|
|
||||||||
Plant |
Centre for Biomolecular Sciences, University of St Andrews, North Haugh, St Andrews KY16 9ST, UK1
Author for correspondence: Martin Ryan. Fax +44 1334 462595. e-mail martin.ryan{at}st-and.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The RNA genomic sequences of a number of luteoviruses have been determined (Mayo et al., 1989
; van der Wilk et al., 1989
; Keese et al., 1990
). The sequence of PLRV revealed eight major ORFs in two blocks of coding sequences (Fig. 1
). Full-length cDNA of the luteovirus beet western yellows virus (BWYV), which is closely related to PLRV, was constructed and RNA transcripts were shown to be infectious in protoplasts or by agro-infection in plants (Veidt et al., 1992
). Site-directed mutagenetic analyses of BWYV cDNA has established that only the putative polymerase (P1/P2) is required for virus replication, and that only the P3 coat protein is required for virion assembly (Reutenauer et al., 1993
). Like many positive ssRNA viruses, PLRV has been found to express the products of its genome in a variety of ways including transcription of subgenomic mRNAs, translational frameshifting, amber stop codon readthrough, internal initiation, and protein processing and maturation. The five 3'-terminal ORFs which characterize the luteovirus group are expressed from two sub-genomic RNAs of ~2·7 kb (Rohde et al., 1994
) and 0·8 kb (Ashoub et al., 1998
). The larger subgenomic mRNA encodes the ~23 kDa coat protein P3 (Mayo et al., 1989
), the virus transmission protein P5 (Bahner et al., 1990
; Brault et al., 1995
) and the P4 protein responsible for virus movement between cells (Tacke et al., 1993
). The 0·8 kb sub-genomic mRNA encodes proteins of 7·1 kDa (P6) and 14 kDa (P7); no function has been assigned to either of these proteins, although P7 has nucleic acid binding properties (Ashoub et al., 1998
).
|
Recently, Prüfer et al. (1999)
showed that P1 is processed in plants infected with PLRV. A major product of this processing is a 25 kDa protein representing the C terminus of P1 (P1-C25); the N terminus of the P1-C25 is either the VPg domain, or closely adjacent to it. It was strongly suspected that this cleavage was due to the closely adjacent serine proteinase motif. Supporting this hypothesis, experiments in which conserved residues within the serine proteinase active site motif were mutagenized showed that RNAs of BWYV which were replication-competent were no longer so. Additionally, the P1 of subgroup I luteoviruses, which is significantly smaller and has no homology with P1 of subgroup II viruses, lacks a VPg that is homologous with that of subgroup II (van der Wilk et al., 1997
) and, in addition, also lacks a serine proteinase motif (Mayo & Ziegler-Graff, 1996
). P1-C25 has nucleic acid binding properties, suggesting that it may form complexes with PLRV genomic RNA to facilitate the covalent binding of VPg to the 5' terminus of PLRV genomic RNA.
We have previously demonstrated the utility of the baculovirus protein expression system for studying aspects of PLRV biology by expressing virus-like particles (VLP) in insect cells (Lamb et al.,1996
). In this paper, we report the expression of P1 protein in insect cells and demonstrate that, in these cells, P1 is processed in a manner similar to that observed in planta,that P1 is responsible for this proteolytic activity,and that the chymotrypsin-like serine proteinase motif of P1 is responsible for the observed cleavage.
| Methods |
|---|
|
|
|---|
Construction of plasmids
pSAB53.
This plasmid contains the full-length PLRV genome inserted into vector pUC19 with the insertion of a T7 RNA polymerase promoter sequence immediately upstream of the 5' terminus of the PLRV sequences. Details as to the construction of this plasmid will be presented elsewhere (F. E. Gildow and others, unpublished results). We were unable to rescue virus back from this construct and subsequent nucleotide sequencing studies showed a point mutation producing a coding change (G355
V) within an important motif of the proposed serine proteinase P1 domain.
pXL1.
The point mutation present within P1 was corrected by site-directed mutagenesis. Sequences encoding the N-terminal half of the P1 protein were amplified using oligonucleotide primers 304 (5' GACTAGATCTCCACCATGAACAGATTTACCGCATATG 3') and 208 (5' TGTTTCCGGAATATCC 3'), the reverse primer 208 correcting the point mutation. The sequences encoding the C-terminal half of P1 were amplified using primers 3329 (5' GACCCGGATATTCCGGAACAGGGTTTTG 3') and 305 (5' ACTGGAATTCTCAGGCTTTGGAGTTCAGCTTC 3'), the forward primer 3329 (overlapping primer 208) also encoding the correction. In the former case, the PCR product was restricted with BglII and AccIII, whereas in the latter case, the PCR product was restricted with AccIII and EcoRI. The purified restriction fragments were ligated together with the vector pGEM3zf(+) (Promega) restricted with BamHI and EcoRI.
pVLP1GVPk.
Sequences encoding the entire P1 region of pSAB53 were amplified using primers 304 and 155 (5' ACTGGAGCTCGGCTTTGGAGTTCAGCTTCAGA 3'). The PCR product was restricted with HindIII, then doubly restricted with either BglII or SacI. The BglIIHindIII and HindIIISacI restriction fragments were ligated together with plasmid pVL140Pk (Hanke et al., 1995
) restricted with BamHI and SacI. This three-way ligation strategy was adopted due to the presence of an internal SacI restriction enzyme site. This plasmid encodes, therefore, the P1 region (G355
V) of PLRV fused to the Pk tag (supplied from plasmid pVL140Pk).
pHP1XP.
Plasmid pSAB53 was doubly restricted with XhoI and PstI. The XhoIPstI restriction fragment encoding most of the PLRV P1 protein (see Fig. 1
) was purified and ligated into the E. coli expression vector pRSETb, which was similarly restricted.
pGEX-P1SP.
Plasmid pHP1XP was restricted with SmaI and EcoRI and the restriction fragment encoding the C-terminal region of PLRV P1 (delimited by the SmaI and PstI sites within P1) was purified. This fragment was ligated together with the E. coli expression vector pGEX-KT, which was similarly restricted.
pBacP1.
Sequences encoding the P1 region were amplified by PCR using the template plasmid pXL1 and primers 304 and 305. The PCR product was restricted with BglII and EcoRI, and ligated into the vector pFastBac1 (GibcoBRL), which was similarly restricted.
pBacP1Pk.
Plasmid pVLP1GVPk was initially restricted with KpnI (present in the vector sequences downstream of the insert) and subsequently SmaI. The small restriction fragment (encoding sequences downstream of the proteinase domain together with the Pk tag) was purified and ligated with the vector pBacP1, which was similarly restricted.
pBacP1GV and pBacP1GVPk.
These plasmids were obtained similarly to pBacP1 and pBacP1Pk except that instead of using pXL1 as PCR template, pSAB53 was used, which contained the G355
V mutation.
pVLTV.
Plasmid pSAB53 was restricted with KpnI, treated with mung bean nuclease to produce blunt ends, then restricted with BglII. The 5·8 kb restriction fragment, which contained the whole PLRV genome, was ligated into the vector pVL1393 (Invitrogen) restricted with SmaI and BglII.
pBacTV
X.
Plasmid pVLTV was restricted with XbaI and then recircularized (removing the majority of P1 and P2 sequences).
pGEMP1.
The whole P1 sequence was amplified with oligonucleotide primers 304 and 305 using plasmid pXL1 as a template and the PCR product was ligated into the transcription vector pGEM-T easy (Promega).
Site-directed mutagenesis.
A series of mutations were introduced into the putative proteinase domain by PCR; plasmid pBacP1 was used as template. Five conserved amino acids, three of which comprise the proposed triad of H255, D286 and S354, were mutated. Details of these constructs are shown in Table 1
. Briefly, primers 1 and 2 were used in the first-round PCR. The amplified product was then used as a primer in the second round of amplification, along with primer 3. The amplified product from second-round PCR was then restricted (as indicated) and ligated into pBacP1, which was similarly restricted. For pBacP1-3 and pBacP1-4, the products of the first-round PCR were cut with XhoI and XbaI, and ligated into similarly restricted pBacP1. The resulting donor plasmids (Table 1
, column 1) were used to generate recombinant baculovirus. The sequences of the oligonucleotides used in the generation of these mutants (and referred to in Table 1
) are: 5637, 5' TAAAGGCTTGTTTGTTAG 3'; aHA, 5' GAAAACGGCAGCGCTCTCGGGTAC 3'; bHW, 5' CCTTCTAGACACCATTCAGCTGTCACC 3'; bHA, 5' CCTTCTAGACATGCTTCAGCTGTCACC 3'; 5DE, 5' TTCATTACGGGCACTTTTG 3'; 6DA, 5' AGCATTACGGGCACTTTTG 3'; 7SC, 5' TGCGGAACAGGGTTTTGGTC 3'; 8SA, 5' GCCGGAACAGGGTTTTGGTC 3'; 9SA, 5' GCCCCAAATTATGTGTTTGA 3'.
|
Construction of recombinant baculoviruses.
X was generated by co-transfection with Bsu36I-cleaved viral DNA (Possee & Howard, 1987
Preparation of polyclonal antisera.
E. coli JM101 containing plasmid pGEX-P1SP was induced at OD600 of 1·0 with IPTG (0·4 mM) and cells were harvested 4 h later. The fusion protein GSTP1SP was purified using glutathione agarose beads, and cleaved with thrombin while still bound to the beads. The released protein, P1SP, was mixed with complete Freunds adjuvant and used to immunize rabbits. Booster injections (100 µg antigen) were administered at 2 week intervals using incomplete Freunds adjuvant. The titres were monitored by ELISA 10 days after each booster. The antisera collected after the fourth booster (500 µg antigen) were tested by ELISA and Western blotting and used in this study. Mouse monoclonal anti-Pk tag antibodies were a kind gift of R. E. Randall.
Tissue culture and baculovirus propagation.
Procedures used in virus purification, amplification and expression of PLRV proteins in Sf9 insect cells were performed as described previously (OReilly et al., 1992
). For co-infection experiments, appropriate volumes of two virus stocks were mixed and used as an inoculum.
Western blotting.
Infected Sf9 cells were harvested at the times indicated, washed with PBS and boiled after adding SDS loading buffer. Proteins were resolved by SDSPAGE (10% or 13%) and transferred onto a PVDF membrane as described previously (Bjerrum & Schafer-Nielson, 1986
). Membranes were blocked with PBS/0·1 % Tween 20/0·1% BSA/0·1% Ficoll/0·1% PVP for 4 h at room temperature or overnight at 4 °C. The rabbit polyclonal anti-P1SP primary antibodies (1:2000 dilution in blocking buffer) were incubated with the membranes for 1 h. The mouse monoclonal anti-Pk tag antibodies (1:1000 dilution in blocking buffer) were incubated with the membranes for 1 h. Membranes were then washed with PBS/0·1% Tween 20 and incubated for 1 h with peroxidase-conjugated goat anti-rabbit or mouse IgG (1:4000 dilution in blocking buffer). Bound secondary antibody was detected using enhanced chemiluminescence (Amersham).
Transcription/translation in vitro.
A coupled transcription/translation wheatgerm extract system (TNT; Promega) was programmed with 1 µg unrestricted pGEMP1 plasmid DNA and incubated at 30 °C for 90 min, in the presence of T7 RNA polymerase and [35S]methionine, as recommended by the manufacturer. Extended incubations were performed following the arrest of translation by the addition of RNase (0·5 mg/ml) and cycloheximide (0·8 mg/ml). Translation products were analysed by SDSPAGE and autoradiography.
DNA sequencing.
The nucleotide sequence of all cDNA clones derived from PCR amplification was confirmed by automated DNA sequencing using a PE Applied Biosystems 377 Prism machine.
| Results |
|---|
|
|
|---|
|
V. This mutation is at a conserved proteinase motif (GxSG), G355 corresponding to the glycine residue predicted to be involved in the formation of the oxyanion hole of the putative proteolytic domain. To investigate the effect of the G355
V mutation, two further recombinant baculoviruses were constructed (BacP1GV and BacP1GVPk), each bearing this point mutation. Western blot analyses of Sf9 cells infected with BacP1GV and BacP1GVPk viruses showed that only full-length proteins were produced (Fig. 2A
P1 processing is mediated by P1 itself
Proteolysis of P1 in baculovirus-infected Sf9 cells could be accounted for in two ways: either P1 contains a functional proteolytic domain, or the G355
V mutation renders P1 not susceptible to cleavage by an undefined cellular or baculovirus-specific proteinase. To address this question, Sf9 cells were co-infected with BacP1GVPk (Pk-tagged protein P1; not cleaved in this system), together with BacP1, the (untagged) P1 protein which was cleaved. Western blotting with monoclonal antibody directed against the Pk tag showed that protein P1GVPk was cleaved upon co-infection with BacP1 (Fig. 3
). Taken together, these data show that protein P1GVPk functioned as a substrate (alone), was processed in trans by the wild-type P1 protein (expressed from BacP1) and not by a cellular or baculovirus-specific proteinase. This conclusion is consistent with other co-infection experiments we have performed. By increasing the m.o.i. ratio of BacP1:BacP1GVPk, increased P1 processing in trans is observed. Similar observations are made with cells singly infected with BacP1Pk; at m.o.i. of 0·1, processing is partial with substantial amounts of uncleaved P1 observed (Fig. 2B
), whereas at m.o.i. of 2, processing of P1 appeared to be complete (Fig. 3
, lane 1).
|
V mutation produced an identical translation profile (data not shown). The minor translation products observed were, therefore, due to internal initiation. In each case, we were unable to observe proteolytic processing, either in cis or in trans. Extended incubations (following the arrest of translation), however, showed the appearance of two new products of ~43 kDa and ~27 kDa (Fig. 4
|
W/A, D286
E/A, S354
C/A), the proteolytic activity of all mutant P1 proteins was completely abolished; only the full-length (mutant) P1 translation product was observed.
|
| Discussion |
|---|
|
|
|---|
A PLRV P1 C-terminal, hydrophilic, basic region containing the sequence KxKxKKRxRRxxRxK separate from the VPg region and within the terminal 25 kDa (encoded by nt 18481892) has been shown to bind labelled PLRV RNA (Prüfer et al., 1999
). This has led this group to propose a model for VPg maturation in which C25 (containing VPg) is cleaved by the viral proteinase from the N-terminal region of P1. This region contains the viral proteinase and a hydrophobic region which they propose is membrane-bound. The hydrophilic C terminus, including the VPg and PLRV RNA binding region, is bound to genomic RNA and the VPg is transferred from C25 to the 5' end of the genomic RNA by some unspecified mechanism. Our data support the first part of this model if not (yet) the second.
Unexpectedly, using in vitro translation systems both wheatgerm extracts (this paper) and rabbit reticulocyte lysates (data not shown) we were unable to demonstrate a proteinase activity in cis, although we were able to detect some processing in trans upon extended incubation (2 h). In contrast, in the expression of the identical ORF in vivo, in which expressed products were present at much higher concentrations, proteolytic processing was observed. We also observed that the processing of P1 occurred more rapidly in insect cells infected at high m.o.i. (m.o.i. of 2) than those infected at low (~0·1) m.o.i.
Currently, we have no evidence for cis (intramolecular) cleavage. These data may be interpreted in two ways: firstly, that the proteinase cleaves P1 in trans and not in cis, or secondly, that the proteinase requires activation by a co-factor (supplied in trans) that would be unable to activate the proteinase due to the extremely low concentration of products generated in such cell-free translation systems. If such a cofactor is required we can conclude that: (i) if such a factor is viral in origin, this factor is present within P1 since processing was observed in vivo with only P1 luteovirus sequences present, and (ii) if it is cellular in origin, then it is present in both insect and plant cells.
Whether this cleavage reaction is related to the unusual position of the VPg downstream rather than upstream of the viral proteinase domain remains to be determined. A mechanism of cleavage in trans implies an interaction between two (or more) P1 molecules to bring about cleavage. The presence of N-terminal hydrophobic domains (thought to be involved in membrane binding) within P1 may have a significant role both in the cellular localization and kinetics of P1 association.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bahner, I., Lamb, J., Mayo, M. A. & Hay, R. T. (1990). Expression of the genome of potato leafroll virus: readthrough of the coat protein termination codon in vivo. Journal of General Virology 71, 2251-2256.
Bjerrum, O. J. & Schafer-Nielson, C. (1986). Analytical Electrophoresis. Weinheim: M. J. Dunn.
Brault, V., van den Heuvel, J. F., Verbeek, M., Ziegler-Graff, V., Reutenauer, A., Herrbach, E., Garaud, J. C., Guilley, H., Richards, K. & Jonard, G. (1995). Aphid transmission of beet western yellows luteovirus requires the minor capsid read-through protein P74. EMBO Journal 14, 650-659.[Medline]
Gorbalenya, A. E., Donchenko, A. P., Blinov, V. M. & Koonin, E. V. (1989). Cysteine proteinases of positive strand RNA viruses and chymotrypsin-like serine proteinases. A distinct protein superfamily with a common structural fold. FEBS Letters 243, 103-114.[Medline]
Habili, N. & Symons, R. H. (1989). Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Research 17, 9543-9555.
Hanke, T., Young, D. F., Doyle, C., Jones, I. & Randall, R. E. (1995). Attachment of an oligopeptide epitope to the C-terminus of recombinant SIV gp160 facilitates the construction of SMAA complexes while preserving CD4 binding. Journal of Virological Methods 53, 149-156.[Medline]
Harrison, B. D. (1984). Potato leafroll virus. CMI/AAB Descriptions of Plant Viruses, no. 291.
Keese, P., Martin, R. R., Kawchuk, L. M., Waterhouse, P. M. & Gerlach, W. L. (1990). Nucleotide sequences of an Australian and a Canadian isolate of potato leafroll luteovirus and their relationships with two European isolates. Journal of General Virology 71, 719-724.
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Medline]
Lamb, J. W., Duncan, G. H., Reavy, B., Gildow, F. E., Mayo, M. A. & Hay, R. T. (1996). Assembly of virus-like particles in insect cells infected with a baculovirus containing a modified coat protein gene of potato leafroll luteovirus. Journal of General Virology 77, 1349-1358.
Mayo, M. A. & Ziegler-Graff, V. (1996). Molecular biology of luteoviruses. Advances in Virus Research 46, 413-460.[Medline]
Mayo, M. A., Barker, H., Robinson, D. J., Tamada, T. & Harrison, B. D. (1982). Evidence that potato leafroll virus RNA is positive-stranded, is linked to a small protein and does not contain polyadenylate. Journal of General Virology 59, 163-167.
Mayo, M. A., Robinson, D. J., Jolly, C. A. & Hyman, L. (1989). Nucleotide sequence of potato leafroll luteovirus RNA. Journal of General Virology 70, 1037-1051.
Miller, W. A., Dineshkumar, S. P. & Paul, C. P. (1995). Luteovirus gene-expression. Critical Reviews in Plant Sciences 14, 179-211.
OReilly, D. R., Miller, L. K. & Luckow, V. A. (1992). Baculovirus Expression Vectors: A Laboratory Manual. New York: W. H. Freeman.
Possee, R. D. & Howard, S. C. (1987). Analysis of the polyhedrin gene promoter of the Autographa californica nuclear polyhedrosis virus. Nucleic Acids Research 15, 10233-10248.
Prüfer, D., Tacke, E., Schmitz, J., Kull, B., Kaufmann, A. & Rohde, W. (1992). Ribosomal frameshifting in plants: a novel signal directs the -1 frameshift in the synthesis of the putative viral replicase of potato leafroll luteovirus. EMBO Journal 11, 1111-1117.[Medline]
Prüfer, D., Kawchuk, L., Monecke, M., Nowok, S., Fischer, R. & Rohde, W. (1999). Immunological analysis of potato leafroll luteovirus (PLRV) P1 expression identifies a 25 kDa RNA-binding protein derived via P1 processing. Nucleic Acids Research 27, 421-425.
Reutenauer, A., Ziegler-Graff, V., Lot, H., Scheidecker, D., Guilley, H., Richards, K. & Jonard, G. (1993). Identification of beet western yellows luteovirus genes implicated in viral replication and particle morphogenesis. Virology 195, 692-699.[Medline]
Rohde, W., Gramstat, A., Schmitz, J., Tacke, E. & Prüfer, D. (1994). Plant-viruses as model systems for the study of noncanonical translation mechanisms in higher-plants. Journal of General Virology 75, 2141-2149.
Tacke, E., Schmitz, J., Prüfer, D. & Rohde, W. (1993). Mutational analysis of the nucleic acid-binding 17 kDa phosphoprotein of potato leafroll luteovirus identifies an amphipathic alpha-helix as the domain for protein/protein interactions. Virology 197, 274-282.[Medline]
van der Wilk, F., Huisman, M. J., Cornelissen, B. J. C., Huttinga, H. & Goldbach, R. (1989). Nucleotide-sequence and organization of potato leafroll virus genomic RNA. FEBS Letters 245, 51-56.[Medline]
van der Wilk, F., Verbeek, M., Dullemans, A. M. & van den Heuvel, J. F. (1997). The genome-linked protein of potato leafroll virus is located downstream of the putative proteinase domain of the ORF1 product. Virology 234, 300-303.[Medline]
Veidt, I., Bouzoubaa, S. E., Leiser, R. M., Ziegler-Graff, V., Guilley, H., Richards, K. & Jonard, G. (1992). Synthesis of full-length transcripts of beet western yellows virus RNA: messenger properties and biological activity in protoplasts. Virology 186, 192-200.[Medline]
Received 13 December 1999;
accepted 3 March 2000.
This article has been cited by other articles:
![]() |
X. Li, C. Halpin, and M. D. Ryan A novel cleavage site within the potato leafroll virus P1 polyprotein J. Gen. Virol., May 1, 2007; 88(5): 1620 - 1623. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Smits, E. J. Snijder, and R. J. de Groot Characterization of a Torovirus Main Proteinase J. Virol., April 15, 2006; 80(8): 4157 - 4167. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. El Amrani, A. Barakate, B. M. Askari, X. Li, A. G. Roberts, M. D. Ryan, and C. Halpin Coordinate Expression and Independent Subcellular Targeting of Multiple Proteins from a Single Transgene Plant Physiology, May 1, 2004; 135(1): 16 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sadowy, M. Juszczuk, C. David, B. Gronenborn, and M. D. Hulanicka Mutational analysis of the proteinase function of Potato leafroll virus J. Gen. Virol., June 1, 2001; 82(6): 1517 - 1527. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |