|
|
||||||||
Plant |
Departmento de Biotecnologia, E.T.S. Ingenieros Agronomos, Universidad Politecnica, 28040 Madrid, Spain1
Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK2
National Agricultural Research Centre, Islamabad 45500, Pakistan3
Author for correspondence: Bryan Harrison. Fax +44 1382 562426. e-mail djrobi{at}scri.sari.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent work has also revealed another type of circular single-stranded DNA of about 1·4 kb in all leaf curl-affected cotton plants that were tested from several locations in Pakistan; this molecule resembles a genome component of nanoviruses that encodes a replication-associated protein (Rep). However, this nanovirus-like DNA becomes packaged in begomovirus coat protein and is transmissible by B. tabaci (Mansoor et al., 1999
). When cotton plants were inoculated with cloned infectious molecules of the nanovirus-like component, together with cloned molecules of a DNA-A from leaf curl-affected cotton, each of these agents infected the plants systemically but only very mild symptoms developed in co-infected plants, not those typical of cotton leaf curl disease (Mansoor et al., 1999
). The aetiology of the disease is therefore still unclear.
A further complication is that four different types of Pakistan cotton leaf curl virus (CLCuV-PK) DNA-A (types a, 26, 72b and 804a) have been distinguished by comparing their complete sequences, which differ by 829% and, for three of these types, by as much as distinct begomovirus species (Zhou et al., 1998
). However, the differences are not uniformly distributed along the DNA-A sequence, so that some parts differ much more than the mean value, whereas other parts are virtually the same. It was concluded that three of the types of CLCuV-PK DNA-A are probably recombinant molecules, and all four were found to share part, but not the whole, of their sequence with DNA-A from okra plants infected by okra yellow vein mosaic virus (OYVMV; Zhou et al., 1998
). However, the other parent(s) of each of the three putative recombinants is not known and the direction of recombination is therefore unclear. These data, and other analyses of partial sequences of DNA-A, suggested that begomovirus isolates possessing recombinant DNA-A molecules might be widespread in cotton and other malvaceous species in Pakistan (Zhou et al., 1998
; Harrison & Robinson, 1999
; Sanz et al., 1999
).
Two kinds of evidence suggest that begomoviruses infecting non-malvaceous plants in Pakistan may play a part in the evolution of Pakistani cotton-infecting begomoviruses. Firstly, tests with a panel of monoclonal antibodies showed that Pakistani begomovirus isolates from a range of naturally infected non-malvaceous species were antigenically strongly related to, although mostly distinguishable from, CLCuV-PK (Harrison et al., 1997a
). Indeed, begomoviruses found in various hosts in India or Pakistan are antigenically more closely related to one another than to begomoviruses associated with similar diseases in other geographical areas, such as the Americas or the African/Mediterranean region (Swanson et al., 1992
; Nateshan et al., 1996
; Harrison et al., 1997a
). Secondly, CLCuV-PK was transmitted experimentally by B. tabaci to bean, tobacco and tomato, as well as to the malvaceous species okra (Abelmoschus esculentus), which developed okra leaf curl disease (Harrison et al., 1997a
). Individual plants of a variety of species in Pakistan might therefore be co-infected with two or more begomovirus isolates. Indeed, brief records of begomovirus co-infection in three plants (one cotton, two okra) from Pakistan (Zhou et al., 1998
; Sanz et al., 1999
) support this idea. Co-infection is presumably a precondition for recombination to occur, and earlier work has not detected any bar to begomovirus co-infection at either the strain or species level. For instance, Lazarowitz (1991)
reported co-infection of squash plants in California with two strains of squash leaf curl virus, and Harrison et al. (1997b
) detected the DNA-A of two distinct begomoviruses in many severely mosaic-affected cassava plants from Uganda.
In this paper, we describe work to assess the extent to which begomovirus co-infection occurs in cotton and other plants in Pakistan, and to explore the variety of begomovirus DNA-A sequences occurring in singly or multiply infected plants. The results show that co-infection and recombination are rife in naturally infected plants, and that they involve several begomoviruses, and hosts in several botanical families. Based on this evidence, we propose a hypothesis to explain the evolutionary divergence, as a group, of begomoviruses in the Indian subcontinent from those occurring in other geographical regions.
| Methods |
|---|
|
|
|---|
Sources of viral DNA.(a) Samples from malvaceous species.
p12 Hollyhock (Althaea rosea) from Mirpur Mathelo, north Sindh
p17 China rose (Hibiscus rosa-sinensis) from Moen jo Daro, central Sindh
p26 Hollyhock from Hyderabad, south Sindh
p31 China rose from Karachi, south Sindh
S12 and S13 Hollyhock from Mirpur Mathelo
S26 Hollyhock from Hyderabad
(b) Samples from other species.
p1 Tomato (Lycopersicon esculentum) from Multan, Punjab
p19 Solanum nigrum from Nawabshah, central Sindh
p20 Guar (Cyamopsis tetragonoloba) from Shahdadpur, central Sindh
p24 and p25 Unidentified weeds from Mirpur Khas, south Sindh
p27 Tobacco (Nicotiana tabacum) from Hyderabad
p28 Tomato from Tando Muhammad Khan, south Sindh
p29 Bottlegourd (Luffa cylindrica) from Tando Muhammad Khan
p30 Watermelon (Citrullus lanatus) from Tando Muhammad Khan
All the samples from Sindh, except those from Mirpur Mathelo, were collected outside the area of the cotton leaf curl epidemic.
PCR and sequence determination.
The first kind of analysis was used to test for mixed infections involving any of the four main types of CLCuV-PK (clc26, clca, clc72b and clc804a) and the isolates of OYVMV described by Zhou et al. (1998)
. Five pairs of primers were designed, four that were specific for DNA-A of each type of CLCuV-PK and one OYVMV-specific pair that detected DNA-A of isolates of both type oyvm201 and type oyvm301. Positions of the primers are shown in Fig. 1
; the primer pairs were (sequences not listed in full are given by Zhou et al., 1998
): (a) for CLCuV-PK type 26, primer pair CL-CR/R2 and CL-72/F (5' ATTCGAGGGTGTGTTGATGGC 3', identical to nt 24692489); (b) for CLCuV-PK type a, primer pair CL-CR/R2 and CL-AR/F2 (5' GCGTTTGTTTTTAAAGCACGTGG 3', nt 25562578); (c) for OYVMV, primer pair CL-CR/R2 and OYV/F (5' TGGGTGAGAAAGACGAATGCT 3', nt 15791599); (d) for CLCuV-PK type 72b, primer pair CL72-AL/R and CL72-AL/F; (e) for CLCuV-PK type 804a, primer pair CL800-AL/R and CL11/F. Each primer pair was used in a separate reaction (Harrison et al., 1997a
) to test samples from malvaceous plants.
|
Sequence analysis.
The new sequences (EMBL acc. nos AJ245495AJ245501 and AJ270853AJ270873) obtained as described above were compared with other partial DNA-A sequences obtained by Sanz et al. (1999)
(EMBL acc. nos AJ228561AJ228599) but not previously analysed in this manner. The comparisons also included the relevant parts of the published sequences of DNA-A of the four types of CLCuV-PK and two types of OYVMV (AJ002447AJ002459), and of two types of tomato leaf curl virus from India (U15015 and U38239). Sequence data were analysed with the Wisconsin Package, version 8.1 (Anon., 1994
). Multiple alignments were optimized manually. A phylogenetic tree representing the CP gene (768 nt) of 33 virus isolates was constructed by a Maximum Likelihood method using PUZZLE version 4.0, with 10000 puzzling steps. Where some nucleotides at the 3' end of the CP gene were not determined, as explained above, it was assumed that the open reading frames of all isolates had the same length as that of isolate clc26, and the missing nucleotides were considered to be unknown.
| Results |
|---|
|
|
|---|
|
The two leaf curl-affected okra plants in which CLCuV-PK was not detected gave a product with the OYVMV-specific primers even though yellow vein mosaic symptoms were uncommon (<1%) or apparently absent in the source fields. Further work is needed to clarify the aetiology of these two kinds of begomovirus-associated disease symptom in okra.
