J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alagiozoglou, L.
Right arrow Articles by Morris, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alagiozoglou, L.
Right arrow Articles by Morris, L.
Agricola
Right arrow Articles by Alagiozoglou, L.
Right arrow Articles by Morris, L.
Journal of General Virology (2000), 81, 2029-2038.
© 2000 Society for General Microbiology


Animal: DNA Viruses

Phylogenetic analysis of human herpesvirus-8 in South Africa and identification of a novel subgroup

Lee Alagiozoglou1, Freddy Sitas2 and Lynn Morris1

AIDS Virus Research Unit, National Institute for Virology and Department of Virology, University of the Witwatersrand, Private Bag X4, Sandringham 2131, Johannesburg, South Africa1
Cancer Registry, South African Institute for Medical Research, Johannesburg, South Africa2

Author for correspondence: Lynn Morris. Fax +27 11 321 4234. e-mail lynnm{at}niv.ac.za


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The incidence of Kaposi’s sarcoma in South Africa is increasing in parallel with the human immunodeficiency virus type 1 epidemic. An 804 bp region in the ORF75 gene of 40 human herpesvirus-8 (HHV-8) isolates from South Africa was sequenced and the phylogenetic relationships were compared to published sequences. Nineteen strains clustered with subgroup B and 11 with subgroup A; however, the bootstrap values supporting these subgroups were not significant. Three strains grouped significantly with the C subgroup, while eight sequences did not cluster with any of the previously classified subgroups and were termed novel (N). The N subgroup differed from the A, B and C subgroups by DNA distances of 4·8, 4·2 and 4·5%, respectively, although within the N subgroup there was only 0·4% variation. The inclusion of this subgroup increased the number of previously described subgroup-specific polymorphisms from 17 to 47 over an 804 bp region. There was sufficient inter-subgroup genetic diversity for a single-strand conformational polymorphism assay to be used to identify them rapidly. Thus, based on analysis of the ORF75 gene, a unique HHV-8 subgroup, termed N, is present in South Africa, which accounts for 20% of circulating strains. Further studies are required to determine the degree of genetic divergence, distribution and pathogenic potential of this novel subgroup.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human herpesvirus-8 (HHV-8) has been implicated as the causative agent of Kaposi’s sarcoma (KS). Sero-epidemiological studies have shown a strong correlation between HHV-8 infection and the risk of developing KS, and HHV-8 DNA is found consistently in KS tissues (Chang et al., 1994Down ; Corbellino et al., 1996Down ; Martin et al., 1998Down ; Monini et al., 1996Down ; Moore et al., 1996bDown ; Smith et al., 1997Down ; Viviano et al., 1997Down ; Whitby et al., 1995Down ). Although the incidence of KS is decreasing in Europe and the USA (Hermans et al., 1996Down ; Katz et al., 1994Down ), it is increasing on a course parallel to human immunodeficiency virus type 1 (HIV-1) infection in sub-Saharan Africa. The continued expansion of the HIV-1 epidemic in South Africa, where approximately 3·4 million individuals are estimated to be infected, is likely to exacerbate this situation (South African Department of Health, 1999Down ).

KS is classified into four forms; classic (Mediterranean), endemic (African), iatrogenic (immunosuppressed) and AIDS-associated (epidemic) (Fife & Bower, 1996Down ; Martin et al., 1993Down ; Oettle, 1962Down ; Wahman et al., 1991Down ). All of these forms have been shown to be infectious (Wahman et al., 1991Down ). Classic KS is a sporadic tumour found in elderly Mediterranean or Eastern European men and presents as paranodular skin lesions. Endemic KS is common in equatorial Africa, predominantly in young males and prepubescent children, and is often associated with rapid disease progression. Iatrogenic KS occurs in solid-organ transplant recipients under immunosuppressive therapy. AIDS-associated KS occurs in HIV-positive individuals and is the most fulminant form of the disease, possibly as a result of co-infection with HIV (Wahman et al., 1991Down ). These different forms of KS are not histologically distinguishable, although genetic studies of HHV-8 sequences have revealed that there are nucleic acid differences associated with the different forms (Boralevi et al., 1998Down ). However, other studies have not confirmed this (Fouchard et al., 2000Down ).

The HHV-8 genome contains approximately 170 kb and shows little overall nucleotide variation (Decker et al., 1996Down ; Moore et al., 1996aDown ; Russo et al., 1996Down ). Recent studies have identified ORF75 as useful in delineating different strains, as this region shows 1·5–1·9% variation (Zong et al., 1997Down ). Analysis of this region has shown that subgroup A predominates in classic KS, subgroups B and C are found in Africa and all subgroups have been found in AIDS-related KS in the USA (Zong et al., 1997Down ). Whether these differences in the HHV-8 genome underpin differences in clinical presentation remains to be determined. Previous studies have shown the presence of HHV-8 in South Africa (Bourboulia et al., 1998Down ; Engelbrecht et al., 1997Down ; Sitas et al., 1997Down , 1999Down ; Wilkinson et al., 1999Down ). We therefore undertook an analysis of the phylogenetic relationships of HHV-8 in South Africa and found that, in addition to the previously identified A, B and C subgroups, a novel subgroup is circulating in this region.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} HHV-8 PCR-positive samples.
The 40 patients included in this study were selected from a larger group of 429 as those who were HHV-8 DNA-positive by PCR (L. Alagiozoglou, H. Bredell, H. Carrara, R. Pacella-Norman, D. J. Martin, F. Sitas and L. Morris, unpublished results). This included 25 individuals with clinically confirmed KS and 15 HIV-1-infected individuals with no visible signs of KS (Table 1Down). The majority of patients were black males (29/40) with a median age for the cohort of 40 years. Those with clinically confirmed KS have been given a ‘KS’ prefix. All patients were HIV-positive except for KS80ZA and KS82ZA. The 15 KS-negative but HHV-8 DNA-positive individuals were identified through screening of 334 HIV-infected individuals. Seven of these were migrant workers on the mines (LN, MEN and TS) and eight were private patients (PP) or attended outpatient AIDS clinics (RS and DS). Three of the samples were from lymph nodes (LN) and the rest were from blood. An LN and a blood sample were available from one patient (LN7ZA and PB7ZA), giving a total of 41 samples from the 40 patients.


View this table:
[in this window]
[in a new window]
 
Table 1. Demographic information for sequenced specimens

 
Peripheral blood mononuclear cells (PBMC) were isolated by discontinuous gradient centrifugation using Ficoll–Hypaque (Sigma) at 1500 r.p.m. for 30 min. The cells were lysed overnight at 56 °C in 50 µl lysis buffer (10 mM Tris–HCl, pH 8·3, 0·5% Triton X-100, 0·001% SDS) plus 3 µl 20 mg/ml proteinase K (Boehringer Mannheim). Proteinase K was denatured by heating at 95–100 °C for 15 min. Specimens were screened for HHV-8 DNA by nested PCR for 30 cycles in a total volume of 50 µl and products were run on a 1% agarose gel for detection. The primer pairs used to amplify the ORF75 gene were: first round, KS1000 (5' CGGTTCGGTGGCATACAGGC 3') and KS1034 (5' CTGACTACAGAGGGTGTCCCCG 3'), and second round, KS2000 and KS2034. The latter pair correspond to LGH2000 and LGH2034 of Zong et al. (1997)Down , which amplify an 804 bp product. This segment corresponds to genomic positions 133639–134442 as described by Russo et al. (1996)Down and the exact positions obtained from the published sequence (accession no. U75698). The following cycling conditions were used: 94 °C for 2 min (denaturation step) followed by 35 cycles of 94 °C for 1 min, 65 °C for 1 min and 72 °C for 1 min, with a final 5 min extension step at 72 °C. Supertherm Taq DNA polymerase was used in the first-round PCR. For the nested PCR, cycling conditions were identical to the first round except that Taq polymerase from Boehringer Mannheim was used and the extension temperature was reduced to 55 °C. The amplified nested product was detected on a 1% agarose gel. A sample from a KS patient who was previously PCR positive was used as a positive control and water was used as a negative control.

{blacksquare} Phylogenetic analysis.
The ORF75 PCR products were cloned into a TA vector (pMOSBlue T vector, Amersham, or a pGEM-T vector, Promega) and both the forward and reverse strands from one clone from each patient were sequenced. Sequencing was performed by the dideoxy chain-termination method using the Cy5 AutoRead sequencing kit (Pharmacia Biotech), the Thermo Sequenase fluorescent-labelled primer cycle sequencing kit (Amersham) or the dRhodamine cycle sequencing ready reaction kit (PE Applied Biosystems).

Sequences from the 41 samples were compared with 14 distinct A, B and C reference strains (Zong et al., 1997Down ). Alignment was performed by using CLUSTAL W (Thompson et al., 1994Down ). A matrix of genetic distances between subgroups was determined by performing pairwise comparisons between all the sequences using the DNADIST program from the PHYLIP phylogenetic inference package (Felsenstein, 1993Down ). Genetic relationships between HHV-8 strains were determined by constructing phylogenetic trees based on the neighbour-joining method of Saitou & Nei (1987)Down from CLUSTAL W. An unrooted tree was constructed in order to represent graphically the amount of genetic variability between the strains and subgroups. Kimura’s two-parameter model was used to generate pairwise distance matrices (Kimura, 1980Down ) and the CONSENSE program from PHYLIP was used to determine bootstrap values for each node. Analyses were performed on 100 consecutive replicates to calculate the probability that a group of strains would cluster together. Bootstrap values of >=70% correspond to a probability of >=95% and were considered significant (Hillis & Bull, 1993Down ). The 41 sequences have been deposited in GenBank (accession numbers AF243797AF243837).

{blacksquare} Single-strand conformational polymorphism (SSCP) analysis.
SSCP analysis was performed by using the 804 bp fragment amplified from the ORF75 region. From the PCR product, 5 µl was added to 45 µl formamide. The DNA was denatured by heating at 96 °C for 2 min. The entire reaction volume (50 µl) was loaded onto a 5% polyacrylamide gel and run at 200 V for 6 h in 1x TBE buffer. The specimens were run with samples of known subgroups, as determined by sequencing, for comparison.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Phylogenetic analysis of South African HHV-8 sequences reveals a novel subgroup
In order to determine the extent of genetic diversity among South African HHV-8 isolates, the ORF75 gene was sequenced and analysed phylogenetically relative to 14 strains from the A, B and C reference subgroups (Zong et al., 1997Down ). Nineteen of the South African specimens grouped with subgroup B, 11 with subgroup A and three with subgroup C. Eight sequences did not cluster with any previously identified subgroup and were termed novel (N) strains (Fig. 1Down). The placement of the South African isolates in the C and N subgroups was supported by high bootstrap values of 89 and 76%, indicating that they were significantly different and therefore they were considered as two separate subgroups. Similarly, a bootstrap value of 100% separated these isolates from the A and B strains. However, subgroups A and B, which included the reference strains, were not separated by high bootstrap values, indicating a low probability that they formed two discrete subgroups. Although there were suggestions of clusters within the A and B groups, none of the nodes within these clusters had bootstrap values greater than 70%. Thus, according to phylogenetic analysis, distinct A and B subgroups were not supported statistically and these isolates were therefore termed A/B strains.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic analysis of the 804 bp ORF75 region of 41 South African HHV-8 isolates. All specimens were collected within South Africa. The best tree determined from 100 replicates in a neighbour-joining algorithm was used in the construction of the phylogenetic tree. Bootstrap values >=70% are indicated, as they represent significant branching. Only subgroups C and N showed significant bootstrap values. The reference specimens are shown in bold type and boxed. N, Novel subgroup. PB7ZA and LN7ZA are matched PBMC and LN cells from the same individual.

 
There was no phylogenetic relatedness among HHV-8 strains from different regions within South Africa or from individuals known to have originated from other countries, including Zambia (PP163ZA), Malawi (DS895ZA) and Mozambique (TS652ZA). One patient (DS814ZA), a white homosexual man, harboured a strain that clustered significantly with subgroup C sequences from New York and showed one nucleotide difference from KSHV75, a US strain. However, this strain is probably also circulating locally, as isolates from two HIV-positive black females from Johannesburg (KS70ZA and KS91ZA) were also associated significantly with this group (Fig. 1Up). Comparison of the two samples from the same patient (LN7 and PB7) showed that they were closely related, with only three nucleotide differences, possibly indicating a low level of intra-patient genetic variation. The two HIV-negative specimens (KS80ZA and KS82ZA) did not show any unique groupings, but were similar to specimens from HIV-infected patients that were outliers of the A subgroup. The N subgroup appears to be unique to this region, as it has not previously been described. It is, however, relatively common, in that 20% (8/40) of isolates were shown to cluster within the N subgroup. Individuals infected with N strains showed no unique demographic, clinical or histological features.

Subgroup N shows significant inter-subgroup variation
In order to determine the degree of difference of the N subgroup from the A, B and C reference subgroups, the inter-subgroup nucleotide distance was calculated by using the distance matrix algorithm from PHYLIP (Table 2Down). All eight subgroup N strains were compared with subgroup A (n=7), B (n=3) and C (n=3) strains from Zong et al. (1997)Down . The N subgroup differed from the A, B and C strains by nucleic acid distances of 4·8, 4·2 and 4·5%, respectively (Table 2Down), indicating that it was equally different from each of the three reference subgroups. The intra-subgroup variation for each of the South African subgroups was also determined. While the A/B strains differed from each other by approximately 0·6%, an average intra-subgroup variation of 0·2% was observed for subgroup C and 0·4% for the N subgroup (not shown). Thus, while the N subgroup showed significant variation from the established subgroups, strains within the N subgroup showed limited variation relative to each other, similar to subgroups A, B and C.


View this table:
[in this window]
[in a new window]
 
Table 2. Inter-subgroup variation between the novel subgroup (N) and the A, B and C subgroups

 
Subgroup N is defined by 32 characteristic polymorphisms
Three subtypic categories of HHV-8 have been described previously by Zong and co-workers based on 17 characteristic mutations at distinct loci (Zong et al., 1997Down ). Five of these loci differentiated the A subgroup, one the B subgroup and 11 the C subgroup. We performed a similar analysis on the South African isolates to determine whether they contained these subgroup-specific polymorphisms (Table 3Down). Most of the South African A/B strains showed mutations characteristic for either subgroup A (nucleotide positions 563, 618, 867, 1000 and 1085) or subgroup B (nucleotide 633) and, therefore, on the basis of this analysis, would be classified as such. However, they also showed an additional four mutations (nucleotides 636, 995, 1034 and 1035) that were also shared by the reference A and B strains, supporting the phylogenetic data that indicated that the A and B subgroups show significant overlap (Fig. 1Up). KS76ZA was unusual in that it had three of the four mutations in common with A/B strains, but none of the other loci that identified the A or B subgroup. This strain showed a similar pattern to ST1, an isolate from a Ugandan AIDS patient, which was considered to be a recombinant strain (Zong et al., 1997Down ). Only five of the 11 characteristic mutations for the C subgroup were retained by the South African samples (nucleotides 977, 988, 1016, 1084 and 1278). Four of the C loci were lost, as they now identified the A/B strains (see above), and one was also shared by the N subgroup (nucleotide 1276). Position 1028 was lost, as only one of the three South African C samples had a G at this position. However, a larger sample number is needed to in order to assess fully the degree of divergence at these loci. An additional 33 key diagnostic loci were identified for the N subgroup, which were distinct and overlapped only one of the 17 previously identified loci (nucleotide 1034). The overlap at nucleotide position 1034 and the loss of positions 1028 and 1276 gives a total of 47 loci that defined the four subgroups. These subgroup-specific patterns are indicated as different colours in Table 3Down. Over an 804 bp region, this translates to an overall deviation of 5·9% (47/804) as opposed to 2·1% (17/804) calculated from the study by Zong et al. (1997)Down .


View this table:
[in this window]
[in a new window]
 
Table 3. Nucleic acid polymorphisms in the ORF75 gene

 
Subgroup N shows distinct amino acid polymorphisms
The phylogenetic relationships based on the predicted amino acid sequences showed a similar branching pattern to that of the nucleic acid sequences (not shown). To determine whether distinct amino acid mutations differentiated subgroups, similar to the nucleotide analysis, amino acid sequences were aligned and compared (Table 4Down). Seventeen subgroup-specific amino acid polymorphisms were found; two were characteristic for the A subgroup (amino acids 87 and 115), one for the B subgroup (amino acid 91), three for the C subgroup (amino acids 87, 104 and 119) and 12 for the N subgroup (amino acids 27, 66, 93, 102, 103, 104, 105, 168, 169, 174, 192 and 233). All subgroup N and C strains had the designated mutations, whereas not all A and B subgroup strains shared these loci. Three loci were shared by both A and B subgroups (A/B strains) (amino acids 23, 103 and 104). KS76ZA shared these loci but did not have any other subgroup-specific mutations, similar to the results of the nucleic acid analysis. Although amino acid mutations were less able to define subgroups compared with nucleic acid data, this analysis clearly delineated the N subgroup due to its highly polymorphic nature.


View this table:
[in this window]
[in a new window]
 
Table 4. Amino acid polymorphisms associated with ORF75

 
SSCP can be used to identify the novel subgroup
An SSCP assay was evaluated as a rapid method of identifying the N subgroup. SSCP was performed on the 804 bp amplified fragments generated from the ORF75 gene of some of the 41 South African specimens. For convenience, these were labelled based on their similarities to A and B reference strains (four strains from subgroup A, five from B, two from C and five from N). The migration of single-stranded DNA specimens from the A, B or C subgroups did not allow them to be distinguished from one another (Fig. 2Down). Some of the A and B strains showed similar migration patterns, confirming their high degree of genetic overlap, while all C subgroup strains showed different patterns. An electrophoretic shift was visible for all five N specimens and, although this was not identical for all samples, it allowed them to be differentiated easily from the A, B and C subgroups.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. SSCP analysis of 16 South African HHV-8 subgroups. The A, B and C subgroups show no distinct migration pattern. The slower migration patterns of the novel (N) DNA fragments distinguish this subgroup from the others.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Phylogenetic analysis of the ORF75 gene of HHV-8 revealed that subgroups A/B and C and a novel subgroup (N) are present in South Africa. The A/B subgroup strains were the most common, as they were found in 29 of the 40 individuals, followed by the N subgroup (n=8) and the C subgroup (n=3). The significance of these findings as yet remains unclear, as there are no apparent differences in the clinical presentation or demographic features of individuals infected with strains of different subgroups. There were no genetic differences between HHV-8 from individuals who had asymptomatic infection and those who had clinically confirmed KS. Three isolates from individuals originating from neighbouring countries did not show any difference from the South African strains, although it is not known where these individuals acquired their HHV-8 infection. Thus, while KS has only recently gained prominence in South Africa as a result of the HIV-1 epidemic, the high level of genetic heterogeneity of HHV-8 suggests that this virus may have been circulating in this region for a long time.

Subgroup determination based on polymorphic differences in the ORF75 and UPS75 gene regions has identified three genetic subgroups, A, B and C (Zong et al., 1997Down ). According to the geographical location from which the samples were obtained, it was suggested that the A subgroup predominates in regions associated with classical KS, whereas the B and C subgroups prevail in Africa, although these associations are often tenuous (Cook et al., 1999Down ; Zong et al., 1997Down ). All subgroups have been found in the USA, and the limited variation between them has led to the suggestion that they originated from a common isolate (Zong et al., 1997Down ). More recent data for the highly variable ORFK1 region have indicated the complexity of HHV-8 genetic types and the presence of chimeric or recombinant viruses (Poole et al., 1999Down ). Isolates EKS1, C282, ST1 and AKS1/2, which were originally classified as subgroup A, were reclassified as A/C following analysis of the K1 region. Subgroup C genomes were shown to be divergent upstream of the UPS75 region in ORFK15. Two diverged alleles were identified at this site: the minor form, which includes the prototype C strains ASM72 and HBL6 (Poole et al., 1999Down ) shown in Fig. 1Up, and the predominant form. Since this study focuses on the ORF75 region and not ORFK1 or ORFK15, we have continued to use the original subgroup designations of A, B and C (Zong et al., 1997Down ).

South African subgroups were determined by sequencing single clones from 41 HHV-8 DNA samples, which were analysed in the ORF75 gene region. The extent of genetic variation within a single patient or as a result of clone bias was not examined, but such variation would probably be minor and would not influence the overall groupings. Comparison of the two samples available from one patient (LN7 and PB7) supports this notion. Based on the 17 characteristic loci in the ORF75 gene, subgroups A, B and C were all found to occur in South Africa, although subgroup C was found only rarely (3/40, 8%). In addition, a fourth, newly defined, novel (N) subgroup was identified. The N subgroup was defined by 33 mutations, 32 of which were newly described. Of the original 17 loci, 15 were retained, giving a total of 47 key diagnostic polymorphisms within the 804 bp region that defined the four subgroups in South Africa.

A similar analysis carried out across the 267 predicted amino acids of the ORF75 gene product recorded 17 polymorphisms that were characteristic for the four subgroups. The majority of mutations delineated the N subgroup (n=12), with only one to three point mutations descriptive for the other three subgroups. Subgroup designation based on polymorphisms is therefore limited when using amino acids, compared with nucleic acids. In general, both methods can be used for subtyping as well as delineating strains containing mutations overlapping with A and B subgroups, as well as identifying new strains of HHV-8.

Based on the analysis of specific polymorphisms, it may be concluded that distinct A and B subgroups exist in South Africa. However, this analysis is based on only 6% (47/804 nucleotides) of the ORF75 gene. More detailed and statistically accurate analysis of this region based on phylogenetic relationships has shown that the A and B subgroups were not supported by strong bootstrap values and hence were termed A/B strains. Closer analysis of the polymorphic changes revealed that the A/B strains shared four specific loci. These loci were previously specific for subgroup C (Zong et al., 1997Down ), and were subsequently lost with the addition of the N subgroup. Thus, while A and B strains show a subgroup-specific pattern, they also share common mutations that prevent their segregation as distinct subgroups on a phylogenetic tree. The A and B subgroups are also less distinct in other regions of the genome lying just outside of ORF75, where only one nucleotide difference was found between the A and B subgroups (Zong et al., 1997Down ). Other researchers have also experienced difficulties in identifying distinct A and B subgroups in UPS75 using the prototype A, B and C sequences (Fouchard et al., 2000Down ). It is interesting that these researchers were using a Zambian strain of HHV-8. Studies done with HHV-8 from Central Africa, Senegal, Cameroon and French Guyana did in fact identify subgroup A and C strains but no isolates from subgroup B. This study examined a smaller fragment (473 bp) in the ORF75 region, which may have allowed for a definitive subgroup analysis of A and C in the absence of B (Fouchard et al., 2000Down ).

Since the A and B strains are closely related, it is possible that one of these strains may represent the progenitor or that one of these subgroups may have been the original isolate.

The C and N subgroups remain distinct clusters supported by strong bootstrap values and characteristic loci. Within the N subgroup, there was limited variation between the eight sequences analysed (intra-subgroup variation). However, when compared with sequences from other subgroups (inter-subgroup variation), there was a high level of genetic diversity (4·2–4·8%). Previous analysis of a larger region within ORF75 (UPS75) using subgroups A, B and C showed only 1·5% variation (Zong et al., 1997Down ). Thus, the addition of the N subgroup has revealed that the ORF75 gene is more divergent than was first realized. Studies in other parts of Africa on both the ORF75 and the K1 regions have not revealed the presence of the N subgroup (Fouchard et al., 2000Down ; Kasolo et al., 1998Down ). Ongoing studies in other gene regions of subgroup N, including ORF26 and T0.7/K12, have revealed that it contains sequences that do not align with previously defined subgroups (G. Hayward, personal communication), suggesting further that the N subgroup is novel. New HHV-8 subgroups are continually being identified, including subgroup D in the South Pacific (Poole et al., 1999Down ) and samples from Zambian children with febrile illness, which differ significantly from published subgroups (Kasolo et al., 1998Down ), but the relationship of these new subgroups to N is unknown. It has been hypothesized that HHV-8 is an ancient virus that branched out into its various subgroups over 100000 years ago (Hayward, 1999Down ). Thus, the N subgroup may represent a vestige of modern-day HHV-8 subgroups that may have been present for a long period, only coming to the fore as a result of the HIV epidemic. Alternatively, it could be a new subgroup that has evolved due to continuous reactivation of HHV-8 in AIDS-infected individuals, especially in developing countries, where HIV antiviral therapy is not used. More studies on this newly identified HHV-8 subgroup need to be done in order to determine its distribution, transmission, genetic diversity and pathogenic potential.


   Acknowledgments
 
We wish to thank Henry Carrara, Rosanna Pacella-Norman, Helba Bredell, Eli Silber, Dave Spencer, Ruben Sher and Pam Sonnenberg for their contribution of clinical specimens and Carolyn Williamson and Gary Hayward for critical reading of the manuscript. This work was funded by the Poliomyelitis Research Foundation and the Medical Research Council of South Africa.


   Footnotes
 
The GenBank accession numbers of the HHV-8 ORF75 sequences reported in this paper are AF243797AF243837.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Boralevi, F., Masquelier, B., Denayrolles, M., Dupon, M., Pellegrin, J. L., Ragnaud, J. M. & Fleury, H. J. (1998). Study of human herpesvirus 8 (HHV-8) variants from Kaposi’s sarcoma in France: is HHV-8 subtype A responsible for more aggressive tumors?Journal of Infectious Diseases178, 1546-1547.[Medline]

Bourboulia, D., Whitby, D., Boshoff, C., Newton, R., Beral, V., Carrara, H., Lane, A. & Sitas, F. (1998). Serologic evidence for mother-to-child transmission of Kaposi’s sarcoma-associated herpesvirus infection.JAMA280, 31-32.[Free Full Text]

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma.Science266, 1865-1869.[Abstract/Free Full Text]

Cook, P. M., Whitby, D., Calabro, M.-L., Luppi, M., Kakoola, D. N., Hjalgrim, H., Ariyoshi, K., Ensoli, B., Davison, A. J. & Schulz, T. F. (1999). Variability and evolution of Kaposi’s sarcoma-associated herpesvirus in Europe and Africa. International Collaborative Group.AIDS13, 1165-1176.[Medline]

Corbellino, M., Poirel, L., Bestetti, G., Pizzuto, M., Aubin, J. T., Capra, M., Bifulco, C., Berti, E., Agut, H., Rizzardini, G., Galli, M. & Parravicini, C. (1996). Restricted tissue distribution of extralesional Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS patients with Kaposi’s sarcoma.AIDS Research and Human Retroviruses 12, 651-657.[Medline]

Decker, L. L., Shankar, P., Khan, G., Freeman, R. B., Dezube, B. J., Lieberman, J. & Thorley-Lawson, D. A. (1996). The Kaposi sarcoma-associated herpesvirus (KSHV) is present as an intact latent genome in KS tissue but replicates in the peripheral blood mononuclear cells of KS patients.Journal of Experimental Medicine184, 283-288.[Abstract/Free Full Text]

Engelbrecht, S., Treurnicht, F. K., Schneider, J. W., Jordaan, H. F., Steytler, J. G., Wranz, P. A. & van Rensburg, E. J. (1997). Detection of human herpes virus 8 DNA and sequence polymorphism in classical, epidemic, and iatrogenic Kaposi’s sarcoma in South Africa.Journal of Medical Virology52, 168-172.[Medline]

Felsenstein, J. (1993). PHYLIP (Phylogeny Inference Package), version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle, WA, USA.

Fife, K. & Bower, M. (1996). Recent insights into the pathogenesis of Kaposi’s sarcoma.British Journal of Cancer73, 1317-1322.[Medline]

Fouchard, N., Lacoste, V., Couppie, P., Develoux, M., Mauclere, P., Michel, P., Herve, V., Pradinaud, R., Bestetti, G., Huerre, M., Tekaia, F., de The, G. & Gessain, A. (2000). Detection and genetic polymorphism of human herpes virus type 8 in endemic or epidemic Kaposi’s sarcoma from West and Central Africa, and South America.International Journal of Cancer85, 166-170.

Hayward, G. S. (1999). KSHV strains: the origins and global spread of the virus.Seminars in Cancer Biology9, 187-199.[Medline]

Hermans, P., Lundgren, J., Sommereijns, B., Pedersen, C., Vella, S., Katlama, C., Luthy, R., Pinching, A. J., Gerstoft, J., Pehrson, P. & Clumeck, N. (1996). Epidemiology of AIDS-related Kaposi’s sarcoma in Europe over 10 years. AIDS in Europe Study Group.AIDS10, 911-917.[Medline]

Hillis, D. M. & Bull, J. J. (1993). An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis.Systematic Biology42, 182-192.

Kasolo, F. C., Monze, M., Obel, N., Anderson, R. A., French, C. & Gompels, U. A. (1998). Sequence analyses of human herpesvirus-8 strains from both African human immunodeficiency virus-negative and -positive childhood endemic Kaposi’s sarcoma show a close relationship with strains identified in febrile children and high variation in the K1 glycoprotein.Journal of General Virology79, 3055-3065.[Abstract]

Katz, M. H., Hessol, N. A., Buchbinder, S. P., Hirozawa, A., O’Malley, P. & Holmberg, S. D. (1994). Temporal trends of opportunistic infections and malignancies in homosexual men with AIDS.Journal of Infectious Diseases170, 198-202.[Medline]

Kimura, M. (1980). A simple model for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.Journal of Molecular Evolution16, 111-120.[Medline]

Martin, R. W.III, Hood, A. F. & Farmer, E. R. (1993). Kaposi’s sarcoma.Medicine72, 245-261.[Medline]

Martin, J. N., Ganem, D. E., Osmond, D. H., Page-Shafer, K. A., Macrae, D. & Kedes, D. H. (1998). Sexual transmission and the natural history of human herpesvirus 8 infection.New England Journal of Medicine338, 948-954.[Abstract/Free Full Text]

Monini, P., de Lellis, L., Fabris, M., Rigolin, P. & Cassai, E. (1996). Kaposi’s sarcoma-associated herpesvirus DNA sequences in prostate tissue and human semen.New England Journal of Medicine334, 1168-1172.[Abstract/Free Full Text]

Moore, P. S., Gao, S. J., Dominguez, G., Cesarman, E., Lungu, O., Knowles, D. M., Garber, R., Pellett, P. E., McGeoch, D. J. & Chang, Y. (1996a). Primary characterization of a herpesvirus agent associated with Kaposi’s sarcomae.Journal of Virology70, 549-558.[Abstract]

Moore, P. S., Kingsley, L. A., Holmberg, S. D., Spira, T., Gupta, P., Hoover, D. R., Parry, J. P., Conley, L. J., Jaffe, H. W. & Chang, Y. (1996b). Kaposi’s sarcoma-associated herpesvirus infection prior to onset of Kaposi’s sarcoma.AIDS10, 175-180.[Medline]

Oettle, A. G. (1962). Geographical and racial differences in the frequency of Kaposi’s sarcoma as evidence of environmental or genetic cause.Acta Unio Internationalis Contra Cancrum 18, 330-363.

Poole, L. J., Zong, J. C., Ciufo, D. M., Alcendor, D. J., Cannon, J. S., Ambinder, R., Orenstein, J. M., Reitz, M. S. & Hayward, G. S. (1999). Comparison of genetic variability at multiple loci across the genomes of the major subtypes of Kaposi’s sarcoma-associated herpesvirus reveals evidence for recombination and for two distinct types of open reading frame K15 alleles at the right-hand end.Journal of Virology73, 6646-6660.[Abstract/Free Full Text]

Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y. & Moore, P. S. (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).Proceedings of the National Academy of Sciences, USA93, 14862-14867.[Abstract/Free Full Text]

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees.Molecular Biology and Evolution4, 406-425.[Abstract]

Sitas, F., Taylor, L., Madhoo, J., Cooper, K., Carrara, H., Boshoff, C. & Weiss, R. A. (1997). Occurrence of human herpes virus 8 in Kaposi’s sarcoma and other tumours in South Africa. South African Medical Journal 87, 1020, 1022.

Sitas, F., Carrara, H., Beral, V., Newton, B., Reeves, G., Bull, D., Jentsch, U., Pacella-Norman, R., Bourboulia, D., Whitby, D., Boshoff, C. & Weiss, R. (1999). Antibodies against human herpesvirus 8 in black South African patients with cancer.New England Journal of Medicine340, 1863-1871.[Abstract/Free Full Text]

Smith, M. S., Bloomer, C., Horvat, R., Goldstein, E., Casparian, J. M. & Chandran, B. (1997). Detection of human herpesvirus 8 DNA in Kaposi’s sarcoma lesions and peripheral blood of human immunodeficiency virus-positive patients and correlation with serologic measurements.Journal of Infectious Diseases176, 84-93.[Medline]

South African Department of Health (1999). Ninth Annual National HIV Sero-prevalence Survey of Women Attending Public Antenatal Clinics in South Africa. Health Systems Research and Epidemiology.

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Research22, 4673-4680.[Abstract/Free Full Text]

Viviano, E., Vitale, F., Ajello, F., Perna, A. M., Villafrate, M. R., Bonura, F., Arico, M., Mazzola, G. & Romano, N. (1997). Human herpesvirus type 8 DNA sequences in biological samples of HIV-positive and negative individuals in Sicily.AIDS11, 607-612.[Medline]

Wahman, A., Melnick, S. L., Rhame, F. S. & Potter, J. D. (1991). The epidemiology of classic, African, and immunosuppressed Kaposi’s sarcoma.Epidemiologic Reviews13, 178-199.[Free Full Text]

Whitby, D., Howard, M. R., Tenant-Flowers, M., Brink, N. S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F. E., Aldam, D. M., Denton, A. S., Miller, R. F., Weller, I. V. D., Weiss, R. A. & Schulz, T. F. (1995). Detection of Kaposi sarcoma-associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi’s sarcoma.Lancet346, 799-802.[Medline]

Wilkinson, D., Sheldon, J., Gilks, C. F. & Schulz, T. F. (1999). Prevalence of infection with human herpesvirus 8/Kaposi’s sarcoma herpesvirus in rural South Africa.South African Medical Journal89, 554-557.

Zong, J. C., Metroka, C., Reitz, M. S., Nicholas, J. & Hayward, G. S. (1997). Strain variability among Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genomes: evidence that a large cohort of United States AIDS patients may have been infected by a single common isolate.Journal of Virology71, 2505-2511.[Abstract]

Received 14 January 2000; accepted 12 April 2000.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
L. Wang, M. M. Brinkmann, M. Pietrek, M. Ottinger, O. Dittrich-Breiholz, M. Kracht, and T. F. Schulz
Functional characterization of the M-type K15-encoded membrane protein of Kaposi's sarcoma-associated herpesvirus
J. Gen. Virol., June 1, 2007; 88(6): 1698 - 1707.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. Whitby, V. A. Marshall, R. K. Bagni, C. D. Wang, C. J. Gamache, J. R. Guzman, M. Kron, P. Ebbesen, and R. J. Biggar
Genotypic characterization of Kaposi's sarcoma-associated herpesvirus in asymptomatic infected subjects from isolated populations
J. Gen. Virol., January 1, 2004; 85(1): 155 - 163.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
L. A. Dourmishev, A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac
Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis
Microbiol. Mol. Biol. Rev., June 1, 2003; 67(2): 175 - 212.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. N. Kakoola, J. Sheldon, N. Byabazaire, R. J. Bowden, E. Katongole-Mbidde, T. F. Schulz, and A. J. Davison
Recombination in human herpesvirus-8 strains from Uganda and evolution of the K15 gene
J. Gen. Virol., October 1, 2001; 82(10): 2393 - 2404.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alagiozoglou, L.
Right arrow Articles by Morris, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alagiozoglou, L.
Right arrow Articles by Morris, L.
Agricola
Right arrow Articles by Alagiozoglou, L.
Right arrow Articles by Morris, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS