J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzutani, T.
Right arrow Articles by Azuma, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzutani, T.
Right arrow Articles by Azuma, M.
Agricola
Right arrow Articles by Suzutani, T.
Right arrow Articles by Azuma, M.
Journal of General Virology (2000), 81, 1763-1771.
© 2000 Society for General Microbiology


Animal: DNA Viruses

The role of the UL41 gene of herpes simplex virus type 1 in evasion of non-specific host defence mechanisms during primary infection

Tatsuo Suzutani1, Masayoshi Nagamine1, Taiichiro Shibaki1, Masahiro Ogasawara1, Itsuro Yoshida1, Toru Daikoku2, Yukihiro Nishiyama2 and Masanobu Azuma1

Department of Microbiology, Asahikawa Medical College, Asahikawa 078-8510, Japan1
Laboratory of Virology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya 466-8550, Japan2

Author for correspondence: Tatsuo Suzutani. Fax +81 166 68 2399. e-mail suzutani{at}asahikawa-med.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The UL41 gene product (vhs) of herpes simplex virus (HSV) is packaged in the virion, and mediates host protein synthesis shutoff at the early stage of the virus replication cycle. In order to clarify the role of vhs in virus replication and virulence, we isolated a completely UL41-deficient mutant (the VR{Delta}41 strain) and its revertant (the VR{Delta}41R strain). In the mouse encephalitis model, the replication of strain VR{Delta}41 was inhibited after 2 days post-infection, resulting in low virulence, by {gamma}-ray-sensitive cells such as lymphocytes and/or neutrophils. The result suggested that some cytokines, produced in VR{Delta}41-inoculated brains, activate and induce the migration of {gamma}-ray-sensitive cells to the infection site. Therefore, cytokines produced by HSV-1-infected human cells were screened, and potent inductions of interleukin (IL)-1{beta}, IL-8 and macrophage inflammatory protein-1{alpha} by VR{Delta}41 infection were observed. Moreover, the VR{Delta}41 strain showed 20- and 5-fold higher sensitivity to interferon-{alpha} and -{beta} compared to the wild-type strain, respectively. These results indicate that one important role of vhs in vivo is evasion from non-specific host defence mechanisms during primary infection through suppression of cytokine production in HSV-infected cells and reduction of the anti-HSV activity of interferon-{alpha} and -{beta}.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Herpes simplex virus (HSV) infection causes the shutoff of host cellular protein synthesis soon after virus entry into cells (Roizman et al., 1965Down ; Sydiskis & Roizman, 1966Down ). The shutoff phenomenon is classified into two stages: early, primary or virion-associated shutoff, which is induced by a structural component of the HSV virion and does not require virus protein synthesis, and delayed or secondary shutoff, which requires the expression of viral gene(s) (Nishioka & Silverstein, 1978Down ; Fenwick & Walker, 1978Down ). The early shutoff is mediated by the virion host shutoff (vhs) protein encoded by the UL41 gene, whereas one of the immediate early proteins, ICP27 (also known as IE63, IE2 and UL54), causes the delayed shutoff through the regulation of small nuclear ribonucleoprotein distribution, although it has not been clarified whether other viral factors are also involved in the shutoff or not (Read & Frenkel, 1983Down ; Martin et al., 1987Down ; Kwong et al., 1988Down ; Sandri-Goldin & Mendoza, 1992Down ; Phelan et al., 1993Down ).

The UL41 gene is an early/late gene and expresses two forms of the protein, the major 58 kDa polypeptide and a highly phosphorylated 59·5 kDa polypeptide (Read et al., 1993Down ). At the intermediate and late stages of the HSV replication cycle, the shutoff activity of the newly synthesized vhs polypeptide is suppressed by formation of a complex with VP16 (also known as Vmw65, {alpha}TIF and ICP25) via a domain spanning residues 310–330 of the vhs protein (Lam et al., 1996Down ; Schmelter et al., 1996Down ). The 58 kDa vhs–VP16 complex is packaged into the tegument of HSV particles, and delivered into the cytoplasm of newly infected cells following fusion of the viral envelope with the host plasma membrane (McLauchlan et al., 1992Down ; Smibert et al., 1992Down ; Read et al., 1993Down ). UL13 protein kinase seems to be involved in releasing vhs protein and VP16 from the tegument, although the details have yet to be precisely defined (Overton et al., 1994Down ). The vhs protein degrades both cellular and viral mRNAs rapidly, resulting in the shutoff of protein synthesis, while it does not affect rRNA or tRNA (Nishioka & Silverstein, 1977Down ; Schek & Bachenheimer, 1985Down ; Strom & Frenkel, 1987Down ). Zelus et al. (1996)Down demonstrated a messenger ribonuclease (RNase) activity in crude vhs samples which were prepared from purified virions or synthesized in a rabbit reticulocyte in vitro translation system. This study strongly suggested that vhs protein itself was an RNase, although a demonstration of the RNase activity of vhs protein purified to homogeneity is necessary.

The role of vhs function in virus replication has been studied using vhs loss of function mutants. The studies indicate that: (i) shutoff of expression of host genes may allow better utilization of the translational machinery of the infected cell for translation of newly synthesized viral mRNAs, (ii) degradation of viral mRNA may facilitate rapid transitions in the expression of specific groups of viral genes (Kwong & Frenkel, 1987Down ; Strom & Frenkel, 1987Down ). However, these functions are dispensable, and loss of vhs function reduces virus yield by less than 1 log order in tissue culture infection (Read & Frenkel, 1983Down ; Strelow & Leib, 1995Down ). The vhs protein seems to play more important role(s) in vivo, as indicated by the reduced virulence and the impaired replication of vhs mutants in mouse (Becker et al., 1993Down ; Strelow & Leib, 1995Down ). Therefore, we have studied the molecular mechanism of the low virulence of vhs-deficient mutants to understand how the degradation of host mRNA is linked to virulence. The results presented here indicate that vhs function inhibits non-specific host defence mechanisms through suppression of cytokine expression in HSV-infected cells and through a reduction in the anti-HSV activity of interferon (IFN)-{alpha} and -{beta}.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cell cultures.
A human myelomonocytic cell line, U937, was kindly supplied by K. Satoh (Asahikawa Medical College, Asahikawa, Japan) and cultivated in RPMI1640 supplemented with 10% foetal bovine serum (RPMI-FBS-10). The cells were subcultured for differentiation to a macrophage-like phenotype in RPMI-FBS-10 containing 10 nM of 12-O-tetradecanoyl phorbol acetate 3 days before virus infection (Gidlund et al., 1981Down ). HEL, Vero and BALB/3T3 clone A31 cells were cultured in Eagle’s minimum essential medium (MEM) supplemented with 10% newborn calf serum (MEM-NCS-10). A human neuroblastoma cell line, NB69 cells, was cultured in RPMI-FBS-15. The BALB/3T3 and NB69 cells were generously supplied by RIKEN Cell Bank, Tsukuba, Japan. Human macrophages were isolated as settled cells on plastic Petri dishes from monocytes, which were prepared from human blood by Percoll (Pharmacia) density gradient centrifugation, and cultured in RPMI-FBS-10.

{blacksquare} Isolation of virus strains.
HSV-1 strain VR-3 was the parental strain used. pUC{Delta}41, a plasmid for isolation of the UL41-deletion mutant, was constructed as follows: genomic DNA of VR-3 strain was digested with KpnI and EcoRI, and an 11·9 kbp fragment from UL39 to a part of the UL44 gene was cloned into pUC18 to give pUC39Kpn44Eco. A 3·9 kbp BamHI fragment and a 4·1 kbp MunI/EcoRI fragment were prepared from pUC39kpn44Eco, and cloned into the pUC18 BamHI and EcoRI sites with a BamHI/EcoRI fragment of the green fluorescent protein gene from pRSET-GFP to give pUC{Delta}41 (Fig. 1aDown). pRSET-GFP was kindly supplied by Roger Y. Tsien, University of California, San Diego, CA, USA. The deletion construct, pUC{Delta}41, is deficient in the UL41 gene from 8 bp upstream of the start codon to the BamHI site in the UL41 gene. The DNA encoding the UL41 deletion mutation was excised by digestion with AatI and EcoRI and co-transfected with VR-3 DNA into Vero cells using FuGENE 6 transfection reagent (Boehringer Mannheim). The transfected Vero cells were cultured in MEM-NCS-2 containing 0·5% methyl cellulose 4000 (Nacalai Tesque) and progeny strains were isolated from plaques under a microscope. The genotype of isolated strains was verified by PCR of the genetically engineered region using primers UL41-S1 (5' GCGATATGACGTACTTAATGTAGC 3'; positions 91377–91400) and UL41-S2' (5' TTAGGCCGATCCGCAGTTACAATT 3'; positions 92669–92646), and the ApaI cleavage pattern of the PCR product. Of 29 plaques picked from the transfected culture, two plaques contained UL41-deficient recombinant virus. Three rounds of plaque purification yielded a pure population of the VR{Delta}41 strain.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1. Targeted deletion of the UL41 gene of HSV-1. (a) Construction of plasmids used to isolate the UL41-deletion mutant and its revertant of HSV-1. Locations of genes and restriction enzyme cutting sites are shown at the top of the figure. The structures of the insert DNA in the plasmids for the isolation of the deletion mutant and its revertant are designated as pUC{Delta}41 and pBS-40H42N, respectively. The locations of probes for Southern hybridization are also indicated. (b) Southern analysis of genomic DNA from VR-3 (lane 1), VR{Delta}41 (lane 2) and VR{Delta}41R (lane 3) strains of HSV-1. (c) Detection of the UL41 polypeptide in HSV-1-infected Vero cells. Mock- (lane M), VR-3- (lane 1), VR{Delta}41- (lane 2) and VR{Delta}41R- (lane 3) infected cells were separated by SDS–PAGE and analysed by Western blotting using the UL41 antiserum. (d) SDS–PAGE analysis of pulse-labelled proteins in the vhs assay. The vhs assay was carried out as follows: mock- and HSV-1-infected Vero cells at 10 p.f.u. per cell were cultured in medium containing actinomycin D for 4·5 h and then the cells were pulse-labelled with [35S]methionine and [35S]cysteine for 30 min. A fluorogram of a dried gel is shown. (e) Quantity of translated proteins in vhs assay. The radio-labelled samples of the vhs assay were precipitated with TCA and were quantified with a liquid scintillation counter. The amount of labelled protein is indicated as a percentage relative to that of mock-infected cells.

 
The rescued strain of VR{Delta}41, VR{Delta}41R, was isolated as follows: a 3·7 kbp HindIII/NotI fragment prepared from pUC39kpn44Eco was cloned into pBluescript (Stratagene) to give plasmid pBS-40H42N. The VR{Delta}41R strain was isolated by co-transfection of the 3·7 kbp HindIII/NotI fragment and VR{Delta}41 DNA as described above. One of 30 selected plaques contained virus with the rescued genotype, and a pure population of the VR{Delta}41R strain was obtained from the plaque by three rounds of further plaque purification.

{blacksquare} Southern blot analysis.
Genomic DNA extracted from 5x106 HSV-1-infected Vero cells was digested with HindIII and NotI, and used for Southern blot analysis. The GFP gene, prepared from the pRSET-GFP plasmid by digestion with BamHI and EcoRI, was used as a probe. Probes for the UL41 gene were prepared by PCR. The PCR amplification was carried out using primers UL41-NS (5' ttttcTaGACCTGACATGGGTTTGTTCG 3'; capital letters represent viral sequence positions 92646–92625) and UL41-E (5' CAAGCGCGgTCGaCTGACGTTTGGG 3'; positions 91143–91167). Two fragments, of 1035 bp and 471 bp, were purified from the BamHI-cleaved PCR product which had been electrophoresed on an agarose gel, and were used as probes for the 5'-end and 3'-end regions of the UL41 gene, respectively. Each DNA fragment was radiolabelled by the end-labelling method using polynucleotide kinase and [{gamma}-32P]ATP. Hybridizations were performed at 65 °C overnight in 5x SSC (1xSSC: 150 mM NaCl, 15 mM sodium citrate), 1% SDS and 1x Denhardt’s solution. Following hybridization, the membrane was washed with 0·2xSSC in 0·1% SDS at 65 °C. The membrane was stripped with 0·2 M NaOH and neutralized with 0·2 M Tris–HCl (pH 7·2) in 0·1% SDS prior to rehybridization with other probes.

{blacksquare} Preparation of polyclonal antisera.
The UL41 coding sequence was amplified by PCR from genomic DNA of the HSV-2 186 strain using UL41f (5' attgcggccgcATGGGTCTGTTTGGCATGATGAAG 3'; capital letters represent viral sequence positions 93275–93252) and UL41r (attgcggccgcCTACTCGTCCCAGAATTTAGCCAG; positions 91797–91820) as the primers (Dolan et al., 1998Down ). PCR products were digested with NotI and cloned into the NotI site of pET-28a (Novagen) to give pET-UL41. The plasmid, pET-UL41, was transformed into E. coli strain BL21(DE3), which following induction with IPTG, expressed 6x His-UL41 fusion protein. The UL41 fusion protein was purified using the Prep Cell system (Bio-Rad), and the purified fractions were used to immunize three rabbits, as described previously (Daikoku et al., 1997Down ).

{blacksquare} Western blot analysis.
Western blotting was performed as described previously (Oshima et al., 1998Down ). Briefly, proteins were electrophoretically transferred from an SDS–polyacrylamide gel to PVDF transfer membranes. Respective bound primary antibodies were detected using horseradish peroxidase-linked sheep anti-rabbit immunoglobulin G and ECL Western blotting detection reagents (Amersham Pharmacia Biotech).

{blacksquare} vhs Assay.
Vero cells in 35 mm Petri dishes were infected with HSV-1 strains at an m.o.i. of 10 p.f.u. per cell, and cultivated in MEM-NCS-2 supplemented with 2 µg/ml of actinomycin D (MEM-Act D). After 4·5 h of incubation in a CO2 incubator, the cultures were re-fed with MEM-Act D containing 50 µCi/ml of Pro-mix (mixture of L-[35S]methionine and L-[35S]cysteine; Amersham) and pulse-labelled for 30 min. The cells were lysed by incubation with 500 µl of SDS sample buffer (65 mM Tris–HCl, pH 6·8, 2% SDS, 5% 2-mercaptoethanol) containing 100 unit/ml Benzone nuclease (Merck) at 37 °C for 30 min.

Labelling was quantified as follows: labelled proteins were precipitated by addition of trichloroacetic acid (TCA) at a final concentration of 10% (w/v) and incubation for 30 min on ice. After centrifugation for 10 min at 12000 r.p.m. using a micro-centrifuge, the supernatant was discarded and the pellet was washed three times with 10% ice-cold TCA. The incorporated 35S-radioactivity was measured in a liquid scintillation counter.

Labelled proteins were analysed by electrophoresis on a 10% SDS–polyacrylamide gel and fluorography using EN3HANCE (NEN Life Science).

{blacksquare} Mouse model for HSV-1 infection.
The virulence of HSV-1 strains VR-3, VR{Delta}41, VR{Delta}41R and the thymidine kinase (TK)-negative strain VRTK- were analysed in a mouse model for HSV-1 encephalitis as described previously (Suzutani et al., 1988Down , 1995Down ). Groups of 10 adult (4-week-old) or newborn (3-day-old) female BALB/c mice were inoculated in the right cerebral hemisphere with 3 µl aliquots of serial 10-fold dilutions of the HSV-1 strains, and the survival rate was assessed daily for 28 days. The 50% lethal doses (LD50) for the virus strains were determined graphically.

For suppression of mouse defence functions, {gamma}-rays from 137Cs were used to irradiate mice using Gammacell 40 (Atomic Energy of Canada Ltd).

The virus titre in the brains of HSV-1-infected mice was determined as follows. Mice were decapitated under ether anaesthesia, and the cerebra were removed and homogenized in 2 ml of MEM with a homogenizer. The extracts were centrifuged at 3000 r.p.m. for 10 min at 4 °C and the virus in the supernatants was titrated on Vero cells.

{blacksquare} Quantification of mRNA.
The expression patterns of genes were semi-quantitatively monitored using Atlas human cDNA expression array I (Clontec Laboratories). The virus stocks of each HSV-1 strain used in these experiments were purified by sucrose gradient centrifugation in order to remove cellular factors. Total RNA was extracted from 5x106–1x107 mock- or HSV-1-infected HEL or differentiated U937 cells at 1 h post-infection using TRIZOL reagent (Gibco BRL). mRNA was purified from the total RNA samples by oligo(dT) cellulose spin columns (5 Prime->3 Prime Inc.). 32P-labelled cDNA was synthesized and hybridized to a membrane onto which 588 human DNA had been immobilized, in accordance with the manufacturer’s instructions. After washing, the membranes were exposed to an Imaging Plate for 2 h. Gene expression was quantified by analysing the radiogram using a Bio-Imaging Analyser BAS2000 (Fuji Photo Film).

{blacksquare} ELISA.
The quantities of interleukin (IL)-1{beta}, IL-8 and macrophage inflammatory protein (MIP)-1{alpha} in the medium of mock- and HSV-1-infected human cell cultures (HEL, NB69 and primary macrophages) at 24 h post-infection were measured using ELISA kits (IL-1{beta} and IL-8 immunoassay kits, BioSource International; MIP-1{alpha} immunoassay kit, R&D Systems).

{blacksquare} Effect of vhs function on susceptibility of HSV-1 to IFN.
Susceptibility of HSV-1 strains to IFN was evaluated by a plaque reduction assay on HEL cells as previously described (Suzutani et al., 1988Down ). Briefly, confluent HEL cells in 24-well plastic plates were re-fed with MEM-NCS-10 containing various concentration of IFN and cultured for 16 h in a CO2 incubator. The IFN-treated HEL cells were infected with 10–20 p.f.u. of HSV-1 strains and cultured with MEM-NCS-2 supplemented with 0·5% methyl cellulose 4000 and IFN for 3 days. IFN-{alpha} and -{beta} used in this study were natural type and kindly supplied by Sumitomo Pharmaceuticals and Daiichi Pharmaceutical Co., respectively. Recombinant IFN-{gamma} was provided by Shionogi & Co.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Isolation of a UL41-deficient HSV-1 mutant
To study vhs function in detail, we isolated a completely UL41-deficient recombinant HSV-1 (VR{Delta}41) strain which lacked not only vhs function but also expression of any polypeptide from the UL41 gene, and we also isolated a revertant of VR{Delta}41 (VR{Delta}41R) as described in Methods.

Genotypes of the isolated virus strains were analysed by Southern blot hybridization (Fig. 1aUp, bUp). A 3·7 kbp fragment of the VR-3 strain and VR{Delta}41R strain, and a 3·6 kbp fragment of the VR{Delta}41 strain in HindIII/NotI-cleaved viral DNA were detected using a probe of the 3' end segment from the BamHI site of the UL41 gene. The identical 3·6 kbp DNA fragment was detected using a probe of the GFP gene in the VR{Delta}41 genome, while a probe from the 5' end segment of the UL41 gene, between the MunI and BamHI sites, hybridized to 3·7 kbp fragments from the VR-3- and VR{Delta}41R genomes but not the VR{Delta}41 genome. These results indicate that the genotypes of the VR{Delta}41 and VR{Delta}41R strains are those of a UL41-deficient virus and a UL41 gene rescued virus, respectively.

The phenotypes of strains were verified with Western blotting and a vhs assay (Fig. 1cUpeUp). Western blotting using polyclonal antisera against HSV-2 UL41 polypeptide detected the 58 kDa polypeptide expressed from the UL41 gene in VR-3- and VR{Delta}41R-infected cells at 12 h post-infection but not in VR{Delta}41-infected cells (Fig. 1cUp). The VR-3 and VR{Delta}41R strains reduced uniformly the synthesis of all host proteins of infected cells to 15% of the level of mock-infected cells (Fig. 1dUp, eUp). In contrast, no vhs activity was observed in VR{Delta}41-infected cells. These results verified by both genotypic and phenotypic characteristics that strain VR{Delta}41 is a UL41-deficient strain and that VR{Delta}41R is a revertant of VR{Delta}41 in the UL41 gene.

Virulence of HSV-1 strains in mice
The effect of vhs function on virulence was analysed by using a BALB/c mouse encephalitis model. The VR{Delta}41 strain showed low virulence, depending on the age of the host mouse (Table 1Down). The results suggested two possibilities for the cause of the low virulence of the VR{Delta}41 strain: (i) the VR{Delta}41 strain can replicate in dividing neurons of suckling mice but not in stationary neurons of adult mice, like the TK-deficient HSV described previously (Suzutani et al., 1995Down ), or (ii) the maturity of cells responsible for non-specific defences against virus replication influences the sensitivity of animals to VR{Delta}41 infection (Johnson, 1964Down ; Hayashi et al., 1980Down ). In order to clarify the cause of the age-dependent low virulence of VR{Delta}41, the effect of {gamma}-ray irradiation of mice on the virulence was examined. The LD50 of the VR{Delta}41 strain was decreased in proportion to the dose of {gamma}-ray irradiation in the host mice (Fig. 2Down). At 4 Gy of irradiation, the LD50 value of VR{Delta}41 was 1·0 p.f.u. per mouse, which was the same as the LD50 values of VR-3 and VR{Delta}41R in non-irradiated mice. Irradiation with 4 Gy just on the head had little effect on the LD50 value of VR{Delta}41. On the other hand, the virulence of the TK-deficient strain (VRTK-) isolated from the same parental strain was not enhanced by {gamma}-ray irradiation, because TK-deficient HSV cannot replicate in stationary neurons. These results indicate that the major cause of low virulence is the inhibition of VR{Delta}41 replication by a {gamma}-ray-sensitive cell population(s).


View this table:
[in this window]
[in a new window]
 
Table 1. The LD50 values for intra-cranial inoculation of HSV-1 strains in BALB/c mice

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Virulence of HSV-1 strains in {gamma}-ray-irradiated mice. The LD50 values of HSV-1 strains were determined by intra-cranial inoculation into 4-week-old mice which were irradiated with {gamma}-rays systemically at the dose indicated. {circ}, VR-3; {bullet}, VR{Delta}41R; {blacktriangleup}, VR{Delta}41; and {blacksquare}, VRTK- strains. The LD50 value of the VR{Delta}41 strain in mice, locally irradiated with 4 Gy {gamma}-rays on the head, is shown by an open triangle ({triangleup}).

 
The time-course of the virus yield in the brain was measured to clarify the time at which the non-specific defence function begins to act, and to what degree it reduces virus yield. As shown in Fig. 3Down, the wild-type strain, VR-3, and VR{Delta}41R replicated rapidly in the first 2 days to near 106 p.f.u. per brain. Gamma-ray-irradiated mice and non-irradiated mice started to die at 3 days or 5 days post-infection, respectively, and all mice with lethal infections died within 12 days post-infection. The VR{Delta}41 strain showed a comparable yield with those of the VR-3 and VR{Delta}41R strains at 1 day post-infection. However, the yield of VR{Delta}41 in non-irradiated mice was suppressed from 2 days post-infection, although low titres of virus were maintained. Irradiation with 4 Gy of {gamma}-rays caused the yield of VR{Delta}41 to increase; nevertheless, the titre was lower than those of VR-3 and VR{Delta}41 by more than one log, and the mice died between 10 and 23 days post-infection. On mock-infected mice, 4 Gy of {gamma}-ray irradiation induced no symptoms.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Replication of HSV-1 strains in mouse brain. Virus titres in the brains of mice which were systemically irradiated with {gamma}-rays at 0 ({circ}) or 4 Gy ({bullet}) were examined. (a) The VR-3 strain. (b) The VR{Delta}41 strain. (c) The VR{Delta}41R strain. The cross ({dagger}) indicates the day at which mice started to die of encephalitis.

 
Taken together, the results of the mouse encephalitis model indicate: (i) the defence function against VR{Delta}41 began 1 day after infection, (ii) the cells related to the suppression of VR{Delta}41 replication are sensitive to 4 Gy of {gamma}-ray irradiation and are distributed in the body but not in the brain at the time of virus inoculation, and (iii) migration into the brain and activation of the cells may be induced by some cytokine(s) secreted from {gamma}-ray-resistant resident cells in the brain.

Identification and quantification of cytokine gene expression in HSV-infected human cells
To identify the cytokines secreted from VR{Delta}41-infected cells, gene expression in mock-, VR-3-, VR{Delta}41- and VR{Delta}41R-infected human embryo fibroblast cells (HEL) and macrophage-like cell line U937 was screened semi-quantitatively, using Atlas cDNA expression arrays (Clontech). The amounts of mRNAs from the IL-1{alpha}, -1{beta}, -2 to -13, -15, -17 and -18, IFN-{alpha}, -{beta} and -{gamma}, tumour necrosis factor-{alpha} and 17 other kinds of chemokine genes could be evaluated by Atlas. Only three out of the 37 cytokine genes, the IL-1{beta}, IL-8 and MIP-1{alpha} genes, were expressed in VR{Delta}41-infected U937 cells at 1 h post-infection (Table 2Down). Expression of IL-1{beta} and IL-8 genes was enhanced about 2-fold by VR{Delta}41-infection as compared with mock-infected cells. On the other hand, only very low levels of the mRNAs detected in VR{Delta}41-infected cells were detected in VR-3-infected cells. In HEL cells, none of the cytokines examined in Atlas were detected in HSV-infected or mock-infected cells.


View this table:
[in this window]
[in a new window]
 
Table 2. Amounts of mRNA from cytokine genes in HSV-1-infected cells

 
In order to determine whether the expression of cytokine genes leads to cytokine production from the VR{Delta}41-infected cells, the amounts of IL-1{beta}, IL-8 and MIP-1{alpha} in mock- or HSV-infected HEL, macrophage and NB69 (human neuroblastoma cell line) cultures were measured by ELISA (Table 3Down). All tested cytokines were detected in mock-infected macrophage cultures. VR{Delta}41 infection enhanced cytokine expression, especially the expression of IL-8, which was increased about 200-fold, but the effect on cytokine production was weaker in VR-3- and VR{Delta}41R-infected macrophages. Similar results were observed with IL-8 expression in HSV-infected HEL cells, and with IL-1{beta} and MIP-1{alpha} expression in HSV-infected macrophages. IL-1{beta} and MIP-1{alpha} were not detected in mock- or HSV-infected HEL cells and none of the tested cytokines were detected in neuroblastoma cell lines.


View this table:
[in this window]
[in a new window]
 
Table 3. Amount of cytokines produced in mock- and HSV-1-infected cells

 
Susceptibility of HSV-1 strains to human IFNs
We could not detect mRNA from the IFN genes in HSV-1-infected cells, as described above. However, production of IFN-{alpha}/{beta} by HSV-1-infected mouse peritoneal macrophages and expression of IFN-{gamma} in acute nervous system infection of mouse by HSV-1 have been reported (Kirchner et al., 1983Down ; Cantin et al., 1995Down ). These reports suggested that IFN would play a role in the clearance of HSV. To clarify whether vhs function could affect the anti-HSV activity of IFN, the susceptibility of HSV-1 strains to human IFN-{alpha}, -{beta} and -{gamma} was examined. The 50% inhibitory concentrations of IFN-{alpha} and -{beta} for the VR{Delta}41 strain were 26·6 and 50·1 IU/ml, which were 5% and 18% of those for the VR-3 strain, respectively (Fig. 4Down). However, no effect of vhs was observed on the anti-HSV activity of IFN-{gamma}.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4. Susceptibility of HSV-1 strains to human IFNs. Confluent HEL cells were treated with the indicated concentrations of IFN for 16 h. The cells were infected with VR-3 ({circ}), VR{Delta}41 ({blacktriangleup}) and VR{Delta}41R ({bullet}) strains and incubated for 3 days with IFN at the same concentration as for pre-treatment. The number of plaques was counted, and is shown as a percentage relative to those of the untreated control. (a) Natural IFN-{alpha}. (b) Natural IFN-{beta}. (c) Recombinant IFN-{gamma}. There are significant differences (Student’s t-test, P<0·01) between the sensitivity of the VR{Delta}41 strain to IFN-{alpha} and -{beta} and those of the VR-3 and VR{Delta}41R strains.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The study of UL41 gene function has progressed in the 15 years since the isolation of HSV mutants defective in vhs function and the identification of the mutation site in the UL41 gene of these mutants (Read & Frenkel, 1983Down ; Kwong et al., 1988Down ). However, the role of the vhs function in virus replication and virulence in vivo has remained an unsolved problem. We studied the relationship between vhs function and the virulence of HSV-1 using a newly isolated UL41 deletion mutant and its revertant to solve this problem. The virus yield from one-step growth of the VR{Delta}41 strain in the mouse fibroblast cell line BALB/3T3 was 13% of that of the parental strain (data not shown). This deficient replication observed in vitro is likely to be no more than a marginal cause of the low virulence of VR{Delta}41, because there was no significant difference in the titres of the virus strains in the mouse brain 1 day after inoculation (Fig. 3Up). We could observe the evasion of non-specific host defence mechanisms by HSV-1 vhs function during the period between 2 days after infection and the establishment of specific immunity against HSV. Gamma-ray irradiation of mice at 4 Gy completely restored the virulence of VR{Delta}41, indicating that virulence was suppressed by {gamma}-ray-sensitive cells such as lymphocytes and/or neutrophils.

The results and suggestions obtained from experiments using the mouse encephalitis model appear to be supported by evidence that enhanced expression of three cytokine genes was detected in VR{Delta}41-infected human macrophage cells by screening using Atlas cDNA expression arrays (Table 2Up). All of these cytokines are concerned with activation of the non-specific defence mechanism and induction of inflammation: IL-1{beta} is an important inflammatory cytokine which activates natural killer cell activity and production of other cytokines such as IL-6 and chemokines, while IL-8 and MIP-1{alpha}, which are C-X-C and C-C chemokines, respectively, induce activation and migration of neutrophils and monocytes (Harada et al., 1994Down ; Baggiolini et al., 1995Down ). Moreover, the expression of these cytokine genes led to production of the cytokine peptides (Table 3Up). It is possible to conclude from these results that one important function of vhs is evasion of host non-specific defence mechanisms by suppressing activation and migration of granulocytes and monocytes through shutting off cytokine production in HSV-1-infected cells.

The rodent brain contains two populations of macrophages, the microglia, which reside anywhere in the central nervous system (CNS), and the CNS-associated macrophages, which reside within the vascular basement membrane in close proximity to blood vessels (Stoll & Jander, 1999Down ). Similar to macrophages in peripheral blood or tissues other than CNS, activated microglia and macrophages in CNS can synthesize a variety of soluble factors, including cytokines. Considering the function of microglia and CNS-associated macrophages with our result, since cytokines were produced by HSV-infected macrophages from peripheral blood but not in HSV-infected neuroblastoma cells (Table 3Up), the source of cytokines produced in the HSV-infected brain would be microglia and/or macrophages activated by HSV infection. Our results support this supposition in that irradiation with 4 Gy limited to the head had little effect on the LD50 value of VR{Delta}41, because microglia and macrophages are highly tolerant to {gamma}-ray irradiation (Fabrikant, 1972Down ).

In the screening of gene expression in HSV-infected cells by Atlas cDNA expression arrays, we could only detect IL-8 gene expression in U937 cells with VR-3 infection (Table 2Up), although not only IL-8 peptide from macrophages but also IL-1{beta} and MIP-1{alpha} peptides from macrophages, and IL-8 peptide from HEL cells were detected. These results indicated two possibilities. (i) mRNAs, which could not be detected 1 h post-infection in our assay, are expressed at a later period in HSV-infected cells. (ii) The sensitivity of mRNA detection by Atlas cDNA expression arrays may be lower than that of ELISA in the detection of peptides. In our preliminary study, we could observe 13·0 and 40·8 copies per cell of IL-8 mRNA in VR-3-infected and VR{Delta}41-infected HEL cells, respectively, after a 1 h adsorption period, by quantitative RT–PCR, although these were not detected by Atlas. This expression of the IL-8 gene was observed only at the very early stage of infection (data not shown) and part of the down-regulation at a later stage of infection would be caused by the delayed shutoff function of HSV. These observations seem to support the latter possibility described above. Therefore, it is possible that VR{Delta}41-infection enhanced the production of a number of cytokines in macrophages of which we identified only IL-1{beta}, IL-8 and MIP-1{alpha}.

Recently, a number of studies have been performed on the molecular mechanisms of virus evasion of host defence systems. The evasive functions of four proteins encoded by the HSV genome have previously been demonstrated, i.e. a complex of glycoprotein E (gE; encoded by the US8 gene) and gI (encoded by the US7 gene) forms an Fc receptor on the surface of infected cells and virions, and the Fc receptor forms antibody bipolar bridges resulting in the escape from neutralization of virions and infected cells by complement and antibody-dependent killer cells (Para et al., 1982Down ; Johansson et al., 1986Down ; Johnson & Feenstra, 1987Down ; Frank & Friedman, 1989Down ). Also, complement activity is suppressed by gC (encoded by UL44), which is a C3b receptor (Friedman et al., 1984Down ; McNearney et al., 1987Down ; Van Strijp et al., 1988Down ). ICP47, one of the immediate-early proteins encoded by the US12 gene, inhibits antigen presentation on the surface of infected cells by inhibition of peptide transporter (TAP), mediating the escape from cytotoxic T cells (York et al., 1994Down ; Früh et al., 1995Down ; Ahn et al., 1996Down ; Tomazin et al., 1996Down ). In this study, we showed that the vhs protein is a fifth protein mediating evasion of host defence mechanisms.

It is assumed that the vhs function affects all mRNAs, including viral mRNAs; therefore, vhs might be able to target modifications of various cellular functions and viral functions. In this study, we focused on the early stage of primary HSV infection and showed one of the vhs functions to be evasion of non-specific defence mechanisms. However, this evasion might be only a part of the vhs function even in evasion from host defence, since a previous report showed that vhs reduces major histocompatibility complex (MHC) class I molecules on the plasma membrane of HSV-infected cells and a vhs-deficient strain induces strong immunity as a vaccine strain (Hill et al., 1994Down ; Walker & Leib, 1998Down ; Walker et al., 1998Down ). A radical strategy like that of vhs, which non-specifically suppresses the synthesis of various proteins, regardless of whether they are beneficial or harmful factors, would be possible in the replication cycle of HSV, which is completed in 12 h, but not in cytomegalovirus replication. Further studies of the roles of vhs will advance our understanding of virus–host interactions.


   Acknowledgments
 
The technical assistance of Dr Kazuhiro Nakaya and Chiaki Hatanaka is greatly appreciated. This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Ahn, K., Meyer, T. H., Uebel, S., Sempé, P., Djaballah, H., Yang, Y., Peterson, P. A., Früh, K. & Tampé, R. (1996). Molecular mechanism and species specificity of TAP inhibition by herpes simplex virus protein ICP47.EMBO Journal15, 3247-3255.[Medline]

Baggiolini, M., Loetscher, P. & Moser, B. (1995). Interleukin-8 and the chemokine family.International Journal of Immunopharmacology 17, 103-108.[Medline]

Becker, Y., Tavor, E., Asher, Y., Berkowitz, C. & Moyal, M. (1993). Effect of herpes simplex virus type 1 UL41 gene on the stability of mRNA from the cellular genes: {beta}-actin, fibronectin, glucose transporter-1, and docking protein, and on virus intraperitoneal pathogenicity to newborn mice.Virus Genes7, 133-143.[Medline]

Cantin, E. M., Hinton, D. R., Chen, J. & Openshaw, H. (1995). Gamma interferon expression during acute and latent nervous system infection by herpes simplex virus type 1.Journal of Virology69, 4898-4905.[Abstract]

Daikoku, T., Shibata, S., Goshima, F., Oshima, S., Tsurumi, T., Yamada, H., Yamashita, Y. & Nishiyama, Y. (1997). Purification and characterization of the protein kinase encoded by the UL13 gene of herpes simplex virus type 2.Virology235, 82-93.[Medline]

Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J. (1998). The genome sequence of herpes simplex virus type 2.Journal of Virology72, 2010-2021.[Abstract/Free Full Text]

Fabrikant, J. I. (1972). Radiobiology. Chicago: Year Book Medical Publishers.

Fenwick, M. L. & Walker, M. J. (1978). Suppression of the synthesis of cellular macromolecules by herpes simplex virus. Journal of General Virology41, 37-51.[Abstract/Free Full Text]

Frank, I. & Friedman, H. M. (1989). A novel function of the herpes simplex virus type 1 Fc receptor: participation in bipolar bridging of antiviral immunoglobulin G.Journal of Virology63, 4479-4488.[Abstract/Free Full Text]

Friedman, H. M., Cohen, G. H., Eisenberg, R. J., Seidel, C. A. & Cines, D. B. (1984). Glycoprotein C of herpes simplex virus 1 acts as a receptor for the C3b complement component on infected cells.Nature309, 633-635.[Medline]

Früh, K., Ahn, K., Djaballah, H., Sempé, P., Van Endert, P. M., Tampé, R., Peterson, P. A. & Yang, Y. (1995). A viral inhibitor of peptide transporters for antigen presentation.Nature375, 415-418.[Medline]

Gidlund, M., Örn, A., Pattengale, P. K., Jansson, M., Wigzell, H. & Nilsson, K. (1981). Natural killer cells kill tumor cells at a given stage of differentiation.Nature292, 848-850.[Medline]

Harada, A., Sekido, N., Akahoshi, T., Wada, T., Mukaido, N. & Matsushima, K. (1994). Essential involvement of interleukin-8 (IL-8) in acute inflammation.Journal of Leukocyte Biology56, 559-564.[Abstract]

Hayashi, K., Kurata, T., Morishima, T. & Nassery, T. (1980). Analysis of the inhibitory effect of peritoneal macrophages on the spread of herpes simplex virus. Infection and Immunity28, 350-358.[Abstract/Free Full Text]

Hill, A. B., Barnett, B. C., McMichael, A. J. & McGeoch, D. J. (1994). HLA class I molecules are not transported to the cell surface in cells infected with herpes simplex virus types 1 and 2.Journal of Immunology152, 2736-2741.[Abstract]

Johansson, P. J. H., Schröder, A. K., Nardella, F. A., Mannik, M. & Christensen, P. (1986). Interaction between herpes simplex type 1-induced Fc receptor and human and rabbit immunoglobulin G (IgG) domains.Immunology58, 251-255.[Medline]

Johnson, R. T. (1964). The pathogenesis of herpes encephalitis. II. A cellular basis for the development of resistance with age.Journal of Experimental Medicine120, 359-374.[Abstract]

Johnson, D. C. & Feenstra, V. (1987). Identification of a novel herpes simplex virus type 1-induced glycoprotein which complexes with gE and binds immunoglobulin.Journal of Virology61, 2208-2216.[Abstract/Free Full Text]

Kirchner, H., Engler, H., Schröder, C. H., Zawatzky, R. & Storch, E. (1983). Herpes simplex virus type 1-induced interferon production and activation of natural killer cells in mice. Journal of General Virology64, 437-441.[Abstract/Free Full Text]

Kwong, A. D. & Frenkel, N. (1987). Herpes simplex virus-infected cells contain a function(s) that destabilizes both host and viral mRNAs.Proceedings of the National Academy of Sciences, USA84, 1926-1930.[Abstract/Free Full Text]

Kwong, A. D., Kruper, J. A. & Frenkel, N. (1988). Herpes simplex virus virion host shutoff function.Journal of Virology62, 912-921.[Abstract/Free Full Text]

Lam, Q., Smibert, C. A., Koop, K. E., Lavery, C., Capone, J. P., Weinheimer, S. P. & Smiley, J. R. (1996). Herpes simplex virus VP16 rescues viral mRNA from destruction by the virion host shutoff function.EMBO Journal15, 2575-2581.[Medline]

McLauchlan, J., Addison, C., Craigie, M. C. & Rixon, F. J. (1992). Noninfectious L-particles supply functions which can facilitate infection by HSV.Virology190, 682-688.[Medline]

McNearney, T. A., Odell, C., Holers, V. M., Spear, P. G. & Atkinson, J. P. (1987). Herpes simplex virus glycoprotein gC-1 and gC-2 bind to the third component of complement and provide protection against complement-mediated neutralization of viral infectivity.Journal of Experimental Medicine166, 1525-1535.[Abstract/Free Full Text]

Martin, T. E., Barghusen, S. C., Leser, G. P. & Spear, P. G. (1987). Redistribution of nuclear ribonucleoprotein antigens during herpes simplex virus infection.Journal of Cell Biology105, 2069-2082.[Abstract/Free Full Text]

Nishioka, Y. & Silverstein, S. (1977). Degradation of cellular mRNA during infection by herpes simplex virus.Proceedings of the National Academy of Sciences, USA74, 2370-2374.[Abstract/Free Full Text]

Nishioka, Y. & Silverstein, S. (1978). Requirement of protein synthesis for the degradation of host mRNA in Friend erythroleukemia cells infected with herpes simplex virus type 1.Journal of Virology27, 619-627.[Abstract/Free Full Text]

Oshima, S., Daikoku, T., Shibata, S., Yamada, H., Goshima, F. & Nishiyama, Y. (1998). Characterization of the UL16 gene product of herpes simplex virus type 2.Archives of Virology143, 863-880.[Medline]

Overton, H., McMillan, D., Hope, L. & Wong-kai-in, P. (1994). Production of host shutoff-defective mutants of herpes simplex virus type 1 by inactivation of the UL13 gene.Virology202, 97-106.[Medline]

Para, M. F., Baucke, R. & Spear, P. G. (1982). Glycoprotein gE of herpes simplex virus type 1: effects of anti-gE on virion infectivity and on virus-induced Fc-binding receptors.Journal of Virology41, 129-136.[Abstract/Free Full Text]

Phelan, A., Carmo-Fonseca, M., McLauchlan, J., Lamond, A. I. & Clements, J. B. (1993). A herpes simplex virus type 1 immediate-early gene product, IE63, regulates small nuclear ribonucleoprotein distribution.Proceedings of the National Academy of Sciences, USA90, 9056-9060.[Abstract/Free Full Text]

Read, G. S. & Frenkel, N. (1983). Herpes simplex virus mutants defective in the virion-associated shutoff of host polypeptide synthesis and exhibiting abnormal synthesis of (immediate early) viral polypeptides.Journal of Virology46, 498-512.[Abstract/Free Full Text]

Read, G. S., Karr, B. M. & Knight, K. (1993). Isolation of a herpes simplex virus type 1 mutant with a deletion in the virion host shutoff gene and identification of multiple forms of the vhs (UL41) polypeptide.Journal of Virology67, 7149-7160.[Abstract/Free Full Text]

Roizman, B., Borman, G. S. & Rousta, M.-K. (1965). Macromolecular synthesis in cells infected with herpes simplex virus.Nature206, 1374-1375.[Medline]

Sandri-Goldin, R. M. & Mendoza, G. E. (1992). A herpes simplex virus regulatory protein appears to act posttranscriptionally by affecting mRNA processing.Genes & Development6, 848-863.[Abstract/Free Full Text]

Schek, N. & Bachemheimer, S. L. (1985). Degradation of cellular mRNAs induced by a virion-associated factor during herpes simplex virus infection of Vero cells.Journal of Virology55, 601-610.[Abstract/Free Full Text]

Schmelter, J., Knez, J., Smiley, J. R. & Capone, J. P. (1996). Identification and characterization of a small modular domain in the herpes simplex virus host shutoff protein sufficient for interaction with VP16. Journal of Virology70, 2124-2131.[Abstract]

Smibert, C. A., Johnson, D. C. & Smiley, J. R. (1992). Identification and characterization of the virion-induced host shutoff product of herpes simplex virus gene UL41.Journal of General Virology73, 467-470.[Abstract/Free Full Text]

Stoll, G. & Jander, S. (1999). The role of microglia and macrophages in the pathophysiology of the CNS.Progress in Neurobiology58, 233-247.[Medline]

Strelow, L. I. & Leib, D. A. (1995). Role of the virion host shutoff (vhs) of herpes simplex virus type 1 in latency and pathogenesis.Journal of Virology69, 6779-6786.[Abstract]

Strom, T. & Frenkel, N. (1987). Effects of herpes simplex virus on mRNA stability.Journal of Virology61, 2198-2207.[Abstract/Free Full Text]

Suzutani, T., Machida, H., Sakuma, T. & Azuma, M. (1988). Effects of various nucleosides on antiviral activity and metabolism of 1-{beta}-D-arabinofuranosyl-E-5-(2-bromovinyl)uracil against herpes simplex virus types 1 and 2. Antimicrobial Agents and Chemotherapy 32, 1547-1551.[Abstract/Free Full Text]

Suzutani, T., Koyano, S., Takada, M., Yoshida, I. & Azuma, M. (1995). Analysis of the relationship between cellular thymidine kinase activity and virulence of thymidine kinase-negative herpes simplex virus types 1 and 2.Microbiology and Immunology39, 787-794.[Medline]

Sydiskis, R. J. & Roizman, B. (1966). Polysomes and protein synthesis in cells infected with a DNA virus.Science153, 76-78.[Abstract/Free Full Text]

Tomazin, R., Hill, A. B., Jugovic, P., York, I., Van Endert, P., Ploegh, H. L., Andrews, D. W. & Johnson, D. C. (1996). Stable binding of the herpes simplex virus ICP47 protein to the peptide binding site of TAP. EMBO Journal15, 3256-3266.[Medline]

Van Strijp, J. A. G., Van Kessel, K. P. M., Miltenburg, L. A. M., Fluit, A. C. & Verhoef, J. (1988). Attachment of human polymorphonuclear leukocytes to herpes simplex virus-infected fibroblasts mediated by antibody-independent complement activation.Journal of Virology62, 847-850.[Abstract/Free Full Text]

Walker, J. & Leib, D. A. (1998). Protection from primary infection and establishment of latency by vaccination with a herpes simplex virus type 1 recombinant deficient in the virion host shutoff (vhs) function.Vaccine16, 1-5.[Medline]

Walker, J., Laycock, K. A., Pepose, J. S. & Leib, D. A. (1998). Postexposure vaccination with a virion host shutoff defective mutant reduces UV-B radiation-induced ocular herpes simplex virus shedding in mice.Vaccine16, 6-8.[Medline]

York, I. A., Roop, C., Andrews, D. W., Riddell, S. R., Graham, F. L. & Johnson, D. C. (1994). A cytosolic herpes simplex virus protein inhibits antigen presentation to CD8+ T lymphocytes.Cell77, 525-535.[Medline]

Zelus, B. D., Stewart, R. S. & Ross, J. (1996). The virion host shutoff protein of herpes simplex virus type 1: messenger ribonucleolytic activity in vitro.Journal of Virology70, 2411-2419.[Abstract]

Received 3 November 1999; accepted 8 March 2000.


This article has been cited by other articles:


Home page
J. Virol.Home page
N. Sarma, D. Agarwal, L. A. Shiflett, and G. S. Read
Small Interfering RNAs That Deplete the Cellular Translation Factor eIF4H Impede mRNA Degradation by the Virion Host Shutoff Protein of Herpes Simplex Virus
J. Virol., July 1, 2008; 82(13): 6600 - 6609.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. J. Pasieka, B. Lu, and D. A. Leib
Enhanced Pathogenesis of an Attenuated Herpes Simplex Virus for Mice Lacking Stat1
J. Virol., June 15, 2008; 82(12): 6052 - 6055.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. J. Pasieka, B. Lu, S. D. Crosby, K. M. Wylie, L. A. Morrison, D. E. Alexander, V. D. Menachery, and D. A. Leib
Herpes Simplex Virus Virion Host Shutoff Attenuates Establishment of the Antiviral State
J. Virol., June 1, 2008; 82(11): 5527 - 5535.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Korom, K. M. Wylie, and L. A. Morrison
Selective Ablation of Virion Host Shutoff Protein RNase Activity Attenuates Herpes Simplex Virus 2 in Mice
J. Virol., April 1, 2008; 82(7): 3642 - 3653.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. T. Sciortino, B. Taddeo, M. Giuffre-Cuculletto, M. A. Medici, A. Mastino, and B. Roizman
Replication-Competent Herpes Simplex Virus 1 Isolates Selected from Cells Transfected with a Bacterial Artificial Chromosome DNA Lacking Only the UL49 Gene Vary with Respect to the Defect in the UL41 Gene Encoding Host Shutoff RNase
J. Virol., October 15, 2007; 81(20): 10924 - 10932.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Barzilai, I. Zivony-Elbom, R. Sarid, E. Noah, and N. Frenkel
The Herpes Simplex Virus Type 1 vhs-UL41 Gene Secures Viral Replication by Temporarily Evading Apoptotic Cellular Response to Infection: Vhs-UL41 Activity Might Require Interactions with Elements of Cellular mRNA Degradation Machinery
J. Virol., January 1, 2006; 80(1): 505 - 513.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Feng, D. N. Everly Jr., and G. S. Read
mRNA Decay during Herpes Simplex Virus (HSV) Infections: Protein-Protein Interactions Involving the HSV Virion Host Shutoff Protein and Translation Factors eIF4H and eIF4A
J. Virol., August 1, 2005; 79(15): 9651 - 9664.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W.-L. Hsu, H. A. Saffran, and J. R. Smiley
Herpes Simplex Virus Infection Stabilizes Cellular IEX-1 mRNA
J. Virol., April 1, 2005; 79(7): 4090 - 4098.
[Abstract] [Full Text] [PDF]