Co-infection detected by sequence comparisons
The three primer pairs, which amplify overlapping sequences in begomovirus DNA-A, were used in tests on samples from a range of begomovirus-infected plant species. Overlapping DNA fragments were obtained from 18 samples and, in 12 of these, the overlapping sequences differed (Table 2
). Hence, begomovirus co-infection seems easy to find in Pakistan in non-malvaceous plants, such as bottlegourd, tobacco and tomato, as well as in malvaceous species. However, nearly all the sequences closely resembled those of reference virus isolates (sequence identity always at least 89%, usually >93%), as indicated in Table 2
. In most instances, affinities of the non-overlapping and overlapping parts of Fragment 1 were closest to the same reference isolate; the same was true for Fragments 3 and 3a.
|
Relationships among isolates
When comparing 13 CP genes of Pakistani begomovirus isolates from malvaceous plants, Zhou et al. (1998)
found that the isolates from cotton fell into three clusters, with the isolates from okra being in, or close to, two of these clusters. Twenty-two additional begomovirus CP gene sequences from Pakistani malvaceous and non-malvaceous plants are now available, so making a more comprehensive analysis possible (Fig. 2
). The CP gene sequences from cotton or okra now fall into four main clusters, three of which also contain CP genes of viruses from non-malvaceous plants. The new cluster, typified by isolate olc (okra leaf curl) 90, includes the CP genes of viruses from bottlegourd, hollyhock, tobacco and a weed, all of which are virtually indistinguishable from that of olc90. Among the cotton viruses, several examples were found of two additional minor CP gene variants [typified by clc49 (1·9% nucleotide sequence difference from clc804a) and clc82 (1·3% difference from olc311)] and, among the viruses from okra or saklai (Hibiscus tiliaceus; slc60), three extra variants with up to 6% sequence difference from CLCuV-PK type 804a could be recognized. Among viruses from other species, the CP genes of p28 (tomato) and p30 (watermelon) had strong affinities (<3·3% difference) to that of CLCuV-PK type 804a (Fig. 2
). The two virus isolates from leaf curl-affected tomato in India [U15015 (Padidam et al., 1995a
) and U38239] have CP genes that differ substantially from all the others but the U38239 CP gene is closest to that of CLCuV-PK type 72b (Fig. 2
).
|
Another complexity revealed by our sequence comparisons is that different parts of some individual sequences have different affinities and appear to have been produced by recombination. Clear-cut changes in affinity occurred at points in the IR, or in the AC1 or CP genes (Table 3
). For instance, in the AC1 sequence from sample 74, the sequences brought together are typical of those of the two most disparate types of CLCuV-PK described by Zhou et al. (1998)
, types 26 and 72b. Similarly, the CP gene of slc60 combines sequences typical of CLCuV-PK types 26 (5' half) and 804a (3' half). Of the equivalent sequences of olc1 (from sample O1) and olc16, the 5' 700 nt closely resemble those of CLCuV-PK type 804a but the rest are unlike any of the other sequences, although similar to one another. In other instances (p12, p31), putative recombinant viral sequences from malvaceous plants incorporate elements typical of ToLCV; and part of a viral sequence from tobacco (p27) is typical of an okra-infecting virus (oyvm201; Table 3
). In these last three examples, the presumed recombination site is close to the origin of replication (ori), but it cannot be located precisely because almost all the reference isolates have the same 21 nt sequence at this point. To check the reliability of the sequences determined in this work, two independent clones of 12 PCR products were sequenced. The sequences included examples of Fragments 1, 2 and 3, Fragments from plants considered (because of the sequence differences between overlapping Fragments) to be dually infected, and putative recombinant Fragments. In 11 instances, the duplicate sequences were identical; in the twelfth, we could not decide whether one of the two sequences was derived from a true recombinant DNA-A, or was an artefact produced by template-switching during PCR. We conclude that template-switching, if it occurred at all, could not explain the number of recombinant sequences observed.
|
|
|
| Discussion |
|---|
|
|
|---|
Evidence was obtained of co-infection in cotton, in other malvaceous species and in non-malvaceous species. Sequences typical of viruses from non-malvaceous plants were found in malvaceous ones, and sequences of CLCuV-PK were found in non-malvaceous plants. One factor favouring the spread of begomoviruses among these plants is that many dicotyledonous species in Pakistan are hosts of whiteflies of the B. tabaci complex (Ali et al., 1995
), which are the known or likely vectors of all the viruses. Another possible factor, which may favour virus establishment in the vector-inoculated plants, is that begomovirus replication and/or movement proteins, which are host-adapted, may be able to mediate in trans the replication and systemic invasion of closely related co-infecting viruses that would otherwise be unable to infect the relevant plant species systemically. This phenomenon has been observed in experiments (Lazarowitz, 1991
; Frischmuth et al., 1993
; Ingham et al., 1995
; Hou et al., 1998
), and might partly explain the frequency and variety of the begomovirus sequence mixtures found in naturally infected plants in Pakistan.
The increased number of nucleotide sequences now available for Pakistani begomoviruses has provided a clearer picture of the extents of variation and affinity among them. Considerable similarities were found among the viral CP genes, with most of those from non-malvaceous plants being classified in the clusters containing CP genes obtained from malvaceous plants. This conclusion parallels that drawn from comparisons of epitope profiles of begomovirus particles (Harrison et al., 1997a
). In contrast, comparisons of IR sequences, the most variable part of begomovirus DNA-A (Padidam et al., 1995b
), provided much new evidence of variation and recombination. Additional kinds of IR sequence were obtained from infected malvaceous and non-malvaceous species. Moreover, some of the sequences from malvaceous plants incorporated elements indistinguishable from sequences of viruses infecting non-malvaceous species; and some sequence elements obtained from infected non-malvaceous plants were typical of viruses from malvaceous species. Many putative recombinant sequences had a recombination site close to ori, in agreement with previous findings (Stanley, 1995
; Zhou et al., 1998
; Sanz et al., 1999
). Interestingly, we found no evidence for recombination in the 5' half of the IR, or in the region (250 nt) of the AC1 gene immediately adjoining it. The association of the 5' half of the IR and its cognate AC1 gene was therefore maintained. This is probably required for virus viability because, for the genomic DNA to be replicated, a specific amino-acid motif in the N-terminal portion of the AC1-encoded Rep protein must recognize the iteron(s) in the 5' half of the IR (Lazarowitz et al., 1992
; Fontes et al., 1994
; Jupin et al., 1995
). Also, iteron sequences differ among begomoviruses, and the recognition is nucleotide sequence-specific. In contrast, a putative recombination site was detected in the AV2 gene, near its junction with the IR. The frequency of supposed recombinant sequences among Pakistani begomoviruses presumably reflects the many opportunities for recombination presented by multiple infection of individual plants, together with the existence of shared sequence motifs at various points in the viral DNA-A.
The pattern of relationships among Pakistani begomoviral DNA-A sequences resembles a network, with frequent evolutionary interactions among viruses from malvaceous species, and less frequent interactions between these viruses and those from non-malvaceous species. This picture confirms and extends that provided by the complementary data of Sanz et al. (1999)
, who found that begomoviral sequences from cotton had essentially the same kinds of nucleotide diversity as those from other malvaceous species, and argued that all these sequences represent a single undifferentiated population. We conclude that begomoviruses in Pakistan, and probably in the whole Indian subcontinent, have a complex lineage, largely irrespective of their preferred host species, and distinct from the lineages of begomoviruses associated with similar diseases in other geographical areas, such as the Americas or the African/Mediterranean region.
We have not found the complete DNA-A of CLCuV-PK in Pakistan outside the area affected by the cotton leaf curl epidemic (Punjab and the extreme north of Sindh), although we now have evidence from the sequences found in mixed infections, and from the recombinant sequences, that pieces of sequence that are typical of each of the main types of CLCuV-PK DNA-A (a, 26, 72b and 804a) occur in begomovirus-infected malvaceous or non-malvaceous species in central or south Sindh. A form of CLCuV-PK DNA-A could presumably have emerged in the Punjab by rounds of recombination among such viruses. We have also obtained evidence that the begomovirus epidemic in cotton, in turn, has resulted in numerous multiple infections, and probably yet more rounds of recombination, which have ensured that further types of begomovirus continued to emerge in Pakistan. Whether cotton leaf curl disease in Pakistan is caused by any one, or some combination, of these begomovirus variants, perhaps in association with another virus-like agent (Liu et al., 1998
; Mansoor et al., 1999
), remains to be determined.
| Acknowledgments |
|---|
| Footnotes |
|---|
b Present address: CropDesign N.V., Technologiepark 3, B-9052 Gent, Belgium. ![]()
c Permanent address: Institute of Biotechnology, Zhejiang University, Hangzhou 310029, China. ![]()
d Permanent address: Virology Section, Ayub Agricultural Research Institute, Faisalabad, Pakistan. ![]()
| References |
|---|
|
|
|---|
Anon. (1994). Program Manual for the Wisconsin Package, Version 8. Madison: Genetics Computer Group.
Arguello-Astorga, G., Herrera-Estrella, L. & Rivera-Bustamante, R. (1994). Experimental and theoretical definition of geminivirus origin of replication. Plant Molecular Biology 26, 553-556.[Medline]
Brown, J. K. & Bird, J. (1992). Whitefly-transmitted geminiviruses and associated disorders in the Americas and the Caribbean Basin. Plant Disease 76, 220-225.
Brown, J. K., Frolich, D. R. & Rosell, R. C. (1995). The sweetpotato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annual Review of Entomology 40, 511-534.
Fontes, E. P. B., Gladfelter, H. J., Schaffer, R. L., Petty, I. T. D. & Hanley-Bowdoin, L. (1994). Geminivirus replication origins have a modular organization. Plant Cell 6, 405-416.[Abstract]
Frischmuth, T., Roberts, S., von Arnim, A. & Stanley, J. (1993). Specificity of bipartite geminivirus movement proteins. Virology 196, 666-673.[Medline]
Harrison, B. D. (1985). Advances in geminivirus research. Annual Review of Phytopathology 23, 55-82.
Harrison, B. D. & Robinson, D. J. (1999). Natural genomic and antigenic variation in whitefly-transmitted geminiviruses (begomoviruses). Annual Review of Phytopathology 37, 369-398.[Medline]
Harrison, B. D., Liu, Y. L., Khalid, S., Hameed, S., Otim-Nape, G. W. & Robinson, D. J. (1997a). Detection and relationships of cotton leaf curl virus and allied whitefly-transmitted geminiviruses occurring in Pakistan. Annals of Applied Biology 130, 61-75.
Harrison, B. D., Zhou, X., Otim-Nape, G. W., Liu, Y. & Robinson, D. J. (1997b). Role of a novel type of double infection in the geminivirus-induced epidemic of severe cassava mosaic in Uganda. Annals of Applied Biology 131, 437-448.
Hou, Y.-M., Paplomatas, E. J. & Gilbertson, R. L. (1998). Host adaptation and replication properties of two bipartite geminiviruses and their pseudorecombinants. Molecular PlantMicrobe Interactions 11, 208-217.
Ingham, D. J., Pascal, E. & Lazarowitz, S. (1995). Both bipartite geminivirus movement proteins define viral host range, but only BLI determines viral pathogenicity. Virology 207, 191-204.[Medline]
Jupin, I., Hericourt, F., Benz, B. & Gronenborn, B. (1995). DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein. FEBS Letters 362, 116-120.[Medline]
Lazarowitz, S. G. (1991). Molecular characterization of two bipartite geminiviruses causing squash leaf curl disease: role of viral replication and movement functions in determining host range. Virology 180, 70-80.[Medline]
Lazarowitz, S. G., Wu, L. C., Rogers, S. G. & Elmer, J. S. (1992). Sequence-specific interaction with the viral ALI protein identifies a geminivirus DNA replication origin. Plant Cell 4, 799-809.
Liu, Y., Robinson, D. J. & Harrison, B. D. (1998). Defective forms of cotton leaf curl virus DNA-A that have different combinations of sequence deletion, duplication, inversion and rearrangement. Journal of General Virology 79, 1501-1508.[Abstract]
Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon, R., Stanley, J. & Markham, P. G. (1999). Identification of a novel circular single-stranded DNA associated with cotton leaf curl disease in Pakistan. Virology 259, 190-199.[Medline]
Nadeem, A. (1995). Molecular characterization of two cotton geminiviruses. PhD Dissertation, University of Arizona, USA.
Nateshan, H. M., Muniyappa, V., Swanson, M. M. & Harrison, B. D. (1996). Host range, vector relations and serological relationships of cotton leaf curl virus from southern India. Annals of Applied Biology 128, 233-244.
Navot, N., Pichersky, E., Zeidan, M., Zamir, D. & Csoznek, H. (1991). Tomato yellow leaf curl virus; a whitefly-transmitted geminivirus with a single genomic molecule. Virology 185, 151-161.[Medline]
Padidam, M., Beachy, R. N. & Fauquet, C. M. (1995a). Tomato leaf curl geminivirus in India has a bipartite genome and coat protein is not essential for infectivity. Journal of General Virology 76, 25-35.
Padidam, M., Beachy, R. N. & Fauquet, C. M. (1995b). Classification and identification of geminiviruses using sequence comparisons. Journal of General Virology 76, 249-263.
Sanz, A. I., Fraile, A., Gallego, J. M., Malpica, J. M. & García-Arenal, F. (1999). Genetic variability of natural populations of cotton leaf curl geminivirus, a single-stranded DNA virus. Journal of Molecular Evolution 49, 672-681.[Medline]
Stanley, J. (1995). Analysis of African cassava mosaic virus recombinants suggests strand nicking occurs within the conserved nonanucleotide motif during the initiation of rolling circle DNA replication. Virology 206, 707-712.[Medline]
Swanson, M. M., Varma, A., Muniyappa, V. & Harrison, B. D. (1992). Comparative epitope profiles of the particle proteins of whitefly-transmitted geminiviruses from nine crop legumes in India. Annals of Applied Biology 120, 425-433.
Zhou, X., Liu, Y., Robinson, D. J. & Harrison, B. D. (1998). Four DNA-A variants among Pakistani isolates of cotton leaf curl virus and their affinities to DNA-A of geminivirus isolates from okra. Journal of General Virology 79, 915-923.[Abstract]
Received 14 January 2000;
accepted 3 March 2000.
This article has been cited by other articles:
![]() |
G. Lozano, H. P. Trenado, R. A. Valverde, and J. Navas-Castillo Novel begomovirus species of recombinant nature in sweet potato (Ipomoea batatas) and Ipomoea indica: taxonomic and phylogenetic implications J. Gen. Virol., October 1, 2009; 90(10): 2550 - 2562. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Arguello-Astorga, J. T. Ascencio-Ibanez, M. B. Dallas, B. M. Orozco, and L. Hanley-Bowdoin High-Frequency Reversion of Geminivirus Replication Protein Mutants during Infection J. Virol., October 15, 2007; 81(20): 11005 - 11015. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ge, J. Zhang, X. Zhou, and H. Li Genetic Structure and Population Variability of Tomato Yellow Leaf Curl China Virus J. Virol., June 1, 2007; 81(11): 5902 - 5907. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Morilla, B. Krenz, H. Jeske, E. R. Bejarano, and C. Wege Tete a Tete of Tomato Yellow Leaf Curl Virus and Tomato Yellow Leaf Curl Sardinia Virus in Single Nuclei J. Virol., October 1, 2004; 78(19): 10715 - 10723. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Preiss and H. Jeske Multitasking in Replication Is Common among Geminiviruses J. Virol., March 1, 2003; 77(5): 2972 - 2980. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rahman, D. Hussain, and Y. Zafar Estimation of Genetic Divergence among Elite Cotton Cultivars-Genotypes by DNA Fingerprinting Technology Crop Sci., November 1, 2002; 42(6): 2137 - 2144. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohshima, Y. Yamaguchi, R. Hirota, T. Hamamoto, K. Tomimura, Z. Tan, T. Sano, F. Azuhata, J. A. Walsh, J. Fletcher, et al. Molecular evolution of Turnip mosaic virus: evidence of host adaptation, genetic recombination and geographical spread J. Gen. Virol., June 1, 2002; 83(6): 1511 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H. Schnippenkoetter, D. P. Martin, J. A. Willment, and E. P. Rybicki Forced recombination between distinct strains of Maize streak virus J. Gen. Virol., December 1, 2001; 82(12): 3081 - 3090. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |