J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muggeridge, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muggeridge, M. I.
Agricola
Right arrow Articles by Muggeridge, M. I.
Journal of General Virology (2000), 81, 2017-2027.
© 2000 Society for General Microbiology


Animal: DNA Viruses

Characterization of cell–cell fusion mediated by herpes simplex virus 2 glycoproteins gB, gD, gH and gL in transfected cells

Martin I. Muggeridge1

Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130, USA1

Author for correspondence: Martin Muggeridge. Fax +1 318 675 5764. e-mail mmugge{at}lsumc.edu


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The mechanisms by which herpes simplex viruses (HSV) mediate fusion between their envelope and the plasma membrane during entry into cells, and between the plasma membranes of adjacent infected and uninfected cells to form multinucleated giant cells, are poorly understood. Four viral glycoproteins (gB, gD, gH and gL) are required for virus–cell fusion, whereas these plus several others are required for cell–cell fusion (syncytium formation). A better understanding would be aided by the availability of a model system, whereby fusion could be induced with a minimal set of proteins, in the absence of infection. A suitable system has now been developed for HSV-2, using transfected COS7, 293 or HEp-2 cells. Insofar as the minimal set of HSV-2 proteins required to cause cell–cell fusion in this system is gB, gD, gH and gL, it would appear to resemble virus–cell fusion rather than syncytium formation. However, the ability of a mutation in gB to enhance the fusion of both transfected cells and infected cells, while having no effect on virus–cell fusion, points to the opposite conclusion. The differential effects of a panel of anti-HSV antibodies, and of the fusion-inhibitor cyclosporin A, confirm that the fusion of transfected cells shares some properties with virus–cell fusion and others with syncytium formation. It may therefore prove useful for determining how these processes differ, and for testing the hypothesis that some viral proteins prevent membrane fusion until the appropriate point in the virus life-cycle, with other proteins then overcoming this block.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Membrane fusion by herpesviruses is not well understood, in comparison with that mediated by, for example, influenza virus or human immunodeficiency virus type 1 (HIV-1). This is due partly to the fact that fusion requires the activity of several herpesvirus proteins, and partly to the absence of any obvious counterpart to the fusion peptides of influenza haemagglutinin and HIV-1 gp120/41. In addition, herpesviruses are capable of several modes of fusion, but little is currently known about the mechanistic similarities or differences of these various modes. Herpes simplex viruses (HSV) enter cells by fusion of the virus envelope with the cell plasma membrane (Fuller & Spear, 1987Down ; Morgan et al., 1968Down ; Wittels & Spear, 1990Down ), in a process that requires the activity of glycoproteins gB, gD, gH and gL (Cai et al., 1988Down ; Forrester et al., 1992Down ; Ligas & Johnson, 1988Down ; Roop et al., 1993Down ). They can also cause the fusion of infected cells with neighbouring cells in herpes lesions, producing polykaryocytes, and this is one of the pathways by which the virus spreads in vivo (Blank et al., 1951Down ). Similarly, a limited amount of cell–cell fusion may be produced by wild-type strains of HSV in tissue culture, producing what were termed ‘small multinucleated giant cells’ (Doane et al., 1955Down ; Scott & McLeod, 1959Down ; Wheeler, 1964Down ). In contrast to the limited cell–cell fusion produced in lesions or by wild-type strains in tissue culture, many HSV variants that cause much more extensive cell–cell fusion in tissue culture have been isolated (Spear, 1993Down ). The resulting syncytial plaques may contain hundreds or thousands of nuclei, and are due to mutations in any one of four syn loci (Spear, 1993Down ). Cell–cell fusion by syncytial viruses in tissue culture has been studied in the belief that it will shed light on cell–cell fusion by wild-type viruses in lesions, and also possibly on fusion of the virus envelope with the cell plasma membrane; it requires the activity not only of gB, gD, gH and gL, but also of glycoproteins gE, gI and gM (Davis-Poynter et al., 1994Down ) and the nonglycosylated membrane protein UL45 (Haanes et al., 1994Down ).

Much of the progress in understanding the fusion mechanisms of other viruses has come from studying the fusion of cells transiently or permanently expressing the relevant virus glycoproteins. The development of a similar system for HSV would provide a model system for studying either virus–cell fusion, cell–cell fusion, or both, and possibly for illuminating the differences between them. Considerable effort has therefore gone into expressing individual HSV glycoproteins or various combinations of them in tissue culture cells and looking for cell–cell fusion. These efforts have given mixed results. Early reports that HSV-1 gB (Butcher et al., 1990Down ) or gD (Butcher et al., 1990Down ; Campadelli-Fiume et al., 1988Down ) can cause cell–cell fusion when expressed alone have not been duplicated. Furthermore, fusion was not observed when many combinations of glycoproteins were expressed using vaccinia virus or adenovirus vectors, even when proteins carrying syn mutations were included (Davis-Poynter et al., 1994Down ; Novotny et al., 1996Down ). The recent report that fusion could be consistently observed when COS cells transiently expressing HSV-1 gB, gD, gH and gL were overlaid with Vero cells was therefore surprising and encouraging (Turner et al., 1998Down ). Omission of any one of the four glycoproteins resulted in no fusion, so it was concluded that this combination is necessary and sufficient. Insofar as no additional proteins (i.e. gE, gI, gM and UL45) were required, and no syn mutation was required, the fusion appeared to resemble virus–cell fusion rather than the cell–cell fusion caused by infection with syncytial viruses (for which the term syncytium formation will be reserved).

In the current report, a transient expression system for studying membrane fusion by HSV-2 glycoproteins is described, using COS7, 293 and HEp-2 cells. In this system, cell fusion occurs when HSV-2 gB, gD, gH and gL are coexpressed, and any one of these proteins can be substituted with its HSV-1 counterpart. Fusion does not require the presence of a syn mutation, but is markedly enhanced by a syn mutation in gB, in contrast to results reported for the HSV-1 proteins (Turner et al., 1998Down ). Since virus–cell fusion and syncytium formation are affected differently by monoclonal antibodies (MAbs) against viral glycoproteins, and also by the cyclic oligopeptide cyclosporin A, the effects of these agents on the fusion of transfected cells were determined. Overall, the results demonstrate that the latter system does not exactly mimic the properties of either virus–cell fusion or syncytium formation; rather, it comprises a mixture of the properties of both, and will therefore provide an invaluable tool for investigating the mechanistic differences between them, as well as for determining the roles played by syn mutations.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
COS7, CV1 and 293 cells obtained from ATCC, and HEp-2 cells obtained from Patricia Spear, were grown in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 5% foetal bovine serum (FBS) for COS7 and CV1 and 10% FBS for 293 and HEp-2. HSV-2 strain 333 was obtained from Gary Cohen and Roselyn Eisenberg. 333syn2 and 333syn6, syncytial variants containing syn mutations in UL24 and gB, respectively, were isolated from strain 333 without mutagenesis (M. I. Muggeridge, unpublished). All viruses were propagated and titred on CV1 cells.

{blacksquare} Antibodies.
Of the antibodies described below, some were raised against HSV-2 proteins, whereas others were raised against HSV-1 proteins but are cross-reactive with their HSV-2 homologues. Only the target protein for each antibody, not the homologue against which it was raised, is given. MAbs SB1 and SB3 (both anti-gB) were described previously (Norton et al., 1998Down ). MAbs DL6, DL11 and 1D3 (all anti-gD), and SS10 (anti-gB) were provided by Gary Cohen and Roselyn Eisenberg (Cohen et al., 1986Down ; Eisenberg et al., 1985Down ; Friedman et al., 1984Down ; Krummenacher et al., 1998Down ). MAbs I-99 and III-174 (both anti-gD) were provided by Patricia Spear (Para et al., 1985Down ). MAbs AP7, AP12 and LP2 (all anti-gD) were provided by Tony Minson and Helena Browne (Minson et al., 1986Down ). MAb B4 (anti-gB) was provided by Joseph Glorioso (Marlin et al., 1986Down ). Polyclonal Abs R7 (anti-gD), R90 (anti-gB) and R137 (anti-gH) were provided by Gary Cohen and Roselyn Eisenberg.

{blacksquare} Preparation of IgG.
IgGs were purified from ascites fluids by passage through protein A–Sepharose columns (SB1, SB3, DL6, DL11, 1D3, I-99, III-174, AP7 and LP2) or protein G columns (SS10, AP12 and B4).

{blacksquare} Plasmids and cloning of glycoprotein genes.
For clarity, the relevant glycoproteins of HSV-1 and HSV-2 will be referred to as gB-1, gD-1, gH-1 and gL-1, and gB-2, gD-2, gH-2 and gL-2, respectively, unless (i) it is clear from the context which is being discussed, or (ii) both homologues are being referred to. Plasmids pSR175, pMM147, pHC138 and pCMV3gL, which express gB-1 (KOS strain), gD-1 (Patton strain), gH-1 (NS strain) and gL-1 (NS strain), respectively, were obtained from Gary Cohen and Roselyn Eisenberg. In each case the expression vector is pCMV3, which contains the immediate-early promoter from human cytomegalovirus (Andersson et al., 1989Down ). The source of the HSV-2 genes used for this study was strain 333, and again the vector was pCMV3. The gB-2 gene was cloned as a HindIII–BamHI fragment, producing plasmid pMM245, and was derived from the HindIII H fragment contained in pGR185 (obtained from Gary Hayward). The gD-2 gene was subcloned from plasmid pWW65 (provided by Gary Cohen and Roselyn Eisenberg), producing pMM346. The gH-2 and gL-2 genes were cloned as follows. CV1 cells were infected with HSV-2 at a multiplicity of 0·1 p.f.u. per cell, and harvested at 18 h post-infection. Total infected cell DNA was prepared using the Puregene kit from Gentra Systems, and the gH-2 and gL-2 open reading frames were amplified using Pfu DNA polymerase and the following primer pairs: 5' TGTCGACGCCTCTTTGGGCCGTGGGTA 3' and 5' TGTCGACGGTTGGGTTGGGCGTGGAC 3' for gH-2, and 5' TAAGCTTATTCGGTTGCTCGCGGTTG 3' and 5' TAAGCTTAGACGGGTCGGCTGTCCTG 3' for gL-2. The products were digested with SalI and HindIII, respectively, and cloned into pCMV3. Clones with the correct orientation for expression were picked, and named pMM349 (gH-2) and pMM350 (gL-2).

Plasmid pMM331 was derived from pMM245 by mutation of gB-2 codon 835 from Glu to Asp (E835D), using the QuikChange procedure (Stratagene). Note that the numbering system adopted by Pereira et al. (1989)Down for gB-1 is used, where the signal sequence is not included.

{blacksquare} Immunoperoxidase staining.
This assay has been described previously (Muggeridge et al., 1990Down ). Briefly, for recognition of proteins at the cell surface, unfixed cells were incubated sequentially with the appropriate MAb, a protein A–horseradish peroxidase conjugate, and 4-chloro-1-naphthol as substrate. For recognition of intracellular proteins, the cells were initially treated for 5 min with 5% methanol in PBS.

{blacksquare} Immunofluorescence assay.
Cells in Nunc Labtek chamber slides were fixed with 2% paraformaldehyde–2% sucrose in PBS for 5 min, and permeabilized by incubation for 5 min in DMEM–5% FBS containing 0·5% Triton X-100 detergent and 10% sucrose. Incubation with the primary antibody was for 30 min at room temperature in DMEM–5% FBS, followed by two washes with PBS. Incubation with the secondary antibody (goat anti-mouse IgG–FITC; Southern Biotechnologies) was for 30 min at room temperature in DMEM–1% FBS, followed by two washes with PBS. The slides were then examined with an Olympus fluorescence microscope.

{blacksquare} Cell fusion assay.
Thirty-five mm dishes were seeded with 7·5x104 cells, and transfected the next day, using 5 µg of each plasmid. The calcium phosphate procedure was used for COS7 and 293 cells, and Lipofectin (GibcoBRL) was used for HEp-2 cells. After 16 h, the DNA was removed, and the cells were then overlaid with 2x105 freshly trypsinized cells of the same type. The cultures were examined for cell fusion 24 and 48 h later, using a Nikon Diaphot microscope. For photography, COS7 cells were fixed with 2% paraformaldehyde–2% sucrose in PBS and stained with Giemsa. HEp-2 cells were photographed after immunofluorescent staining (see above).

{blacksquare} Virus penetration (rate-of-entry) assay.
The assay was performed essentially as described previously (Highlander et al., 1987Down ; Huang & Wagner, 1964Down ). Briefly, COS7 cells were preincubated at 4 °C for 30 min, and then replicate dishes of cells were incubated with 250 p.f.u. of virus for 1 h at 4 °C, to allow attachment but not penetration. The medium was replaced with medium prewarmed to 37 °C to allow virus entry to begin, and at various time-points the cells were treated with acid-glycine pH 3 to inactivate any virus that had not yet entered the cells. Plaques were counted after 24 h. The number of plaques produced on dishes that were not treated with acid-glycine was defined as 100%.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Verification of expression of HSV-2 glycoproteins
Expression of gB-2, gD-2 and gH-2 was verified by immunoperoxidase staining of transiently transfected COS7 cells, using rabbit polyclonal antibodies R90 for gB-2, R7 for gD-2 and R137 for gH-2, followed by a protein A–horseradish peroxidase conjugate and 4-chloro-1-naphthol as substrate (data not shown). gB-2 and gD-2 were detected with unfixed cells, and so are present at the cell surface; in contrast, gH-2 was only detected after cell fixation with methanol, indicating that, like gH-1, it is not competent for transport to the cell surface when expressed alone. Since there is no available antibody that recognizes gL-2, its expression was confirmed by its effect on gH-2. When cells were cotransfected with pMM349 (gH-2) and pMM350 (gL-2), cell surface staining with R137 (i.e. staining of unfixed cells) was observed; presumably this was due to the formation and transport of a gH-2/gL-2 heterodimer, as occurs with gH-1 and gL-1 (Hutchinson et al., 1992Down ).

Fusion of COS7 cells expressing HSV-2 glycoproteins
Thirty-five mm dishes were seeded with 7·5x104 COS7 cells, and cotransfected the next day with plasmids expressing gB-2, gD-2, gH-2 and gL-2. After 16 h, the precipitate was removed, and the cells were then overlaid with 2x105 freshly trypsinized COS7 cells. Cell fusion was evident by 24 h (not shown) and was more extensive by 48 h (Fig. 1ADown). If any one of the four plasmids was omitted, there was no fusion (omission of gD-2 is shown as an example; Fig. 1BDown). However, each protein could be replaced by its HSV-1 homologue (Fig. 1CDown–FDown), demonstrating that no type-specific interactions between any of the proteins are required for this fusion process. Insofar as the fusion of transfected cells occurred in the absence of HSV-2 gE, gI, gM and UL45, and did not require the presence of a protein carrying a syn mutation, it would appear to resemble virus–cell fusion more closely than syncytium formation.



View larger version (161K):
[in this window]
[in a new window]
 
Fig. 1. Fusion of transfected COS7 cells by HSV-2 and HSV-1 glycoproteins. COS7 cells were transfected with various combinations of glycoprotein genes, overlaid with untransfected cells the next day, and stained with Giemsa after a further 48 h. Magnification: 200x. (A) gB-2, gD-2, gH-2 and gL-2; (B) gB-2, gH-2 and gL-2; (C) gB-1, gD-2, gH-2 and gL-2; (D) gB-2, gD-1, gH-2 and gL-2; (E) gB-2, gD-2, gH-1 and gL-2; (F) gB-2, gD-2, gH-2 and gL-1.

 
Inhibition of fusion by soluble gD-1
The demonstration that soluble truncated HSV-1 gD blocks infection of cells was an early indication that gD is involved in a receptor-binding step after the initial interaction of the virus with heparan sulfate proteoglycans (Johnson et al., 1990Down ). Since then, several alternative cell surface proteins (termed herpesvirus entry proteins, or Hve co-receptors) have been identified as able to fulfil this role for HSV-1, HSV-2 or both (Cocchi et al., 1998Down ; Geraghty et al., 1998Down ; Montgomery et al., 1996Down ; Warner et al., 1998Down ). Nicola et al. (1996)Down found that a form of gD-1 lacking functional region IV [gD-1({Delta}290–299t)] has enhanced inhibitory activity, and this was subsequently shown to be due to its enhanced binding to the Hve co-receptors (Willis et al., 1998Down ). Soluble truncated wild-type gD-1 and gD-1({Delta}290–299t) were therefore tested for their ability to inhibit fusion of COS7 cells coexpressing gB-2, gD-2, gH-2 and gL-2. At the highest concentration tested (250 µg/ml), the wild-type protein had no effect (not shown); however, gD-1({Delta}290–299t) at this concentration reduced both the number and the size of foci of fusion (Fig. 2Down). This result suggests that an interaction between gD-2 and a cellular co-receptor is involved in the fusion process, and that gD-1({Delta}290–299t) binds more strongly to the co-receptor on COS7 cells than does wild-type gD-1.



View larger version (137K):
[in this window]
[in a new window]
 
Fig. 2. Inhibition of fusion of transfected COS7 cells by a soluble truncated form of gD-1. COS7 cells were co-transfected with plasmids expressing gB-2, gD-2, gH-2 and gL-2, overlaid with untransfected cells the next day, and stained after a further 48 h. Magnification: 100x. (A) No soluble gD added; (B) gD-1({Delta}290–299t) added at 250 µg/ml, for final 48 h.

 
Comparison of a gB-2 syn mutant with wild-type gB-2 in virus entry and in the fusion of transfected cells
As described above, the observation that fusion of transfected cells can occur in the absence of four proteins required for syncytium formation but not for virus entry (i.e. gE, gI, gM and UL45) suggested that it resembles the latter process rather than the former. Since syncytium formation differs from virus entry in several additional aspects, fusion of transfected cells was characterized with regard to each of these aspects in turn. This characterization was crucial for assessing its utility as a model system.

The first aspect to be addressed was the effect of a syn mutation. Neither HSV-1 nor HSV-2 causes extensive cell–cell fusion (i.e. syncytium formation) in tissue culture unless the virus carries a mutation in any one of several syn loci. For HSV-1, these loci are gB, gK, UL20 and UL24, and the relevant mutations are missense mutations for gB and gK, and nonsense mutations for UL20 and UL24 (Spear, 1993Down ). Unfortunately, nothing is known about the mechanisms by which these mutations influence fusion. Syncytial mutants of HSV-2 have been less well studied, but the syncytial phenotype of strain 333syn6 (derived from HSV-2 strain 333) has been shown to be due to mutation of gB-2 residue 835 from glutamic acid to aspartic acid (M. I. Muggeridge, unpublished results). The effects of this gB-2syn mutation on virus entry (i.e. virus–cell fusion) and on the fusion of transfected COS7 cells were therefore investigated. The effect of the mutation on virus–cell fusion was examined by comparing the rates of virus penetration into COS7 cells of HSV-2 strain 333 and the 333syn6 mutant. As can be seen from Fig. 3Down, the mutation had little if any effect on the rate of virus penetration, so it does not influence fusion between the virus envelope and the cell plasma membrane.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Effect of a syn mutation in gB-2 on virus entry. The viruses used were HSV-2 strain 333 ({triangleup}) and 333syn6 ({circ}). Each point is the mean of three independent determinations, and the error bars correspond to one standard deviation.

 
In contrast to the above result, the gB-2syn mutation had a pronounced effect on the fusion of transfected COS7 cells. At 24 h after overlay of transfected cells co-expressing wild-type gB-2, gD-2, gH-2 and gL-2, only small foci of fusion were present (not shown), whereas fusion was already substantial at this time in a parallel culture receiving gB-2syn instead of wild-type gB-2 (Fig. 4ADown). At 48 h, fusion associated with wild-type gB-2 expression (Fig. 4CDown) was similar to that obtained with gB-2syn at 24 h; however, fusion associated with gB-2syn expression was by now extensive, involving the majority of cells in the culture (Fig. 4BDown). Thus, the effect the mutation has on syncytium formation is reproduced in its effect on the fusion of transfected cells, suggesting a mechanistic link between these two processes. This result contrasts with that obtained with the corresponding HSV-1 glycoproteins, where substitution of a gB-1syn mutant did not enhance the fusion of transfected cells (Turner et al., 1998Down ). At this point, the reason for the discrepancy is unclear; it may reflect a difference between membrane fusion mediated by HSV-1 and HSV-2, or it may have a technical explanation.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 4. Effect of a syn mutation in gB-2 on cell fusion. COS7 cells were co-transfected with plasmids expressing gD-2, gH-2, gL-2 and either syn gB-2 (A and B) or wild-type gB-2 (C). They were overlaid with untransfected cells the next day, and stained after a further 24 h (A) or 48 h (B and C). Magnification: 100x (A), 200x (B and C).

 
Therefore, analysis of the effects of a gB-2syn mutation suggests that fusion of transfected cells resembles syncytium formation more closely than virus–cell fusion. While not directly bearing on this point, it should be mentioned that despite the ability of the mutation to enhance cell–cell fusion of transfected cells, it did not affect the requirement for all four glycoproteins in order for fusion to occur (data not shown).

Effects of cyclosporin A on membrane fusion
The second aspect to be addressed, concerning differences between the various modes of fusion, was the effect of the cyclic oligopeptide cyclosporin A. Although its mechanism of action is not known, cyclosporin A blocks cell–cell fusion by syncytial strains of HSV-1 if the syn mutation is in gK or UL24; however, it does not block syncytium formation by HSV-1 if the mutation is in gB, nor does it block entry of HSV into cells (McKenzie et al., 1987Down ; Walev et al., 1991Down , 1994Down ). The effects of cyclosporin A on syncytium formation by HSV-2 mutants and on the fusion of transfected cells were therefore compared. At 25 µM, the highest concentration that was not toxic to the cells, cyclosporin A blocked fusion by mutant 333syn2, which has a syn mutation in the UL24 gene (Fig. 5CDown, DDown), but had no effect on fusion by mutant 333syn6, which has a syn mutation in the gB gene (Fig. 5EDown, FDown). These results indicate that syn mutations in HSV-2 UL24 and gB may promote cell–cell fusion by different mechanisms, of which only the former is sensitive to cyclosporin A, and that this feature is shared with HSV-1 mutants. When added to cell cultures co-expressing gB-2, gD-2, gH-2 and gL-2, cyclosporin A had no effect on cell–cell fusion (compare Fig. 5BDown with 5ADown). The most straightforward conclusion from these results is that cell–cell fusion resulting from the co-expression of gB-2, gD-2, gH-2 and gL-2, in common with virus–cell fusion and with syncytium formation due to a mutation in gB-2, does not involve a cyclosporin A-sensitive step that is required for syncytium formation when the syn mutation is in UL24.



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 5. Effect of cyclosporin A on cell–cell fusion. COS7 cells were either co-transfected with plasmids expressing gB-2, gD-2, gH-2 and gL-2, and overlaid with untransfected cells the next day (A and B), or infected with HSV-2 333syn2 (C and D) or 333syn6 (E and F). Cyclosporin A was added to dishes B, D and F. The transfected cells were stained at 48 h after overlay; the infected cells were stained at 24 h post-infection. Magnification: 200x (A and B), 40x (C–F).

 
Effects of anti-gB and anti-gD MAbs on membrane fusion
The final criterion for comparing modes of fusion was based on previous reports that some MAbs block either virus entry or syncytium formation but not both. The question, therefore, was whether the effects of the MAbs on fusion of transfected cells would mimic their effects on virus entry or on syncytium formation. The MAbs used were limited to those which: (i) recognize gB-2 or gD-2, as there are none that recognize gH-2 or gL-2; (ii) bind to their target protein on the surface of transfected cells (data not shown); (iii) were available in relatively large amounts. Furthermore, all experiments were done with purified IgG, to eliminate potential differences caused by variations in antibody concentration in ascites fluids or by other components of ascites fluids. Each MAb was first tested for its ability to block virus entry (as shown by complement-independent neutralizing activity). For this assay, virus was incubated for 1 h at 37 °C in the presence of various amounts of purified IgG, and then plated on COS7 cells. After 1 h at 37 °C the inoculum was removed, and replaced with fresh medium. Plaques were counted the following day. The amount of each MAb required for 50% neutralization is shown in Table 1Down. MAbs I-99, SB1 and SB3 had no effect, whereas III-174 and 1D3 were the most effective, followed by LP2 and DL11, then AP12, SS10 and B4. DL6 reduced the virus titre at the highest concentration tested, but by less than 50%, and AP7, as observed previously (Minson et al., 1986Down ), actually increased the number of virus plaques by about 50%. The reason for the effect of AP7 is unclear; possibly it enhances the interaction between gD-2 and a co-receptor.


View this table:
[in this window]
[in a new window]
 
Table 1. Quantities of IgG needed for 50% complement-independent neutralization

 
The MAbs were next tested for their ability to block syncytium formation by 333syn6. To eliminate any effect of the MAbs on virus entry in this assay, the inoculum was removed after 1 h at 37 °C and the cultures then treated with acid-glycine pH 3·0 to inactivate any remaining extracellular virus. Fresh medium was then added, together with a MAb at 100 µg IgG/ml, and the cells were incubated for 24 h (examples are shown in Fig. 6ADown–DDown). Of the anti-gD MAbs, syncytium formation was inhibited by LP2, DL11, III-174, I-99, 1D3, AP7 and AP12, but not by DL6. Of the anti-gB MAbs tested (SB1, SB3, B4 and SS10), none inhibited syncytium formation. Note, however, that B4 did not recognize gB-2 on the surface of infected cells in an immunofluorescence assay.



View larger version (159K):
[in this window]
[in a new window]
 
Fig. 6. Effect of MAbs on cell–cell fusion. COS7 cells were either infected with HSV-2 333syn6 (A–D), or co-transfected with plasmids expressing gB-2, gD-2, gH-2 and gL-2 and overlaid with untransfected cells the next day (E–H). MAbs were added as follows: none (A and E); III-174 (B and F); DL6 (C and G); SB1 (D and H). The infected cells were stained at 24 h post-infection; the transfected cells were stained at 48 h after overlay. Magnification: 40x (A–D), 200x (E–H).

 
Finally, the panel of MAbs was tested for the ability to block fusion of transfected COS7 cells co-expressing gB-2, gD-2, gH-2 and gL-2, and examples of the results are shown in Fig. 6Up(EUp–HUp). Fusion was completely inhibited by all the anti-gD MAbs. It was partially inhibited by the anti-gB MAbs SS10 and B4, in that there were fewer foci of fusion, but not inhibited at all by the anti-gB MAbs SB1 and SB3.

Therefore, the results present a mixed picture, in that the effects of the anti-gD MAbs on fusion of transfected cells generally match their effects on syncytium formation, whereas the effects of the anti-gB MAbs match their effects on virus–cell fusion. Taken together with the effects of cyclosporin A and the gB-2syn mutation, the overall conclusion is that cell–cell fusion due to co-expression of gB-2, gD-2, gH-2 and gL-2 shares some properties of virus–cell fusion and some properties of syncytium formation, rather than closely resembling one process or the other.

Fusion of other cell types
To determine if gB-2, gD-2, gH-2 and gL-2 would cause fusion in cells other than COS7s, they were coexpressed in 293 and HEp-2 cells. Fusion of 293 cells was comparable to, or even more extensive, than fusion of COS7 cells; nevertheless, the rate and extent of fusion were increased by the E835D syn mutation in gB-2 (not shown). In contrast to results with COS7 and 293 cells, fusion of HEp-2 cells coexpressing wild-type gB-2, gD-2, gH-2 and gL-2 was quite rare, despite a comparable transfection efficiency, and the foci of fusion were small (Fig. 7ADown). However, substitution of gB-2syn for wild-type gB-2 resulted in substantial amounts of fusion (Fig. 7B.Down)



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 7. Fusion of HEp-2 cells. HEp-2 cells were co-transfected with plasmids expressing gD-2, gH-2, gL-2 and either wild-type gB-2 (A) or syn gB-2 (B). They were overlaid with untransfected cells the next day, and stained by immunofluorescence after a further 48 h. Magnification: 400x.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Many advances in understanding the mechanisms of virus–cell membrane fusion have come from studying cell–cell fusion, where the initiator of the fusion event is a cell line expressing the relevant viral protein(s) (Bentz, 1993Down ). Attempts to develop a system of this type for herpes simplex viruses were not reproducibly successful until Turner et al. (1998)Down showed that COS cells transiently expressing HSV-1 gB, gD, gH and gL will fuse with Vero cells. In the present study, a related system has been established for the corresponding HSV-2 proteins, using three cell types, namely COS7, 293 and HEp-2 cells. As with the HSV-1 system, the minimal set of proteins required for fusion was gB, gD, gH and gL. Furthermore, it was found that any of the HSV-2 proteins can be replaced by its HSV-1 homologue, indicating that there is no requirement for type-specific protein–protein interactions.

The ability of various agents to enhance or inhibit the fusion of transfected cells was then determined, as the utility of the assay as a model system depends on having a clear understanding of its properties compared to those of virus–cell fusion and syncytium formation. First it was shown that the fusion of transfected cells is inhibited by a soluble form of gD-1 [gD-1({Delta}290–299t)] that was previously shown to block virus entry into cells (Nicola et al., 1996Down ; Willis et al., 1998Down ). This result suggests that fusion requires an interaction between gD-2 on the transfected cells and a co-receptor on the target cells, as is also the case for virus–cell fusion (Montgomery et al., 1996Down ) and syncytium formation (Terry-Allison et al., 1998Down ). It would be interesting to determine which of the various Hve co-receptors can interact with gD-2 in cell–cell fusion; however, such experiments cannot currently be performed, as the Chinese hamster ovary cells used to derive cell lines expressing the receptors also express an unidentified co-receptor that can be used by HSV-2 (Montgomery et al., 1996Down ).

The next criterion by which the various modes of fusion were compared was the effect of a syn mutation in gB-2. By definition, this mutation enhances syncytium formation. It was also found to enhance the fusion of transfected cells, when co-expressed with gD-2, gH-2 and gL-2, but it had no effect on virus–cell fusion. This was the first result to suggest that the fusion of cells co-expressing gB-2, gD-2, gH-2 and gL-2 is not a precise model for virus–cell fusion. Furthermore, it suggests that syncytium formation and the fusion of transfected cells share some feature that is absent from virus–cell fusion, and that the syn mutation operates only when the donor membrane (i.e. the one containing the viral membrane proteins) is a cell membrane rather than a viral membrane. The effect of the mutation on cell–cell fusion may be explained in various ways, including the following: (i) an altered interaction with a cellular protein; (ii) an altered interaction with a viral protein, namely gD-2 or the gH-2:gL-2 complex; or (iii) alteration of a property inherent to gB-2, such as its mobility in the plane of the membrane.

The different modes of fusion were next compared by examining the effects of cyclosporin A, a drug whose inhibitory effects on syncytium formation have been well documented for HSV-1. Cyclosporin A had no effect on the fusion of transfected cells coexpressing gB-2, gD-2, gH-2 and gL-2, nor did it inhibit syncytium formation by an HSV-2 mutant carrying a syn mutation in gB. Similarly, it has previously been shown to have no effect either on syncytium formation by HSV-1 mutants with syn mutations in gB (McKenzie et al., 1987Down ; Walev et al., 1991Down , 1994Down ), or on membrane fusion during virus entry (McKenzie et al., 1987Down ). In contrast, in the present study with HSV-2, and previous studies with HSV-1, cyclosporin A did inhibit syncytium formation when the syn locus was anywhere other than gB (McKenzie et al., 1987Down ; Walev et al., 1991Down , 1994Down ). The full significance of these results will not be apparent until the mechanism of action of cyclosporin A is determined. Nevertheless, they suggest that cell–cell fusion by viruses with syn loci at either gK or UL24 shares a cyclosporin A-sensitive step that is not involved in virus entry, in fusion of transfected cells coexpressing gB-2, gD-2, gH-2 and gL-2, or in syncytium formation by gB syn mutants.

Finally, the effects of a panel of MAbs were compared. Of MAbs targeted to gD-2, all eight inhibited the fusion of transfected cells coexpressing gB-2, gD-2, gH-2 and gL-2, and seven inhibited syncytium formation, whereas only five of these seven inhibited virus–cell fusion (as shown by complement-independent neutralizing activity). Of four MAbs targeted to gB-2, two partially inhibited the fusion of cells coexpressing gB-2, gD-2, gH-2 and gL-2, and also inhibited virus–cell fusion, but none blocked syncytium formation. Thus, the effects of the anti-gD MAbs suggest a mechanistic link between the fusion of transfected cells and syncytium formation, whereas the effects of the anti-gB MAbs suggest a link between the fusion of transfected cells and virus–cell fusion.

Overall, the fusion of cells coexpressing gB-2, gD-2, gH-2 and gL-2 in some respects resembles virus–cell fusion, whereas in others it resembles cell–cell fusion caused by syncytial viruses. Therefore, it may prove useful for determining how these processes differ, and how the syn mutations exert their effects. One hypothesis that could be tested is that the virus encodes one or more proteins whose function is to prevent membrane fusion until the appropriate point in the virus life-cycle, and that other proteins act to release this ‘safety catch’; an extension of this hypothesis is that syn mutations in some way bypass the safety catch.


   Acknowledgments
 
This investigation was supported by Public Health Service grant AI42146 from the National Institute of Allergy and Infectious Diseases (NIAID). The support of the LSUHSC Center for Excellence in Cancer Research is also acknowledged. I am grateful to Gary Cohen and Roz Eisenberg for providing plasmids pWW65, pMM147, pSR175, pHC138 and pCMV3gL, polyclonal antibodies R7, R90 and R137, soluble forms of gD-1, and MAbs DL6, DL11, 1D3 and SS10, to Pat Spear for providing MAbs I-99 and III-174, to Tony Minson and Helena Browne for providing MAbs AP7, AP12 and LP2, to Joseph Glorioso for providing MAb B4, and to Gary Hayward for providing plasmid pGR185.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Andersson, S., Davis, D. N., Dahlback, H., Jornvall, H. & Russell, D. W. (1989). Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme.Journal of Biological Chemistry264, 8222-8229.[Abstract/Free Full Text]

Bentz, J. (1993). Viral Fusion Mechanisms. Boca Raton, FL: CRC Press.

Blank, H., Burgoon, C. F., Baldridge, G. D., McCarthy, P. L. & Urbach, F. (1951). Cytologic smears in diagnosis of herpes simplex, herpes zoster, and varicella.Journal of the American Medical Association 146, 1410-1412.

Butcher, M., Raviprakash, K. & Ghosh, H. P. (1990). Acid pH-induced fusion of cells by herpes simplex virus glycoproteins gB and gD. Journal of Biological Chemistry265, 5862-5868.[Abstract/Free Full Text]

Cai, W., Gu, B. & Person, S. (1988). Role of glycoprotein B of herpes simplex virus type 1 in viral entry and cell fusion.Journal of Virology62, 2596-2604.[Abstract/Free Full Text]

Campadelli-Fiume, G., Avitabile, E., Fini, S., Stirpe, D., Arsenakis, M. & Roizman, B. (1988). Herpes simplex virus glycoprotein D is sufficient to induce spontaneous pH-independent fusion in a cell line that constitutively expresses the glycoprotein.Virology166, 598-602.[Medline]

Cocchi, F., Menotti, L., Mirandola, P., Lopez, M. & Campadelli-Fiume, G. (1998). The ectodomain of a novel member of the immunoglobulin superfamily related to the poliovirus receptor has the attributes of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells.Journal of Virology72, 9992-10002.[Abstract/Free Full Text]

Cohen, G. H., Isola, V. J., Kuhns, J., Berman, P. W. & Eisenberg, R. J. (1986). Localization of discontinuous epitopes of herpes simplex virus glycoprotein D: use of a nondenaturing (‘native’ gel) system of polyacrylamide gel electrophoresis coupled with Western blotting.Journal of Virology60, 157-166.[Abstract/Free Full Text]

Davis-Poynter, N., Bell, S., Minson, T. & Browne, H. (1994). Analysis of the contributions of herpes simplex virus type 1 membrane proteins to the induction of cell-cell fusion.Journal of Virology68, 7586-7590.[Abstract/Free Full Text]

Doane, F., Rhodes, A. J. & Ormsby, H. L. (1955). Tissue culture techniques in the study of herpetic infections of the eye. American Journal of Ophthalmology40, 189-193.[Medline]

Eisenberg, R. J., Long, D., Ponce de Leon, M., Matthews, J. T., Spear, P. G., Gibson, M. G., Lasky, L. A., Berman, P., Golub, E. & Cohen, G. H. (1985). Localization of epitopes of herpes simplex virus type 1 glycoprotein D. Journal of Virology53, 634-644.[Abstract/Free Full Text]

Forrester, A., Farrell, H., Wilkinson, G., Kaye, J., Davis-Poynter, N. & Minson, T. (1992). Construction and properties of a mutant of herpes simplex virus type 1 with glycoprotein H coding sequences deleted.Journal of Virology66, 341-348.[Abstract/Free Full Text]

Friedman, H. M., Cohen, G. H., Eisenberg, R. J., Seidel, C. A. & Cines, D. B. (1984). Glycoprotein C of herpes simplex virus 1 acts as a receptor for the C3b complement component on infected cells.Nature309, 633-635.[Medline]

Fuller, A. O. & Spear, P. G. (1987). Anti-glycoprotein D antibodies that permit adsorption but block infection by herpes simplex virus 1 prevent virion-cell fusion at the cell surface. Proceedings of the National Academy of Sciences, USA84, 5454-5458.[Abstract/Free Full Text]

Geraghty, R. J., Krummenacher, C., Cohen, G. H., Eisenberg, R. J. & Spear, P. G. (1998). Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor.Science280, 1618-1620.[Abstract/Free Full Text]

Haanes, E. J., Nelson, C. M., Soule, C. L. & Goodman, J. L. (1994). The UL45 gene product is required for herpes simplex virus type 1 glycoprotein B-induced fusion.Journal of Virology68, 5825-5834.[Abstract/Free Full Text]

Highlander, S. L., Sutherland, S. L., Gage, P. J., Johnson, D. C., Levine, M. & Glorioso, J. C. (1987). Neutralizing monoclonal antibodies specific for herpes simplex virus glycoprotein D inhibit virus penetration.Journal of Virology61, 3356-3364.[Abstract/Free Full Text]

Huang, A. & Wagner, R. (1964). Penetration of herpes simplex virus into human epidermoid cells.Proceedings of the Society for Experimental Biology and Medicine116, 863-869.

Hutchinson, L., Browne, H., Wargent, V., Davis-Poynter, N., Primorac, S., Goldsmith, K., Minson, A. C. & Johnson, D. C. (1992). A novel herpes simplex virus glycoprotein, gL, forms a complex with glycoprotein H (gH) and affects normal folding and surface expression of gH. Journal of Virology66, 2240-2250.[Abstract/Free Full Text]

Johnson, D. C., Burke, R. L. & Gregory, T. (1990). Soluble forms of herpes simplex virus glycoprotein D bind to a limited number of cell surface receptors and inhibit virus entry into cells.Journal of Virology64, 2569-2576.[Abstract/Free Full Text]

Krummenacher, C., Nicola, A. V., Whitbeck, J. C., Lou, H., Hou, W., Lambris, J. D., Geraghty, R. J., Spear, P. G., Cohen, G. H. & Eisenberg, R. J. (1998). Herpes simplex virus glycoprotein D can bind to poliovirus receptor-related protein 1 or herpesvirus entry mediator, two structurally unrelated mediators of virus entry.Journal of Virology72, 7064-7074.[Abstract/Free Full Text]

Ligas, M. W. & Johnson, D. C. (1988). A herpes simplex virus mutant in which glycoprotein D sequences are replaced by {beta}-galactosidase sequences binds to but is unable to penetrate into cells. Journal of Virology62, 1486-1494.[Abstract/Free Full Text]

McKenzie, R. C., Epand, R. M. & Johnson, D. C. (1987). Cyclosporine A inhibits herpes simplex virus-induced cell fusion but not virus penetration into cells.Virology159, 1-9.[Medline]

Marlin, S. D., Highlander, S. L., Holland, T. C., Levine, M. & Glorioso, J. C. (1986). Antigenic variation (mar mutations) in herpes simplex virus glycoprotein B can induce temperature-dependent alterations in gB processing & virus production.Journal of Virology59, 142-153.[Abstract/Free Full Text]

Minson, A. C., Hodgman, T. C., Digard, P., Hancock, D. C., Bell, S. E. & Buckmaster, E. A. (1986). An analysis of the biological properties of monoclonal antibodies against glycoprotein D of herpes simplex virus and identification of amino acid substitutions that confer resistance to neutralization.Journal of General Virology67, 1001-1013.[Abstract/Free Full Text]

Montgomery, R. I., Warner, M. S., Lum, B. J. & Spear, P. G. (1996). Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family.Cell87, 427-436.[Medline]

Morgan, C., Rose, H. M. & Mednis, B. (1968). Electron microscopy of herpes simplex virus. I. Entry.Journal of Virology2, 507-516.[Abstract/Free Full Text]

Muggeridge, M. I., Wu, T.-T., Johnson, D. C., Glorioso, J. C., Eisenberg, R. J. & Cohen, G. H. (1990). Antigenic and functional analysis of a neutralization site of HSV-1 glycoprotein D. Virology174, 375-387.[Medline]

Nicola, A. V., Willis, S. H., Naidoo, N. N., Eisenberg, R. J. & Cohen, G. H. (1996). Structure-function analysis of soluble forms of herpes simplex virus glycoprotein D.Journal of Virology70, 3815-3822.[Abstract/Free Full Text]

Norton, D. D., Dwyer, D. S. & Muggeridge, M. I. (1998). Use of a neural network secondary structure prediction to define targets for mutagenesis of herpes simplex virus glycoprotein B.Virus Research55, 37-48.[Medline]

Novotny, M. J., Parish, M. L. & Spear, P. G. (1996). Variability of herpes simplex virus 1 gL and anti-gL antibodies that inhibit cell fusion but not viral infectivity.Virology221, 1-13.[Medline]

Para, M. F., Parish, M. L., Noble, A. G. & Spear, P. G. (1985). Potent neutralizing activity associated with anti-glycoprotein D specificity among monoclonal antibodies selected for binding to herpes simplex virions. Journal of Virology55, 483-488.[Abstract/Free Full Text]

Pereira, L., Ali, M., Kousoulas, K., Huo, B. & Banks, T. (1989). Domain structure of herpes simplex virus 1 glycoprotein B: neutralizing epitopes map in regions of continuous and discontinuous residues.Virology172, 11-24.[Medline]

Roop, C., Hutchinson, L. & Johnson, D. C. (1993). A mutant herpes simplex virus type 1 unable to express glycoprotein L cannot enter cells, and its particles lack glycoprotein H.Journal of Virology67, 2285-2297.[Abstract/Free Full Text]

Scott, T. F. M. & McLeod, D. L. (1959). Cellular responses to infection with strains of herpes simplex virus.Annals of the New York Academy of Sciences 81, 118-128.

Spear, P. G. (1993). Membrane fusion induced by herpes simplex virus. In Viral Fusion Mechanisms, pp. 201-232. Edited by J. Bentz. Boca Raton, FL: CRC Press.

Terry-Allison, T., Montgomery, R. I., Whitbeck, J. C., Xu, R., Cohen, G. H., Eisenberg, R. J. & Spear, P. G. (1998). HveA (herpesvirus entry mediator A), a coreceptor for herpes simplex virus entry, also participates in virus-induced cell fusion.Journal of Virology72, 5802-5810.[Abstract/Free Full Text]

Turner, A., Bruun, B., Minson, T. & Browne, H. (1998). Glycoproteins gB, gD, and gHgL of herpes simplex virus type 1 are necessary and sufficient to mediate membrane fusion in a Cos cell transfection system.Journal of Virology72, 873-875.[Abstract/Free Full Text]

Walev, I., Weise, K. & Falke, D. (1991). Differentiation of herpes simplex virus-induced fusion from without and fusion from within by cyclosporin A and compound 48/80.Journal of General Virology72, 1377-1382.[Abstract/Free Full Text]

Walev, I., Lingen, M., Lazzaro, M., Weise, K. & Falke, D. (1994). Cyclosporin A resistance of herpes simplex virus-induced ‘fusion from within’ as a phenotypical marker of mutations in the syn 3 locus of the glycoprotein B gene.Virus Genes8, 83-86.[Medline]

Warner, M. S., Geraghty, R. J., Martinez, W. M., Montgomery, R. I., Whitbeck, J. C., Xu, R., Eisenberg, R. J., Cohen, G. H. & Spear, P. G. (1998). A cell surface protein with herpesvirus entry activity (HveB) confers susceptibility to infection by mutants of herpes simplex virus type 1, herpes simplex virus type 2, and pseudorabies virus.Virology246, 179-189.[Medline]

Wheeler, C. E.Jr (1964). Biologic comparison of a syncytial and a small giant cell-forming strain of herpes simplex.Journal of Immunology93, 749-756.

Willis, S. H., Rux, A. H., Peng, C., Whitbeck, J. C., Nicola, A. V., Lou, H., Hou, W., Salvador, L., Eisenberg, R. J. & Cohen, G. H. (1998). Examination of the kinetics of herpes simplex virus glycoprotein D binding to the herpesvirus entry mediator, using surface plasmon resonance. Journal of Virology72, 5937-5947.[Abstract/Free Full Text]

Wittels, M. & Spear, P. G. (1990). Penetration of cells by herpes simplex virus does not require a low pH-dependent endocytic pathway.Virus Research18, 271-290.

Received 31 January 2000; accepted 24 April 2000.


This article has been cited by other articles:


Home page
J. Virol.Home page
V. N. Chouljenko, A. V. Iyer, S. Chowdhury, D. V. Chouljenko, and K. G. Kousoulas
The Amino Terminus of Herpes Simplex Virus Type 1 Glycoprotein K (gK) Modulates gB-Mediated Virus-Induced Cell Fusion and Virion Egress
J. Virol., December 1, 2009; 83(23): 12301 - 12313.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. D. O'Donnell and D. Shukla
A Novel Function of Heparan Sulfate in the Regulation of Cell-Cell Fusion
J. Biol. Chem., October 23, 2009; 284(43): 29654 - 29665.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. K. Isaacson and T. Compton
Human Cytomegalovirus Glycoprotein B Is Required for Virus Entry and Cell-to-Cell Spread but Not for Virion Attachment, Assembly, or Egress
J. Virol., April 15, 2009; 83(8): 3891 - 3903.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
R. Akkarawongsa, N. E. Pocaro, G. Case, A. W. Kolb, and C. R. Brandt
Multiple Peptides Homologous to Herpes Simplex Virus Type 1 Glycoprotein B Inhibit Viral Infection
Antimicrob. Agents Chemother., March 1, 2009; 53(3): 987 - 996.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. J. Reimer, M. Backovic, C. G. Deshpande, T. Jardetzky, and R. Longnecker
Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis
J. Virol., January 15, 2009; 83(2): 734 - 747.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. P. Foster, V. N. Chouljenko, and K. G. Kousoulas
Functional and Physical Interactions of the Herpes Simplex Virus Type 1 UL20 Membrane Protein with Glycoprotein K
J. Virol., July 1, 2008; 82(13): 6310 - 6323.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. Beitia Ortiz de Zarate, L. Cantero-Aguilar, M. Longo, C. Berlioz-Torrent, and F. Rozenberg
Contribution of Endocytic Motifs in the Cytoplasmic Tail of Herpes Simplex Virus Type 1 Glycoprotein B to Virus Replication and Cell-Cell Fusion
J. Virol., December 15, 2007; 81(24): 13889 - 13903.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Tiwari, S. Y. Shukla, B. Y. J. T. Yue, and D. Shukla
Herpes simplex virus type 2 entry into cultured human corneal fibroblasts is mediated by herpesvirus entry mediator
J. Gen. Virol., August 1, 2007; 88(8): 2106 - 2110.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. M. Cairns, L. S. Friedman, H. Lou, J. C. Whitbeck, M. S. Shaner, G. H. Cohen, and R. J. Eisenberg
N-Terminal Mutants of Herpes Simplex Virus Type 2 gH Are Transported without gL but Require gL for Function
J. Virol., May 15, 2007; 81(10): 5102 - 5111.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. P. Hannah, E. E. Heldwein, F. C. Bender, G. H. Cohen, and R. J. Eisenberg
Mutational Evidence of Internal Fusion Loops in Herpes Simplex Virus Glycoprotein B
J. Virol., May 1, 2007; 81(9): 4858 - 4865.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. P. Subramanian and R. J. Geraghty
Herpes simplex virus type 1 mediates fusion through a hemifusion intermediate by sequential activity of glycoproteins D, H, L, and B
PNAS, February 20, 2007; 104(8): 2903 - 2908.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Li, T. J. Minova-Foster, D. D. Norton, and M. I. Muggeridge
Identification of Functional Domains in Herpes Simplex Virus 2 Glycoprotein B
J. Virol., April 15, 2006; 80(8): 3792 - 3800.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. M. Cairns, M. S. Shaner, Y. Zuo, M. Ponce-de-Leon, I. Baribaud, R. J. Eisenberg, G. H. Cohen, and J. C. Whitbeck
Epitope Mapping of Herpes Simplex Virus Type 2 gH/gL Defines Distinct Antigenic Sites, Including Some Associated with Biological Function
J. Virol., March 15, 2006; 80(6): 2596 - 2608.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Gianni, A. Piccoli, C. Bertucci, and G. Campadelli-Fiume
Heptad Repeat 2 in Herpes Simplex Virus 1 gH Interacts with Heptad Repeat 1 and Is Critical for Virus Entry and Fusion
J. Virol., March 1, 2006; 80(5): 2216 - 2224.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. C. Bender, J. C. Whitbeck, H. Lou, G. H. Cohen, and R. J. Eisenberg
Herpes Simplex Virus Glycoprotein B Binds to Cell Surfaces Independently of Heparan Sulfate and Blocks Virus Entry
J. Virol., September 15, 2005; 79(18): 11588 - 11597.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. H. Ch'ng and L.W. Enquist
Neuron-to-Cell Spread of Pseudorabies Virus in a Compartmented Neuronal Culture System
J. Virol., September 1, 2005; 79(17): 10875 - 10889.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. V. Nicola, J. Hou, E. O. Major, and S. E. Straus
Herpes Simplex Virus Type 1 Enters Human Epidermal Keratinocytes, but Not Neurons, via a pH-Dependent Endocytic Pathway
J. Virol., June 15, 2005; 79(12): 7609 - 7616.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. R. Kinzler and T. Compton
Characterization of Human Cytomegalovirus Glycoprotein-Induced Cell-Cell Fusion
J. Virol., June 15, 2005; 79(12): 7827 - 7837.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. S. B. Milne, A. V. Nicola, J. C. Whitbeck, R. J. Eisenberg, and G. H. Cohen
Glycoprotein D Receptor-Dependent, Low-pH-Independent Endocytic Entry of Herpes Simplex Virus Type 1
J. Virol., June 1, 2005; 79(11): 6655 - 6663.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Perez-Romero, A. Perez, A. Capul, R. Montgomery, and A. O. Fuller
Herpes Simplex Virus Entry Mediator Associates in Infected Cells in a Complex with Viral Proteins gD and at Least gH
J. Virol., April 1, 2005; 79(7): 4540 - 4544.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. R. Frampton Jr., W. F. Goins, J. B. Cohen, J. von Einem, N. Osterrieder, D. J. O'Callaghan, and J. C. Glorioso
Equine Herpesvirus 1 Utilizes a Novel Herpesvirus Entry Receptor
J. Virol., March 1, 2005; 79(5): 3169 - 3173.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Parry, S. Bell, T. Minson, and H. Browne
Herpes simplex virus type 1 glycoprotein H binds to {alpha}v{beta}3 integrins
J. Gen. Virol., January 1, 2005; 86(1): 7 - 10.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. P. McShane and R. Longnecker
Cell-surface expression of a mutated Epstein-Barr virus glycoprotein B allows fusion independent of other viral proteins
PNAS, December 14, 2004; 101(50): 17474 - 17479.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Avitabile, G. Lombardi, T. Gianni, M. Capri, and G. Campadelli-Fiume
Coexpression of UL20p and gK Inhibits Cell-Cell Fusion Mediated by Herpes Simplex Virus Glycoproteins gD, gH-gL, and Wild-Type gB or an Endocytosis-Defective gB Mutant and Downmodulates Their Cell Surface Expression
J. Virol., August 1, 2004; 78(15): 8015 - 8025.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Tiwari, C. Clement, M. B. Duncan, J. Chen, J. Liu, and D. Shukla
A role for 3-O-sulfated heparan sulfate in cell fusion induced by herpes simplex virus type 1
J. Gen. Virol., April 1, 2004; 85(4): 805 - 809.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. J. Pasieka, L. Maresova, K. Shiraki, and C. Grose
Regulation of Varicella-Zoster Virus-Induced Cell-to-Cell Fusion by the Endocytosis-Competent Glycoproteins gH and gE
J. Virol., March 15, 2004; 78(6): 2884 - 2896.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
N. Cheshenko, B. Del Rosario, C. Woda, D. Marcellino, L. M. Satlin, and B. C. Herold
Herpes simplex virus triggers activation of calcium-signaling pathways
J. Cell Biol., October 27, 2003; 163(2): 283 - 293.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. G. Spear and R. Longnecker
Herpesvirus Entry: an Update
J. Virol., October 1, 2003; 77(19): 10179 - 10185.
[Full Text] [PDF]


Home page
J. Virol.Home page
M. Yoon, A. Zago, D. Shukla, and P. G. Spear
Mutations in the N Termini of Herpes Simplex Virus Type 1 and 2 gDs Alter Functional Interactions with the Entry/Fusion Receptors HVEM, Nectin-2, and 3-O-Sulfated Heparan Sulfate but Not with Nectin-1
J. Virol., September 1, 2003; 77(17): 9221 - 9231.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Krummenacher, I. Baribaud, R. J. Eisenberg, and G. H. Cohen
Cellular Localization of Nectin-1 and Glycoprotein D during Herpes Simplex Virus Infection
J. Virol., August 15, 2003; 77(16): 8985 - 8999.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. A. Connolly, D. J. Landsburg, A. Carfi, D. C. Wiley, G. H. Cohen, and R. J. Eisenberg
Structure-Based Mutagenesis of Herpes Simplex Virus Glycoprotein D Defines Three Critical Regions at the gD-HveA/HVEM Binding Interface
J. Virol., July 15, 2003; 77(14): 8127 - 8140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Santoro, H. L. Greenstone, A. Insinga, M. K. Liszewski, J. P. Atkinson, P. Lusso, and E. A. Berger
Interaction of Glycoprotein H of Human Herpesvirus 6 with the Cellular Receptor CD46
J. Biol. Chem., July 3, 2003; 278(28): 25964 - 25969.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. M. Cairns, R. S. B. Milne, M. Ponce-de-Leon, D. K. Tobin, G. H. Cohen, and R. J. Eisenberg
Structure-Function Analysis of Herpes Simplex Virus Type 1 gD and gH-gL: Clues from gDgH Chimeras
J. Virol., June 15, 2003; 77(12): 6731 - 6742.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. V. Nicola, A. M. McEvoy, and S. E. Straus
Roles for Endocytosis and Low pH in Herpes Simplex Virus Entry into HeLa and Chinese Hamster Ovary Cells
J. Virol., May 1, 2003; 77(9): 5324 - 5332.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Browne, B. Bruun, A. Whiteley, and T. Minson
Analysis of the role of the membrane-spanning and cytoplasmic tail domains of herpes simplex virus type 1 glycoprotein D in membrane fusion
J. Gen. Virol., May 1, 2003; 84(5): 1085 - 1089.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Harman, H. Browne, and T. Minson
The Transmembrane Domain and Cytoplasmic Tail of Herpes Simplex Virus Type 1 Glycoprotein H Play a Role in Membrane Fusion
J. Virol., November 1, 2002; 76(21): 10708 - 10716.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. A. Connolly, D. J. Landsburg, A. Carfi, D. C. Wiley, R. J. Eisenberg, and G. H. Cohen
Structure-Based Analysis of the Herpes Simplex Virus Glycoprotein D Binding Site Present on Herpesvirus Entry Mediator HveA (HVEM)
J. Virol., November 1, 2002; 76(21): 10894 - 10904.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Z. Fan, M. L. Grantham, M. S. Smith, E. S. Anderson, J. A. Cardelli, and M. I. Muggeridge
Truncation of Herpes Simplex Virus Type 2 Glycoprotein B Increases Its Cell Surface Expression and Activity in Cell-Cell Fusion, but These Properties Are Unrelated
J. Virol., September 15, 2002; 76(18): 9271 - 9283.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. E. Pertel
Human Herpesvirus 8 Glycoprotein B (gB), gH, and gL Can Mediate Cell Fusion
J. Virol., May 1, 2002; 76(9): 4390 - 4400.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Krummenacher, I. Baribaud, J. F. Sanzo, G. H. Cohen, and R. J. Eisenberg
Effects of Herpes Simplex Virus on Structure and Function of Nectin-1/HveC
J. Virol., March 1, 2002; 76(5): 2424 - 2433.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. L. Demmin, A. C. Clase, J. A. Randall, L. W. Enquist, and B. W. Banfield
Insertions in the gG Gene of Pseudorabies Virus Reduce Expression of the Upstream Us3 Protein and Inhibit Cell-to-Cell Spread of Virus Infection
J. Virol., November 15, 2001; 75(22): 10856 - 10869.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Browne, B. Bruun, and T. Minson
Plasma membrane requirements for cell fusion induced by herpes simplex virus type 1 glycoproteins gB, gD, gH and gL
J. Gen. Virol., June 1, 2001; 82(6): 1419 - 1422.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muggeridge, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muggeridge, M. I.
Agricola
Right arrow Articles by Muggeridge, M. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS