV) replication by the putative DNA helicase of Autographa californica NPV. Journal of Virology 67, 6239-6245.
Kamita, S. G. & Maeda, S. (1997). Sequencing of the putative DNA helicase-encoding gene of the Bombyx mori nuclear polyhedrosis virus and fine-mapping of a region involved in host range expansion. Gene 190, 173-179.[Medline]
Kool, M., Voncken, J. W., van Lier, F. L. J., Tramper, J. & Vlak, J. M. (1993). Identification of seven putative origins of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus DNA replication. Journal of General Virology 74, 2661-2668.
Kool, M., Ahrens, C., Goldbach, R. W., Rohrmann, G. F. & Vlak, J. M. (1994). Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proceedings of the National Academy of Sciences, USA 91, 11212-11216.
Kool, M., Ahrens, H. C., Vlak, J. M. & Rohrmann, G. F. (1995). Replication of baculovirus DNA. Journal of General Virology 76, 2103-2118.
Leisy, D. J., Rasmussen, C., Him, H.-T. & Rohrmann, G. F. (1995). The Autographa californica nuclear polyhedrosis virus homologous region 1a: identical sequences are essential for DNA replication activity and transcriptional enhancer function. Virology 208, 742-752.[Medline]
Liptak, L. M., Uprichard, S. L. & Knipe, D. M. (1996). Functional order of assembly of herpes simplex virus DNA replication proteins into prereplicative site structures. Journal of Virology 70, 1759-1767.[Abstract]
Lu, A. & Carstens, E. B. (1991). Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus Autographa californica nuclear polyhedrosis virus. Virology 181, 336-347.[Medline]
Lu, A. & Miller, L. K. (1995). The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. Journal of Virology 69, 975-982.[Abstract]
Maeda, S., Kamita, S. G. & Kondo, A. (1993). Host range expansion of Autographa californica nuclear polyhedrosis virus (NPV) following recombination of a 0·6-kilobase-pair DNA fragment originating from Bombyx mori NPV. Journal of Virology 67, 6234-6238.
Martignoni, M. E. & Iwai, P. J. (1986). A Catalogue of Viral Diseases of Insects, Mites and Ticks, 4th edn. USDA Forest Service PNW-195.
OReilly, D. R., Miller, L. K. & Luckow, V. A. (1994). Baculovirus Expression Vectors: A Laboratory Manual, pp. 132134. New York: W. H. Freeman.
Pearson, M. N. & Rohrmann, G. F. (1995). Lymantria dispar nuclear polyhedrosis virus homologous regions: characterization of their ability to function as replication origins. Journal of Virology 69, 213-221.[Abstract]
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). Nucleotide sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463-5467.
Shorey, H. H. & Hale, R. L. (1965). Mass-rearing of the larvae of nine noctuid species on a simple artificial medium. Journal of Economic Entomology 58, 522-524.
Volkman, L. E., Blissard, G. W., Friesen, P., Keddie, B. A., Possee, R. & Theilmann, D. A. (1995). Family Baculoviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp. 104-113. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag.
Received 12 January 2000;
accepted 3 March 2000.
This article has been cited by other articles:
![]() |
Y. Li and L. A. Guarino Roles of LEF-4 and PTP/BVP RNA Triphosphatases in Processing of Baculovirus Late mRNAs J. Virol., June 1, 2008; 82(11): 5573 - 5583. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wu, T. Lin, L. Pan, M. Yu, Z. Li, Y. Pang, and K. Yang Autographa californica Multiple Nucleopolyhedrovirus Nucleocapsid Assembly Is Interrupted upon Deletion of the 38K Gene J. Virol., December 1, 2006; 80(23): 11475 - 11485. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Knebel-Morsdorf, I. Quadt, Y. Li, L. Montier, and L. A. Guarino Expression of Baculovirus Late and Very Late Genes Depends on LEF-4, a Component of the Viral RNA Polymerase Whose Guanyltransferase Function Is Essential. J. Virol., April 1, 2006; 80(8): 4168 - 4173. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Wilson, S. D. Forney, A. M. Ricci, E. G. Allen, K. L. Hefferon, and L. K. Miller Expression and Mutational Analysis of Autographa californica Nucleopolyhedrovirus HCF-1: Functional Requirements for Cysteine Residues J. Virol., November 15, 2005; 79(22): 13900 - 13914. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Liqun, H. Rivkin, and N. Chejanovsky The Immediate-Early Protein IE0 of the Autographa californica Nucleopolyhedrovirus Is Not Essential for Viral Replication J. Virol., August 1, 2005; 79(15): 10077 - 10082. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kitagawa, H. Tani, C. K. Limn, T. M. Matsunaga, K. Moriishi, and Y. Matsuura Ligand-Directed Gene Targeting to Mammalian Cells by Pseudotype Baculoviruses J. Virol., March 15, 2005; 79(6): 3639 - 3652. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Chen, D. Sahri, and E. B. Carstens Characterization of the Interaction between P143 and LEF-3 from Two Different Baculovirus Species: Choristoneura fumiferana Nucleopolyhedrovirus LEF-3 Can Complement Autographa californica Nucleopolyhedrovirus LEF-3 in Supporting DNA Replication J. Virol., January 1, 2004; 78(1): 329 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Bideshi, S. Renault, K. Stasiak, B. A. Federici, and Y. Bigot Phylogenetic analysis and possible function of bro-like genes, a multigene family widespread among large double-stranded DNA viruses of invertebrates and bacteria J. Gen. Virol., September 1, 2003; 84(9): 2531 - 2544. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lu, Q. Du, and N. Chejanovsky Reduced Expression of the Immediate-Early Protein IE0 Enables Efficient Replication of Autographa californica Multiple Nucleopolyhedrovirus in Poorly Permissive Spodoptera littoralis Cells J. Virol., December 6, 2002; 77(1): 535 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lung, M. Westenberg, J. M. Vlak, D. Zuidema, and G. W. Blissard Pseudotyping Autographa californica Multicapsid Nucleopolyhedrovirus (AcMNPV): F Proteins from Group II NPVs Are Functionally Analogous to AcMNPV GP64 J. Virol., May 3, 2002; 76(11): 5729 - 5736. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Bideshi and B. A. Federici DNA-independent ATPase activity of the Trichoplusia ni granulovirus DNA helicase J. Gen. Virol., June 1, 2000; 81(6): 1601 - 1604. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |