J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mahé, D.
Right arrow Articles by Jestin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahé, D.
Right arrow Articles by Jestin, A.
Agricola
Right arrow Articles by Mahé, D.
Right arrow Articles by Jestin, A.
Journal of General Virology (2000), 81, 1815-1824.
© 2000 Society for General Microbiology


Animal: DNA Viruses

Differential recognition of ORF2 protein from type 1 and type 2 porcine circoviruses and identification of immunorelevant epitopes

Dominique Mahé1, Philippe Blanchard1, Catherine Truong1, Claire Arnauld1, Pierre Le Cann1, Roland Cariolet1, François Madec1, Emmanuel Albina1 and André Jestin1

Agence Française de Sécurité Sanitaire des Aliments, Laboratoire de Biologie Moléculaire, BP 53, 22440 Ploufragan, France1

Author for correspondence: Dominique Mahé. Fax +33 2 96 01 62 83. e-mail d.mahe{at}ploufragan.afssa.fr


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Two types of porcine circovirus (PCV) have been isolated and are referred to as PCV1 and PCV2. PCV1 represents an apathogenic virus, whereas PCV2 is associated with post-weaning multisystemic wasting syndrome. The two PCVs are related, since they display about 70% identity based on nucleotide sequences. In order to discriminate between common and type-specific antigens, an immunocytological approach was used following transfections with cloned circovirus DNAs, as well as recombinant proteins expressed by either baculovirus or plasmid vectors. The ORF1-encoded proteins in the two viruses were shown to be antigenically related, whereas the ORF2 proteins were recognized differentially by polyclonal anti-PCV2 antibodies. Furthermore, PEPSCAN analysis performed on overlapping fragments of the genes encoding part of ORF1 and the entire ORF2 and ORF3 led to the identification of five dominant immunoreactive areas, one located on ORF1 and four on ORF2. However, only some ORF2 peptides proved to be immunorelevant epitopes for virus type discrimination. The potential use of ORF2-derived antigens as diagnostic tools is demonstrated.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Porcine circovirus type 1 (PCV1) was identified as a persistent non-cytopathic contaminant of the continuous porcine kidney cell line PK-15 and was characterized as a small, non-enveloped virus with a capsid size of 17 nm (Tischer et al., 1982Down ). This small virus was classified in a newly recognized virus family, the Circoviridae (Lukert et al., 1995Down ), along with other animal viruses including beak and feather disease virus of psittacine birds (Bassami et al., 1998Down ; Niagro et al., 1998Down ) and chicken anaemia virus (Todd et al., 1990Down ). Whereas PCV was reassigned as the type member of the genus Circovirus, chicken anaemia virus has been proposed to represent the type member of a new genus, Gyrovirus,within this family (Pringle, 1999Down ). Common characteristic features of the circoviruses are their small size and their circular single-stranded DNA genomes. The PCV1 genome consists of a circular single-stranded DNA of 1759 nt (Meehan et al., 1997Down ). The replicative form contains seven putative ORFs with the potential to encode proteins larger than 5 kDa. Two of them represent major ORFs; ORF1, which encodes a protein of 35·7 kDa involved in virus replication (Mankertz et al., 1998aDown ), and ORF2, whose product of 27·8 kDa is suspected to represent the major structural capsid protein. Serological surveys have demonstrated a high prevalence of anti-PCV1 antibodies in the swine population (Dulac & Afshar, 1989Down ; Edwards & Sands, 1994Down ; Hines & Lukert, 1995Down ; Tischer et al., 1995Down ), although no disease could be assigned to this virus either in PCV1-positive farms or after experimental transmission (Allan et al., 1995Down ; Tischer et al., 1986Down ). PCV1 was therefore considered to be non-pathogenic.

Recently, a new situation has appeared with the emergence, in France and other European countries as well as in North America, of a new porcine disease known as post-weaning multisystemic wasting syndrome (PMWS). The disease is characterized clinically by fever and progressive weight loss, as well as respiratory and digestive disorders (Allan et al., 1998aDown , bDown ; Kennedy et al., 1998Down ; Kiupel et al., 1998Down ; Le Cann et al., 1997Down ; Morozov et al., 1998Down ; Nayar et al., 1997Down ; Segalés et al., 1997Down ). Morbidity rates ranging from 5 to 30% have been reported in affected batches of pigs (Madec et al., 2000Down ). Virus isolation from the tissues of pigs affected with PMWS led to the identification of PCV-like antigens and nucleic acids (Ellis et al., 1998Down ; Nayar et al., 1997Down ). These viruses were found to form a closely related group, exhibiting more than 96% sequence identity (Allan et al., 1998bDown ; Meehan et al., 1998Down ). However, they were significantly different from the PCV1 strain, thus representing a new type of porcine circovirus, which has been termed PCV2. Although they display similar genomic organization, their genomes share only about 70% sequence identity. Higher sequence conservation could be observed in the replicative ORF1-encoded protein (Rep protein).

PCV2s are believed to be of aetiological importance in PMWS (Allan et al., 1999aDown ; Balasch et al., 1999Down ; Ellis et al., 1999Down ) and the need for type-specific serological assays is therefore significant in examining the prevalence of PCV2 infection. The aim of the present study was to characterize the expression of the major viral proteins, to analyse their immunological properties and thereby to determine the extent of cross-reactivity between viral antigens from PCV types 1 and 2.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} PCR amplification and cloning
DNA extraction.
Lymph nodes from PMWS-affected piglets were kept frozen at -80 °C prior to DNA extraction. DNA was extracted by using the Qiagen tissue kit according to the manufacturer’s recommendations and used for all subsequent PCV1 and PCV2 PCR assays.

PCR amplification and cloning of PCV genomes.
The PCV1 genome was cloned by utilizing an inverse PCR approach with forward (5' GGCGGCGCCATCTGTAACGGTTT 3') and reverse (5' GATGGCGCCGAAAGACGGGTATC 3') primers, each containing a NarI restriction endonuclease site (underlined). These primers were designed according to the PCV1 sequence presented in the accession number AF012107 (Mankertz et al., 2000Down ) except that the forward primer was modified by two nucleotides in its 5' end without affecting the PCV1 sequence between the NarI sites. The PCV2 genome was cloned in a same inverse PCR approach by using forward (5' GTGGAGCTCCTAGATCTCAGGG 3') and reverse (5' TAGGAGCTCCACACTCCATCAG 3') primers deduced from the PCV2 sequence presented in the accession number AF201311 (Mankertz et al., 2000Down ). Each primer contains a SacI restriction endonuclease site (underlined).

Amplifications were performed with 0·4 µM of each primer, 0·1 mM of each dNTP and 2·5 U Taq DNA polymerase (Boehringer) with the following cycling parameters: denaturation at 94 °C, 5 min; 35 cycles (94 °C, 30 s; annealing at 60 °C, 30 s; 72 °C, 90 s); final elongation at 72 °C, 10 min. PCR products were then cloned into the pPCR-Script SK vector by using the pCR-Script Amp cloning kit (Stratagene). The clones were sequenced on both strands with an ABI 373 sequencer by using the M13 forward and reverse universal primers as well as circovirus genome-specific primers and the ABI Prism Dye terminator cycle sequencing kit (PE Biosystems).

Cloning of PCV genes.
The genes encoding ORF1 and ORF2 from both PCVs were amplified by PCR prior to cloning into the pcDNA3.1 mammalian expression vector (Invitrogen) and into either pVL1393 or pAcGHLT baculovirus transfer vectors (Pharmingen), the latter allowing the expression of glutathione S-transferase (GST)- and 6xHis-fused proteins. The following PCR primer pairs were used for PCV gene amplifications: for PCV1, ORF1 was amplified with ORF1.1 forward (5' CGGGATCCCAGTGAAAATGCCAAGCAAGAAAAG 3') and reverse (5' CGGGATCCCGATGTGATAACAAAAAAGACTCAG 3') primers, whereas ORF2 was amplified with ORF2.1 forward (5' CGGGATCCCTTTTTTGTTATCACATCGTAATGG 3') and reverse (5' CGGGATCCTCTTTCACTTTTATAGGATGACGTG 3') primers. For PCV2 gene amplification, ORF1.2 forward (5' ATGGATCCAGCAGACACATGCCCAGCAAG 3') and reverse (5' GGGGATCCGAAGTGATAAAAAAGACTCAG 3') primers were used to generate the ORF1 gene whereas ORF2 was amplified by using ORF2.2 forward (5' CCGGATCCTCCATTAAGGGTTAAGTGGG 3') and reverse (5' CCGGATCCTCAGATATGACGTATCCAAG 3') primers. All primers included a BamHI cloning site in their 5' end. Amplifications were performed as already mentioned except for the annealing temperature, which was 55 °C, and the elongation time, which was shortened to 45 s.

PCR products corresponding to the PCV2 genes were cloned into the pPCR-Script SK plasmid as indicated above. Recombinant clones were sequenced to ensure that the sequences did not contain mutations. The recombinant plasmids were then digested with BamHI. The purified fragment encoding the ORF1-PCV2 protein was subcloned into BamHI-cut pcDNA3.1 and pVL1393 plasmids, whereas the purified fragment encoding the ORF2-PCV2 protein was subcloned into BamHI-digested pcDNA3.1 and BglII-digested pAcGHLT.

For the PCV1 genes, PCR products were cloned directly into pcDNA3.1 vector after digestion with BamHI. Sequencing was performed for both constructs. The fragments encoding ORF1-PCV1 and ORF2-PCV1 were then purified and cloned into BamHI-digested pVL1393 and BglII-digested pAcGHLT, respectively.

{blacksquare} Antisera
Anti-PCV2 antisera.
Lymph nodes obtained from PMWS-affected pigs and checked by PCR for the presence of PCV2 and the absence of PCV1 genomes were homogenized and ultrafiltered (0·45 µm) before intramuscular and intratracheal inoculations to either specific-pathogen-free (SPF) or conventional 6-week-old pigs. Sera were collected before virus inoculation and weekly for a maximum of 6 weeks post-infection (p.i.).

Hyperimmune sera.
Hyperimmune serum against ORF2-PCV2 was generated in SPF pigs that received two intramuscular injections of 200 µg of each pcDNA3.1 plasmid encoding ORF2-PCV2 and porcine granulocyte/macrophage colony-stimulating factor at 3 week intervals. Animals were then boosted 3 weeks later with 1 ml Sf9 cells (5x106) infected by a recombinant baculovirus encoding the ORF2-PCV2 protein and 1 ml Montanide adjuvant (Seppic). Blood was harvested 3 weeks after the last injection.

Polyclonal antibodies to ORF1-PCV1 were generated by immunizing mice (Agro-Bio). BALB/c mice received four injections of 50 µg of the corresponding recombinant pcDNA3.1 vector at 2 week intervals and two additional injections at 8 and 10 weeks.

{blacksquare} Transfection/infection assays.
The permanent PK-15 cell line, which was free of PCV, was maintained in minimal essential medium (E-MEM, Biowhittaker) supplemented with 5% heat-inactivated foetal calf serum, penicillin and streptomycin. Cells were seeded in 24-well plates (3·5x104 cells per well) and grown to 60–70% confluence. After one wash with OptiMEM medium (Gibco BRL), cells were transfected for 8 h with 0·1 µg DNA (either plasmids encoding viral genes or viral genomes) and 2·25 µg Transfectam reagent (Promega), according to the manufacturer’s protocol, except that OptiMEM was used for material dilution instead of serum-free E-MEM. For genome transfections, NarI-digested PCV1 and SacI-digested PCV2, obtained from the corresponding cloned genomes, were gel-purified and recircularized in the presence of T4 DNA ligase (Boehringer) overnight at room temperature before being transfected. Cells were then overlaid with complete medium and viral protein expression was analysed by an immunoperoxidase monolayer assay (IPMA) as described below, 48 h after gene transfections or 72 h after genome transfections. In the case of genome transfections, cells were additionally treated 24 h after transfection with 300 mM D-glucosamine as described previously (Tischer et al., 1987Down ).

For the infection test, genome-transfected cells were subjected to three successive freeze–thaw cycles. Following a centrifugation step at 2000 g for 5 min, lysate supernatants were collected and used to infect PCV-free PK-15 cells. Freshly trypsinized cells were seeded into 96-well plates and, once semi-confluent, they were inoculated for 1 h at 37 °C with lysate supernatant. They were then subjected to glucosamine treatment as described above and analysed by IPMA 72 h after infection.

For IPMA analysis, cells were fixed and permeabilized at -20 °C with 80% cold acetone and washed with PBS. The cells were then incubated for 1 h at 37 °C with 4% dry milk (Bio-Rad) in PBS containing 0·05% Tween 20 (PBS/Tw) and 0·1% Triton X-100 and incubated for a further 90 min at 37 °C with antisera diluted 100 times in PBS/Tw containing 2% dry milk. After three washes with PBS containing 0·25% Tween 20, cells were incubated for 90 min at 37 °C with HRP-conjugated rabbit anti-mouse or anti-swine IgG (Dako) in PBS/Tw containing 2% dry milk and washed again. Staining was developed in the presence of 9-aminoethyl carbazole (Sigma) in dimethylformamide as well as hydrogen peroxide and was stopped by substrate removal.

{blacksquare} Generation and production of recombinant baculoviruses.
Sf9 cells, maintained in TC100 medium (Gibco BRL) supplemented with 5% foetal calf serum, were co-transfected with 500 ng linearized Baculogold baculovirus DNA (Pharmingen) and 5 µg recombinant baculovirus transfer vector by using the DOTAP transfection reagent (Boehringer) according to the supplier’s instructions. Recombinant baculoviruses were plaque-purified and amplified.

{blacksquare} Expression and identification of recombinant proteins.
Sf9 cells were infected with wild-type Autographa californica multiple nuclear polyhedrosis virus or recombinant baculoviruses at an m.o.i. of 10 p.f.u. per cell. The cells were harvested 72 h p.i. and protein expression was analysed by immunoblot. Total proteins from 105 cells were then separated on a 10% SDS–polyacrylamide gel and transferred onto a nitrocellulose membrane (Bio-Rad). The proteins were identified by using either an anti-GST polyclonal antibody (Pharmingen) or an anti-PCV antiserum and a peroxidase-labelled rabbit anti-mouse or anti-swine IgG conjugate (Dako).

{blacksquare} PEPSCAN analysis.
The simultaneous synthesis of peptide sequences was carried out on a cellulose membrane by Fmoc amino acid chemistry (SYNT:EM). Overlapping peptides covering the last 214 and 213 amino acids, respectively, of ORF1 from PCV1 and PCV2 (102 peptides) as well as the complete sequence of ORF2 (112 peptides) and ORF3 (73 peptides) from both PCVs were synthesized on the membrane. The peptides, which were 15 amino acids in length, overlapped by 11 amino acids and differed by a four amino acid shift. Antibody reactivity to the membrane-bound peptides was analysed by an indirect colorimetric immunoassay according to the manufacturer’s recommendations (SYNT:EM).

Briefly, the membranes were incubated overnight in blocking buffer at 4 °C. After washing once in 50 mM Tris–HCl, pH 7, containing 150 mM NaCl, 30 mM KCl and 0·05% Tween 20, the membranes were incubated with serum diluted 100 times in blocking buffer. Development was performed in the presence of BCIP, MTT and MgCl2. Spots corresponding to peptides with antibody reactivity produced a positive blue signal, which was quantified by using the NIH 3.1 Image software.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Antigenic profile study following transfection with cloned PCV genomes
PK-15 cells transfected with the replicative form of either PCV1 or PCV2 were screened by IPMA for the presence of viral antigens by using experimental antisera (Fig. 1Down). Parallel infection assays were performed after transfection to ensure that the cloned PCV genomes used were functional in producing infectious virus particles. As shown in Fig. 1(a)Down, the serum generated in SPF pig after PCV2 infection revealed the presence of immunoreactive proteins in PCV1- and PCV2-transfected cells, thus indicating the existence of serological cross-reactivity between proteins from the two types of PCV. Hyperimmune sera generated against the major ORF1- and ORF2-encoded viral proteins were used to define better the extent of this serological cross-reaction. The serum generated against ORF1-PCV1 protein revealed a nuclear signal in PCV1- and also in PCV2-transfected cells (Fig. 1aDown), thus demonstrating the existence of common antigenic determinants between ORF1-encoded proteins. However, hyperimmune serum generated against ORF2-PCV2 could only detect the protein in PCV2-transfected cells, whereas no signal was observed in cells transfected with PCV1 genome (Fig. 1aDown). These results were confirmed further by IPMA on cells infected with PCV1 and PCV2 (Fig. 1bDown).



View larger version (101K):
[in this window]
[in a new window]
 
Fig. 1. PK-15 cells were either (a) transfected with cloned genomic DNA or (b) infected. In each case, PCV1 (left panels), PCV2 (middle panels) or the absence of PCV material (control, right panels) was used. Viral antigens were detected by IPMA with either experimental anti-PCV2 antiserum generated in SPF piglet and collected 6 weeks p.i. (row labelled 1) or polyclonal antibodies raised in mouse against PCV1-ORF1 (row 2) and in swine against PCV2-ORF2 (row 3).

 
Immunoreactivity study on recombinant proteins
In order to check the potential absence of cross-reactivity between the two ORF2 proteins and to confirm the presence of common immunoreactive epitopes on the ORF1 proteins, the corresponding coding sequences were cloned into either plasmid or baculovirus expression vectors and expressed as recombinant proteins in mammalian and insect cells, respectively. When tested on PK-15 cells transfected with the recombinant vector expressing ORF2 protein from PCV1 or PCV2, both anti-PCV2 antiserum and ORF2-PCV2 hyperimmune antiserum could detect ORF2 from PCV2, whereas they both failed to detect ORF2 from PCV1 (Fig. 2Down). The same proteins were also expressed as GST-fused proteins in the baculovirus system. The synthesis of the recombinant proteins in infected Sf9 cells was monitored by Western blot with a GST-specific antibody. In each case, a band of the expected size (GST plus ORF) was identified (Fig. 3bDown), thus attesting to the correct expression of both proteins. However, whereas the ORF2-PCV2 protein was recognized by a serum generated in pig following PCV2 infection, no reactivity could be observed for the ORF2-PCV1 protein (Fig. 3aDown). The absence of serological cross-reactivity when experimental anti-PCV2 antisera were used was further confirmed with sera collected at different times p.i. (Table 1Down). Indeed, ORF2 immunoreactivity could be detected only for PCV2 antigens and appeared from 2 weeks p.i. As expected for ORF1-encoded proteins, the proteins from both viruses could be detected by anti-PCV2 and anti-ORF1 antisera (not shown). Moreover, the kinetic analysis of antisera following experimental infection, which was performed on ORF1 from PCV2 alone, indicated a later appearance of anti-ORF1 antibodies after infection compared with the anti-ORF2 antibodies (Table 1Down).



View larger version (155K):
[in this window]
[in a new window]
 
Fig. 2. PK-15 cells were transfected with expression vectors encoding ORF2-PCV1 (a, b) or ORF2-PCV2 (c, d) or were mock transfected (e, f). Cells were fixed 48 h post-transfection and analysed by IPMA with anti-PCV2 antiserum generated in SPF piglet and collected 6 weeks p.i. (a, c, e) or with hyperimmune serum generated against ORF2-PCV2 (b, d, f).

 


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. Western blot analysis of GST-fused ORF2 proteins from PCV1 and PCV2. Total lysates of Sf9 cells infected with pAcGHLT-A recombinant baculovirus expressing a GST-fused ORF2-PCV1 (lanes 1) or ORF2-PCV2 (lanes 2) or wild-type baculovirus (lane 3) and a total lysate of non-infected Sf9 cells (lane 4) were incubated with a swine anti-PCV2 antiserum (a) or with an anti-GST antibody (b). The positions of molecular mass markers are shown.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Reactivity of experimental anti-PCV2 sera collected at different times p.i.

 
Epitope mapping with anti-PCV2 antibodies
In order to characterize better the antigenic domains recognized by the anti-PCV2 antibodies, PEPSCAN analysis was performed on ORF1-, ORF2- and ORF3-encoded proteins with experimental anti-PCV2 antisera. This study was carried out on PCV2 and PCV1 sequences so as to identify common and/or discriminating PCV epitopes. For the ORF1 proteins, the first 100 amino acids were excluded from this study, as they display 12% amino acid divergence in this sequence area. Only the C-terminal 212 amino acid sequences, which differ by 16·5% between the two PCV types, have been investigated. As detected with an anti-PCV2 antiserum on peptides derived from the ORF1 amino acid sequence (Fig. 4Down), reactive peptides were shown to span the common residues (residues 185–211) of PCV1 and PCV2. However, the serum reacted weakly with these peptides, since the intensity ratio did not exceed 1·6. In contrast, as shown in Fig. 5Down(aDown, bDown),the same serum reacted more strongly with the ORF2 peptides. Moreover, it allowed the identification of ORF2-reactive peptides derived from PCV1 and localized between amino acids 25–43 and 169–187 (Fig. 5aDown). When tested on ORF2 overlapping peptides from PCV2, this serum revealed not only the same areas encompassing residues 25–43 and 169–183, but also additional reactive peptides localized between amino acids 65–87, 113–147 and 193–207. Another anti-PCV2 antiserum generated in a conventional pig was also tested for its reactivity on ORF2 peptides (Fig. 5cDown, dDown). While only one reactive peptide could be detected between amino acids 169 and 183 derived from PCV1, four areas of ORF2 derived from PCV2 were shown to be immunoreactive. These included residues 65–87, 113–147, 157–183 and 193–207.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. Immunoreactivity of anti-PCV2 antiserum generated in experimentally inoculated SPF piglet with overlapping peptides spanning residues 98–304 of ORF1-PCV1 (a) or residues 101–307 of ORF1-PCV2 (b). The intensity ratio indicates the ratio between values obtained for the serum collected 6 weeks post-inoculation and the serum collected before experimental inoculation. Peptides are indicated by their amino acid locations.

 


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5. Immunoreactivity of anti-PCV2 antiserum with ORF2 peptides. Overlapping peptides spanning the ORF2-encoded protein from PCV1 (a, c) or PCV2 (b, d) were analysed for their reactivity with experimental antisera generated in SPF (a, b) and conventional (c, d) piglets. The intensity ratio indicates the ratio between values obtained for the serum collected 6 weeks post-inoculation and the serum collected before experimental inoculation. Peptides are indicated by their amino acid locations.

 
Comparison of the results obtained for these two anti-PCV2 antisera thus allowed the identification of common and discriminating reactive peptides on ORF2-PCV2 alone. Indeed, whereas a common reactive peptide could be detected in the C-terminal part of the ORF2 proteins (residues 169–183), three groups of ORF2 peptides located between amino acids 65–87, 113–139 and 193–207 were recognized specifically by both anti-PCV2 antisera. The peptide sequences representative of each group are indicated in Table 2Down. Three of these peptides, namely B-121, B-133 and B-146, allowed the detection of anti-PCV2 antibodies. The B-133 peptide was more effective for PCV2 discrimination, since its A-189 counterpart was not recognized by experimental anti-PCV2 antisera. However, the B-121 peptide, which gave discriminating results with experimentally infected conventional piglets, was not recognized by the anti-PCV2 antisera generated in SPF pigs.


View this table:
[in this window]
[in a new window]
 
Table 2. Sequence of PCV ORF2 peptides and their serological reactivities with experimental anti-PCV2 antisera

 
PEPSCAN analysis was also performed on ORF3-encoded protein, but no reactivity was detected (not shown), thus indicating the lack of immunogenicity of this predicted product.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The PCV1 and PCV2 genomes used in this study were isolated from PMWS-affected animals (Le Cann et al., 1997Down ; Mankertz et al., 2000Down ). Sequence comparison of ORF-encoded proteins revealed significant similarities ranging from about 80 to 60% amino acid identity for the two major proteins, ORF1 and ORF2. Moreover, these levels of similarity were shown to be relatively well conserved between different PCV isolates from both types (Mankertz et al., 2000Down ; Meehan et al., 1998Down ; Morozov et al., 1998Down ). For this reason, the existence of antigenic cross-reactivities between viral products of the two genotypes has been suggested. To address this issue, we first used a system involving cells transfected with specific genomes. The replicative forms of cloned PCV1 and PCV2 genomes used as the DNA source in transfection assays were shown to represent functional genomes, as demonstrated by their ability to generate infectious virus particles in an infection test. This system can thus be used to mimic the different processes of virus formation, including viral protein synthesis for replication and virus assembly. By using this model, serological cross-reaction could be identified here with anti-PCV2 antisera generated after experimental infection. We next attempted to determine the nature of the antigens responsible for these common but also different immunoreactivities, in order to identify common and discriminating serological markers of PCV infection.

By using ORF1-PCV1 hyperimmune serum, we were able to demonstrate that the ORF1 proteins were antigenically related in the two PCV types. This was also confirmed by using recombinant ORF1 proteins from PCV1 and PCV2, which were both recognized by anti-PCV2 antisera. The presence of anti-ORF1 antibodies after PCV2 infection was also shown in this way. In contrast, the absence of cross-reaction that was reported by Balasch et al. (1999)Down with experimental anti-PCV2 sera indicated the absence of anti-ORF1 antibodies. This could be explained by the time after experimental infection that the sera were collected. Indeed, ORF1 antibodies, which would be absent or present at a very low titre at least up to 2 weeks p.i. (Balasch et al., 1999Down ), might appear later after infection (this study).

Further analysis of the antigenic regions of ORF1-encoded proteins with synthetic peptides showed that, in the last 200 amino acids, a common antigenic determinant could be detected between residues 185 and 211 of the proteins. Furthermore, since the first 100 amino acids, which display strong identity between the two proteins, were excluded from this study, we cannot exclude the presence of common antigenic domains in this area. In contrast, no discriminating epitope could be identified. The demonstration of serological cross-reactivity between the ORF1 proteins correlates well with the high degree of sequence identity observed between the two types of PCV and is fully consistent with its essential conserved function for virus replication (Mankertz et al., 1998aDown ).

Immunoreactivity against the putative capsid protein encoded by the major ORF2 was also investigated. In contrast to ORF1, a hyperimmune serum generated against ORF2 from PCV2 did not allow the detection of viral protein in PCV1-transfected cells. Hence, the question was whether this absence of signal resulted from the lack of serological reaction between ORF2-PCV2 antiserum and ORF2-PCV1 protein, since it could also be explained by the absence of ORF2 expression by PCV1. The identification of ORF2 transcript expression in PCV1-infected cells (Mankertz et al., 1998bDown ) does not support this latter hypothesis. Moreover, ORF2 proteins fused to GST were expressed and used to demonstrate here that, in spite of their 56% sequence identity, no detectable cross-reactivity could be shown between ORF2 proteins. Antigenic differences have already been reported between PCV1 and PCV2 isolates, as demonstrated by the differences in anti-PCV antibody titres on infected cells. These differences might thus be explained by the differential antigenicity of ORF2-encoded structural proteins (Allan et al., 1999bDown ; Ellis et al., 1998Down ). Further analysis of immunodominant regions determined by using ORF2 synthetic peptides led, as was expected, to the identification of antigenic domains in only the ORF2-PCV2 protein (residues 65–87, 113–139 and 193–207). However, a few reactive peptides common to ORF2 from PCV1 and PCV2 could also be identified in this way, although variations could be observed depending on the serum used. The absence of cross-reactivity observed in transfected cells or after immunoblot assays might then be explained by the lack of accessibility of this peptide sequence in the whole protein.

The differential immunoreactivity of ORF2-PCV2 peptides or proteins with anti-PCV2 antibodies is of particular interest, since such reagents could be used to develop an immunoassay such as ELISA for the detection of PCV2 infection in herds. Of the reactive peptides chosen to represent the antigenic domains of ORF2 protein, one, B-133, could be selected for such ELISA development, since it allowed anti-PCV2 antibody detection and discrimination in both SPF and farm antisera (unpublished results). This peptide shows 25% amino acid sequence divergence from its counterpart, the A-189 peptide.

As demonstrated by PEPSCAN analysis, greater immunoreactivity was observed for the ORF2 protein, which encodes the putative capsid protein. A sequence comparison of this protein from the different strains of PCV2 revealed some variations in the selected peptides. Among them, the B-133 peptide sequence differs by one amino acid between European and North American strains. Whether the anti-PCV2 antiserum generated from a French PCV2 strain could recognize the same epitopes in strains from other countries is not yet known and would provide information about epitope variability among PCV2 strains.


   Acknowledgments
 
The authors are grateful to Bernard Beaurepaire, Gérard Bennevent, André Keranflec’h and Jean-Pierre Jolly for their contribution to the experimental work on pigs in the AFSSA facilities. The plasmid encoding granulocyte/macrophage colony-stimulating factor was kindly provided by François Lefèvre and Chandra Somasundaram (INRA, Jouy en Josas). This work was supported by funds from the Fonds Européens de Développement et de Restructuration (FEDER 5b).


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Allan, G. M., McNeilly, F., Cassidy, J. P., Reilly, G. A., Adair, B., Ellis, W. A. & McNulty, M. S. (1995). Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material. Veterinary Microbiology 44, 49-64.[Medline]

Allan, G., Meehan, B., Todd, D., Kennedy, S., McNeilly, F., Ellis, J., Clark, E. G., Harding, J., Espuna, E., Botner, A. & Charreyre, C. (1998a). Novel porcine circoviruses from pigs with wasting disease syndromes.Veterinary Record 142, 467-468.[Medline]

Allan, G. M., McNeilly, F., Kennedy, S., Daft, B., Clark, E. G., Ellis, J. A., Haines, D. M., Meehan, B. M. & Adair, B. M. (1998b). Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe.Journal of Veterinary Diagnostic Investigation 10, 3-10.[Abstract/Free Full Text]

Allan, G. M., Kennedy, S., McNeilly, F., Foster, J. C., Ellis, J. A., Krakowka, S. J., Meehan, B. M. & Adair, B. M. (1999a). Experimental reproduction of severe wasting disease by co-infection of pigs with porcine circovirus and porcine parvovirus.Journal of Comparative Pathology 121, 1-11.[Medline]

Allan, G. M., McNeilly, F., Meehan, B. M., Kennedy, S., Mackie, D. P., Ellis, J. A., Clark, E. G., Espuna, E., Saubi, N., Riera, P., Botner, A. & Charreyre, C. E. (1999b). Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland.Veterinary Microbiology 66, 115-123.[Medline]

Balasch, M., Segalés, J., Rosell, C., Domingo, M., Mankertz, A., Urniza, A. & Plana-Durán, J. (1999). Experimental inoculation of conventional pigs with tissue homogenates from pigs with post-weaning multisystemic wasting syndrome.Journal of Comparative Pathology 121, 139-148.[Medline]

Bassami, M. R., Berryman, D., Wilcox, G. E. & Raidal, S. R. (1998). Psittacine beak and feather disease virus nucleotide sequence analysis and its relationship to porcine circovirus, plant circoviruses, and chicken anaemia virus.Virology 249, 453-459.[Medline]

Dulac, G. C. & Afshar, A. (1989). Porcine circovirus antigens in PK-15 cell line (ATCC CCL-33) and evidence of antibodies to circovirus in Canadian pigs.Canadian Journal of Veterinary Research 53, 431-433.

Edwards, S. & Sands, J. J. (1994). Evidence of circovirus infection in British pigs.Veterinary Record 134, 680-681.[Medline]

Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D. & Haines, D. (1998). Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome.Canadian Veterinary Journal 39, 44-51.

Ellis, J., Krakowka, S., Lairmore, M., Haines, D., Bratanich, A., Clark, E., Allan, G., Konoby, C., Hassard, L., Meehan, B., Martin, K., Harding, J., Kennedy, S. & McNeilly, F. (1999). Reproduction of lesions of postweaning multisystemic wasting syndrome in gnotobiotic piglets.Journal of Veterinary Diagnostic Investigation 11, 3-14.[Abstract/Free Full Text]

Hines, R. K. & Lukert, P. D. (1995). Porcine circovirus: a serological survey of swine in the United States.Swine Health and Production 3, 71-73.

Kennedy, S., Allan, G., McNeilly, F., Adair, B. M., Hughes, A. & Spillane, P. (1998). Porcine circovirus infection in Northern Ireland.Veterinary Record 142, 495-496.[Medline]

Kiupel, M., Stevenson, G. W., Mittal, S. K., Clark, E. G. & Haines, D. M. (1998). Circovirus-like viral associated disease in weaned pigs in Indiana.Veterinary Pathology 35, 303-307.[Abstract]

Le Cann, P., Albina, E., Madec, F., Cariolet, R. & Jestin, A. (1997). Piglet wasting disease.Veterinary Record 141, 660.[Medline]

Lukert, P., de Boer, G. F., Dale, J. L., Keese, P., McNulty, M. S., Randles, J. W. & Tischer, I. (1995). Family Circoviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp. 166-168. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag.

Madec, F., Eveno, E., Morvan, P., Hamon, L., Blanchard, P., Cariolet, R., Amenna, N., Morvan, H., Truong, C., Mahé, D., Albina, E. & Jestin, A. (2000). Post-weaning multisystemic wasting syndrome (PMWS) in pigs in France: clinical observations from follow-up studies on affected farms. Livestock Production Science (in press).

Mankertz, A., Mankertz, J., Wolf, K. & Buhk, H.-J. (1998a). Identification of a protein essential for replication of porcine circovirus.Journal of General Virology 79, 381-384.[Abstract]

Mankertz, J., Buhk, H.-J., Blaess, G. & Mankertz, A. (1998b). Transcription analysis of porcine circovirus (PCV).Virus Genes 16, 267-276.[Medline]

Mankertz, A., Domingo, M., Folch, J. M., Le Cann, P., Jestin, A., Segalés, J., Chmielewicz, B., Plana-Durán, J. & Soike, D. (2000). Characterization of PCV-2 isolates from Spain, Germany and France.Virus Research 66, 65-77.[Medline]

Meehan, B. M., Creelan, J. L., McNulty, M. S. & Todd, D. (1997). Sequence of porcine circovirus DNA: affinities with plant circoviruses.Journal of General Virology 78, 221-227.[Abstract]

Meehan, B. M., McNeilly, F., Todd, D., Kennedy, S., Jewhurst, V. A., Ellis, J. A., Hassard, L. E., Clark, E. G., Haines, D. M. & Allan, G. M. (1998). Characterization of novel circovirus DNAs associated with wasting syndromes in pigs.Journal of General Virology 79, 2171-2179.[Abstract]

Morozov, I., Sirinarumitr, T., Sorden, S. D., Halbur, P. G., Morgan, M. K., Yoon, K. J. & Paul, P. S. (1998). Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome.Journal of Clinical Microbiology 36, 2535-2541.[Abstract/Free Full Text]

Nayar, G. P., Hamel, A. & Lin, L. (1997). Detection and characterization of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs.Canadian Veterinary Journal 38, 385-386.

Niagro, F. D., Forsthoefel, A. N., Lawther, R. P., Kamalanathan, L., Ritchie, B. W., Latimer, K. S. & Lukert, P. D. (1998). Beak and feather disease virus and porcine circovirus genomes: intermediates between the geminiviruses and plant circoviruses.Archives of Virology 143, 1723-1744.[Medline]

Pringle, C. R. (1999). Virus taxonomy at the XIth International Congress of Virology, Sydney, Australia, 1999.Archives of Virology 144, 2065-2070.[Medline]

Segalés, J., Sitjar, M., Domingo, M., Dee, S., Del Pozo, M., Noval, R., Sacristan, C., De las Heras, A., Ferro, A. & Latimer, K. S. (1997). First report of post-weaning multisystemic wasting syndrome in pigs in Spain.Veterinary Record 141, 600-601.[Free Full Text]

Tischer, I., Gelderblom, H., Vettermann, W. & Koch, M. A. (1982). A very small porcine virus with circular single-stranded DNA.Nature 295, 64-66.[Medline]

Tischer, I., Mields, W., Wolff, D., Vagt, M. & Griem, W. (1986). Studies on epidemiology and pathogenicity of porcine circovirus.Archives of Virology 91, 271-276.[Medline]

Tischer, I., Peters, D., Rasch, R. & Pociuli, S. (1987). Replication of porcine circovirus: induction by glucosamine and cell cycle dependence.Archives of Virology 96, 39-57.[Medline]

Tischer, I., Bode, L., Peters, D., Pociuli, S. & Germann, B. (1995). Distribution of antibodies to porcine circovirus in swine populations of different breeding farms.Archives of Virology 140, 737-743.[Medline]

Todd, D., Creelan, J. L., Mackie, D. P., Rixon, F. & McNulty, M. S. (1990). Purification and biochemical characterization of chicken anaemia agent.Journal of General Virology 71, 819-823.[Abstract/Free Full Text]

Received 25 January 2000; accepted 22 March 2000.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
H.-G. Shen, J.-Y. Zhou, Z.-Y. Huang, J.-Q. Guo, G. Xing, J.-L. He, Y. Yan, and L.-Y. Gong
Protective immunity against porcine circovirus 2 by vaccination with ORF2-based DNA and subunit vaccines in mice
J. Gen. Virol., August 1, 2008; 89(8): 1857 - 1865.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. J. Lefebvre, S. Costers, J. Van Doorsselaere, G. Misinzo, P. L. Delputte, and H. J. Nauwynck
Antigenic differences among porcine circovirus type 2 strains, as demonstrated by the use of monoclonal antibodies
J. Gen. Virol., January 1, 2008; 89(1): 177 - 187.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. C. Bodjo, O. Kwiatek, A. Diallo, E. Albina, and G. Libeau
Mapping and structural analysis of B-cell epitopes on the morbillivirus nucleoprotein amino terminus
J. Gen. Virol., April 1, 2007; 88(4): 1231 - 1242.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Opriessnig, N. E. McKeown, E.-M. Zhou, X.-J. Meng, and P. G. Halbur
Genetic and experimental comparison of porcine circovirus type 2 (PCV2) isolates from cases with and without PCV2-associated lesions provides evidence for differences in virulence.
J. Gen. Virol., October 1, 2006; 87(Pt 10): 2923 - 2932.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Lekcharoensuk, I. Morozov, P. S. Paul, N. Thangthumniyom, W. Wajjawalku, and X. J. Meng
Epitope Mapping of the Major Capsid Protein of Type 2 Porcine Circovirus (PCV2) by Using Chimeric PCV1 and PCV2
J. Virol., August 1, 2004; 78(15): 8135 - 8145.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
S. Racine, A. Kheyar, C. A. Gagnon, B. Charbonneau, and S. Dea
Eucaryotic Expression of the Nucleocapsid Protein Gene of Porcine Circovirus Type 2 and Use of the Protein in an Indirect Immunofluorescence Assay for Serological Diagnosis of Postweaning Multisystemic Wasting Syndrome in Pigs
Clin. Vaccine Immunol., July 1, 2004; 11(4): 736 - 741.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
C. de Boisseson, V. Beven, L. Bigarre, R. Thiery, N. Rose, E. Eveno, F. Madec, and A. Jestin
Molecular characterization of Porcine circovirus type 2 isolates from post-weaning multisystemic wasting syndrome-affected and non-affected pigs
J. Gen. Virol., February 1, 2004; 85(2): 293 - 304.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Mankertz and B. Hillenbrand
Analysis of transcription of Porcine circovirus type 1
J. Gen. Virol., November 1, 2002; 83(11): 2743 - 2751.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
P. Nawagitgul, P. A. Harms, I. Morozov, B. J. Thacker, S. D. Sorden, C. Lekcharoensuk, and P. S. Paul
Modified Indirect Porcine Circovirus (PCV) Type 2-Based and Recombinant Capsid Protein (ORF2)-Based Enzyme-Linked Immunosorbent Assays for Detection of Antibodies to PCV
Clin. Vaccine Immunol., January 1, 2002; 9(1): 33 - 40.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mahé, D.
Right arrow Articles by Jestin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahé, D.
Right arrow Articles by Jestin, A.
Agricola
Right arrow Articles by Mahé, D.
Right arrow Articles by Jestin, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS