|
|
||||||||
Animal: DNA Viruses |
Departments of Pediatrics and Microbiology, The University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900, USA1
National Cancer Institute, Bethesda, Maryland, USA2
Author for correspondence: Shou-Jiang Gao. Fax +1 210 567 6305. e-mail gaos{at}uthscsa.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Similar to other herpesviruses, KSHV establishes latent infection in the host (Gao et al., 1996a
, b
). KSHV latent nuclear antigen (LNA) encoded by the ORF73 gene is the most immunodominant major latent antigen and the target for several serological assays (Gao et al., 1996b
; Kedes et al., 1996
). In KS lesions, LNA is expressed in >90% of spindle cells, the hallmark of KS, but not in normal vascular endothelium (Dupin et al., 1999
; Rainbow et al., 1997
). LNA tethers the KSHV genomic DNA to host chromosomes in KSHV-infected cells (Ballestas et al., 1999
; Cotter & Robertson, 1999
; Szekely et al., 1999
), and inhibits p53 to prevent KSHV-infected cells from cell death (Friborg et al., 1999
). Thus, similar to EpsteinBarr virus (EBV) latent proteins, particularly EBV nuclear antigen 1 (EBNA 1), KSHV LNA has important roles in virus latent infection. EBNA 1 has genetic variations in the internal repeat domain (IRD) that affect the episomal stability and virus latent infection of EBV (Lee et al., 1999
). We have also identified molecular polymorphism in LNA (Gao et al., 1999
). The sequence variations of ORF73 IRD were found to correlate with the molecular mass polymorphism of LNA. The IRD of ORF73 is stable in KSHV-infected cell lines after long-term culture and in KSHV-infected subjects (Gao et al., 1999
). It is plausible to postulate that LNA genetic variations also affect KSHV episomal stability and latent infection. Identification of genetic variations of LNA and their molecular basis will help to elucidate the biological functions of LNA in KSHV latent infection.
Serological studies have demonstrated that the epidemiology of KSHV mimics that of KS: it is transmissible through male homosexual contact (Dukers et al., 2000
; Grulich et al., 1999
; Kedes et al., 1996
; Martin et al., 1998
; Melbye et al., 1998
; Simpson et al., 1996
; Smith et al., 1999
) and iatrogenic organ transplantation (Alkan et al., 1997
; Nocera et al., 1998
; Parravicini et al., 1997
; Regamey et al., 1998
, 1999
). In Africa, young children have a high prevalence of KSHV infection, indicating that other transmission routes are also present (Mayama et al., 1998
; Olsen et al., 1998
; Rezza et al., 1998
). Despite these serological studies, direct evidence of KSHV transmission has not been demonstrated. Detailed studies to analyse the mode of KSHV transmission and the risk factors are needed but have been impeded by the unavailability of a precise genotyping method that is capable of monitoring the transmission of individual KSHV isolates. Genetic variations have been found among KSHV isolates. Four subtypes (A, B, C and SA) were classified based on the point mutations within ORF26, which encodes a minor capsid protein (Foreman et al., 1998
; Zong et al., 1997
, 1999
). Recently, four subtypes (AD) were classified based on the highly variable gene ORFK1, which has amino acid substitutions up to 29% (Cook et al., 1999
; Kasolo et al., 1998
; Meng et al., 1999
; Poole et al., 1999
; Zong et al., 1999
). Two distinct types of ORFK15 alleles at the right-hand end of the KSHV genome could be distinctly defined (Choi et al., 2000
; Poole et al., 1999
). Nonetheless, the current KSHV genotyping techniques require DNA sequencing, which is time-consuming and not sensitive enough for the identification of individual virus isolates, and thus is not suitable for virus transmission studies. A KSHV genotyping method called KSHV nuclear antigen typing (KVNAtyping) was developed based on the molecular polymorphism of ORF73 (Gao et al., 1999
), which is useful for most epidemiological studies. However, it cannot differentiate certain KSHV isolates if they have similar LNA sizes, or provide sufficient information on the molecular basis of LNA genetic variations and the association of these variations with disease phenotypes.
In this report, we have examined the genetic variations of ORF73 and identified hot-spot variations in the IRD of ORF73. A KSHV genotyping technique, PCRrestriction fragment length polymorphism (RFLP), was also developed and used to identify individual KSHV isolates as well as their genetic variations in the ORF73 gene.
| Methods |
|---|
|
|
|---|
KSHV DNA source: KS lesions and cell lines.
PCRRFLP.
PCR was performed as previously described with minor modifications (Gao et al., 1999
). The IRD of ORF73 was amplified with PCR primers: LNAIIF, 5' ATGGGGACAACGAGATTAGC 3'; and LNAIIR, 5' CGACCCGTGCAAGATTATG 3'. Each PCR reaction was carried out in a 25 µl final volume containing 100 ng genomic DNA, 1 unit platinum Taq DNA polymerase (GIBCO BRL), 100 µM of each dNTP, 50 pM of each primer, 1·5 mM magnesium chloride, 50 mM potassium chloride, 20 mM TrisHCl (pH 8·4) and 1x PCRx enhancer solution (GIBCO BRL). PCR amplification was carried out for 35 cycles at 94 °C for 5 min, 94 °C for 30 s, 58 °C for 30 s and 68 °C for 2 min, and 1 cycle at 68 °C for 5 min. For RFLP, the PCR products were digested with BanII and MboI restriction enzymes for 2 h at 37 °C before gel analysis. Deionized water and DNA from P3HR-1 were used as negative controls for the PCR amplification. DNA bands were observed under UV illumination after ethidium bromide staining. The gel image was documented with Multi-Analyst software (version 1.1) on a Fluor-S MultiImager gel documentation system (Bio-Rad Laboratories).
DNA sequencing.
The ORF73 IRD as well as its N- and C-terminal fragments from a KSHV-infected PK-1 cell line were amplified as described previously (Gao et al., 1999
). The expected band separated in agarose gel electrophoresis was purified by QIAquick gel extraction (Qiagen) and sequenced on an ABI 377 analyser (Applied Bio-systems). The DNA sequences were assembled and analysed with the DNASTAR program.
A segment of KS330 from KSHV-infected cell lines and KS lesions was also PCR-amplified and sequenced as previously reported (Chang et al., 1994
). The KSHV subtypes were assigned as previously reported (Poole et al., 1999
; Zong et al., 1997
).
| Results |
|---|
|
|
|---|
|
Alignment of PK-1 ORF73 sequences with those from BC-1 and two KS lesions obtained through the GenBank database revealed high sequence variations in the IRD. Compared with ORF73 of BC-1 KSHV, the ORF73 from the two KS lesions (GK18 and KS-F) (Glenn et al., 1999
; Zhong et al., 1996
) have 105 bp and 222 bp deletions, six and three bp insertions, and 150 and 158 point mutations, respectively (Fig. 1
). The deletions are mainly located in two spots of repeat region 2, the left and right side of this region. Most of the point mutations are also scattered in repeat region 2, and the rest are in regions 1 and 3. Our sequencing data of PK-1 ORF73 showed that 516 of 558 bp deletions are located in repeat region 2, 30 bp deletions in repeat region 1 and 12 bp deletions in region 3 (Fig. 1
). These sequence variations account for the molecular polymorphism of ORF73. Repeat region 2 appears to be the hot-spot for sequence variations of ORF73.
In spite of large sequence deletions in the ORF73 IRD, no frame-shift was observed with each deletion region or the entire ORF73 gene for all the four KSHV isolates examined.
PCRRFLP genotyping
Sequencing the IRD PCR products is extremely difficult to accomplish due to the high A+G content (75%) and the repetitive sequences. It is therefore not practical to identify the genetic variations in IRD in large numbers of clinical specimens by DNA sequencing. The sequence variations in the ORF73 IRD could be detected by RFLP, which is capable of distinguishing individual KSHV isolates. The size of restriction products will also reflect the location of deletions. We searched the restriction map of the IRD of ORF73 from BC-1 KSHV and found that 64 enzymes had between 1 and 10 cutting sites. Two-thirds of the enzymes would give reasonable fragments visible in agarose gel analysis. After considering the cost and the cutting sites, BanII and MboI enzymes were selected for RFLP analysis of the ORF73 IRD. BanII restriction sites are located in the left half of repeat region 2 and a MboI site is at the start of repeat region 3 in the IRD. Thus, one of the restriction fragments represents repeat region 2, the hot-spot for sequence variations. There are five BanII restriction sites in the PCR-amplified IRD of ORF73 from BC-1 KSHV (Fig. 2
). However, after BanII digestion, only three bands (1131, 457 and 192 bp) were expected to be visible, while the other three small fragments (57, 42 and 19 bp) could not be differentiated from PCR primer dimers in regular agarose gel analysis. There is only one MboI restriction site in the IRD of BC-1 ORF73 (Fig. 2
) and two bands (1403 and 495 bp) are expected after digestion with this single enzyme. There is only one BanII restriction site and no MboI sites in the IRD of PK-1 ORF73 based on its sequence.
|
|
|
|
Invariable PCRRFLP pattern in multifocal KS lesions from the same patient
We have previously demonstrated that there is a single KVNAtype in multifocal KS lesions from individual patients (Gao et al., 1999
). We further determined whether multifocal lesions from individual patients are due to KSHV infection with multiple KSHV genotypes or isolates. Multifocal KS lesions from three patients were subjected to PCRRFLP analysis. A unique RFLP pattern was obtained for all the lesions from individual patients, three bands for patients A1 and A3, and two bands for patient A2 (Fig. 5
), suggesting the presence of a single KSHV genotype in KS development in individual patients.
|
| Discussion |
|---|
|
|
|---|
The genetic variations of ORF73 focus on certain hot-spots in the IRD. Most of the sequence deletions and point mutations were found in repeat region 2, the glutamine-rich region. The hot-spot variations are located on the left and right side of repeat region 2 among all four KSHV isolates examined. The deletions reduce the number of perfect tandem repeats in region 2. Among the six KSHV-infected cell lines examined, PK-1 KSHV has the largest deletion, 30·2% of the IRD size. It was surprising to find that the sequence deletions in the IRD of ORF73 did not cause a frame-shift in all the deletion regions and the entire ORF73 gene in all four KSHV isolates analysed, as sequence deletions generally cause coding frame-shift resulting in altered protein structure, function and antigenicity. This result indicates that the in-frame coding of polymorphic LNA maintained in KSHV infection is possibly controlled by functional selection. It would be interesting to determine whether the LNA genetic variations correlate with phenotype expression, such as the types of disease and disease development.
The hot-spot variations were further confirmed in KS lesions by genotyping with PCRRFLP. Sequence variations cause a change in restriction sites in the IRD. We selected two restriction enzymes that can digest the amplified region into reasonable fragments. From the resulting RFLP pattern, one could identify the location of sequence deletion and/or insertion in the IRD, as we have demonstrated for PK-1 KSHV. Compared with BC-1 KSHV, the RFLP pattern of IRD from PK-1 KSHV had two bands, 897 and 463 bp in size, but did not have the 192 and 655 bp bands. Sequence deletion in repeat region 2 was the reason for the absence of one band at 192 bp in the PK-1 lane. The RFLP profile was consistent with the DNA sequencing result. Based on the ORF73 sequences available, the double enzyme digestion cannot yield fragments over 655 bp in size if a KSHV isolate has a smaller IRD than that of BC-1 KSHV and has restriction sites for both the enzymes. Otherwise, the absence of restriction sites is responsible for a larger band size. Isolates from all the KS lesions examined in Fig. 4
had smaller IRDs, except KS-9, and bands larger than 655 bp in RFLP analysis, except KS-5 and KS-9. Thus, only KSHV from KS-5 and KS-9 in Fig. 4
had both BanII and MboI restriction sites in the IRD of ORF73. The total size added from the three bands in KSHV from KS-9 was smaller than the undigested fragment size (Fig. 4
), suggesting that two fragments were overlapped in one of the bands. A similar situation was also seen in lanes 9, 10 and 11 in Fig. 5
. The second band in lane 9 of Fig. 5
is weak, though it was visible in an ethidium bromide-stained gel. Southern blot hybridization can potentially enhance the sensitivity of the assay as demonstrated previously (Gao et al., 1999
).
In serological assays, LNA is identified as the major immunodominant latent antigen. It has been found that some samples negative in LNA serological assays were positive in lytic antigen serological assays (Schalling et al., 1995
; Simpson et al., 1996
; S.-J. Gao, unpublished observation). This could be due to epitope variations in the IRD. However, further studies in this regard are warranted.
LNA plays important roles in maintaining KSHV episomal stability in latent infection (Ballestas et al., 1999
; Cotter & Robertson, 1999
; Szekely et al., 1999
) and inhibits p53 to protect KSHV-infected cells from cell death (Friborg et al., 1999
). Expression of LNA in most spindle cells of KS lesions also correlates with the function of LNA in latent infections (Dupin et al., 1999
; Rainbow et al., 1997
). Similar to EBV latent antigens, genetic variations in the LNA gene might correlate with KSHV-related pathogenesis. Thus, identification of the genetic variations in LNA is of great importance for understanding KSHV pathogenesis. Because of its important biological function and genetic variations, ORF73 is also a good target for KSHV genotyping.
We classified the KSHV isolates examined in this study into four subtypes based on the RFLP patterns and DNA sequences of the IRD of ORF73 in KSHV isolates with known sequences. Each subtype had a different RFLP pattern, resulting from different sequence variations in the IRD. Through the PCRRFLP analysis, KSHV isolates could potentially be differentiated in epidemiological studies, for example to track person-to-person transmission. Previous studies have classified KSHV genomes into four subtypes based on DNA sequencing of ORF26 or ORFK1 (Caterino-de-Araujo, 1998
; Cook et al., 1999
; Diaz-Cano & Wolfe, 1997
; Foreman et al., 1998
; Luppi et al., 1997
; Meng et al., 1999
; Zong et al., 1997
, 1999
). There is no apparent correlation between our genotypes and these four KSHV subtypes, which were all based on the genetic variations of lytic genes. Our PCRRFLP assay is based on genetic variation of the KSHV latent gene, which might have a different mechanism of genetic variation from that of lytic genes because of different selection pressure encountered during latent and lytic virus infection. Thus it is to be expected that correlation between our genotypes and the KSHV subtype described previously would be low.
Our results show that there is a large repertoire of KSHV genotypes in the KSHV-infected population. Genotyping with PCRRFLP on LNA is meaningful due to the important roles of LNA in KSHV latent infection. This method is easy to perform and can distinguish individual KSHV isolates without the hassle of sequencing the high A+G and repetitive IRD DNA. We have recently isolated an ostensibly aggressive KSHV variant with large sequence deletions in exclusively lytic cycle genes which is present in some KS lesions (J.-H. Deng, Y.-J. Zhang & S.-J. Gao, unpublished data). This finding suggests that the current lytic cycle gene-based genotyping techniques are useless in certain situations. Genotyping with PCRRFLP of ORF73 IRD can identify these defective KSHV genomes.
| Acknowledgments |
|---|
We thank Carlo Parravicini and Mario Corbellino for providing the KS specimens, Ornella Flore and Ethel Cesarman for providing BC-2 and BC-3 cell lines.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Ansari, M. Q., Dawson, D. B., Nador, R., Rutherford, C., Schneider, N. R., Latimer, M. J., Picker, L., Knowles, D. M. & McKenna, R. W. (1996). Primary body cavity-based AIDS-related lymphomas. American Journal of Clinical Pathology105, 221-229.[Medline]
Arvanitakis, L., Mesri, E. A., Nador, R. G., Said, J. W., Asch, A. S., Knowles, D. M. & Cesarman, E. (1996). Establishment and characterization of a primary effusion (body cavity-based) lymphoma cell line (BC-3) harboring Kaposis sarcoma-associated herpesvirus (KSHV/HHV-8) in the absence of EpsteinBarr virus.Blood88, 2648-2654.
Ballestas, M. E., Chatis, P. A. & Kaye, K. M. (1999). Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen.Science284, 641-644.
Boshoff, C., Schulz, T. F., Kennedy, M. M., Graham, A. K., Fisher, C., Thomas, A., McGee, J. O., Weiss, R. A. & OLeary, J. J. (1995). Kaposis sarcoma-associated herpesvirus infects endothelial and spindle cells.Nature Medicine1, 1274-1278.[Medline]
Caterino-de-Araujo, A. (1998). Human herpesvirus 8 group B and C variants circulating in Sao Paulo, Brazil.Journal of Infectious Diseases177, 1136-1137.[Medline]
Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M. (1995a). Kaposis sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.New England Journal of Medicine332, 1186-1191.
Cesarman, E., Moore, P. S., Rao, P. H., Inghirami, G., Knowles, D. M. & Chang, Y. (1995b). In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposis sarcoma-associated herpesvirus-like (KSHV) DNA sequences.Blood86, 2708-2714.
Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposis sarcoma.Science266, 1865-1869.
Chang, Y., Ziegler, J., Wabinga, H., Katangole-Mbidde, E., Boshoff, C., Schulz, T., Whitby, D., Maddalena, D., Jaffe, H. W., Weiss, R. A., Moore, P. S. & Uganda Kaposis Sarcoma Study Group. (1996). Kaposis sarcoma-associated herpesvirus and Kaposis sarcoma in Africa. Archives of Internal Medicine156, 202204.
Chauhan, D., Bharti, A., Raje, N., Gustafson, E., Pinkus, G. S., Pinkus, J. L., Teoh, G., Hideshima, T., Treon, S. P., Fingeroth, J. D. & Anderson, K. C. (1999). Detection of Kaposis sarcoma herpesvirus DNA sequences in multiple myeloma bone marrow stromal cells.Blood93, 1482-1486.
Choi, J. K., Lee, B. S., Shim, S. N., Li, M. & Jung, J. U. (2000). Identification of the novel K15 gene at the rightmost end of the Kaposis sarcoma-associated herpesvirus genome.Journal of Virology74, 436-446.
Cook, P. M., Whitby, D., Calabro, M. L., Luppi, M., Kakoola, D. N., Hjalgrim, H., Ariyoshi, K., Ensoli, B., Davison, A. J., Schulz, T. F. & Group, I. C. (1999). Variability and evolution of Kaposis sarcoma-associated herpesvirus in Europe and Africa.AIDS13, 1165-1176.[Medline]
Cotter, M. A.2nd & Robertson, E. S. (1999). The latency-associated nuclear antigen tethers the Kaposis sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells.Virology264, 254-264.[Medline]
Diaz-Cano, S. J. & Wolfe, H. J. (1997). Clonality in Kaposis sarcoma.New England Journal of Medicine337, 571.
Dukers, N. H., Renwick, N., Prins, M., Geskus, R. B., Schulz, T. F., Weverling, G. J., Coutinho, R. A. & Goudsmit, J. (2000). Risk factors for human herpesvirus 8 seropositivity and seroconversion in a cohort of homosexual men.American Journal of Epidemiology151, 213-224.
Dupin, N., Grandadam, M., Calvez, V., Gorin, I., Aubin, J. T., Harvard, S., Lamy, F., Leibowitch, M., Huraux, J. M., Escande, J. P. & Agut, H. (1995). Herpesvirus-like DNA in patients with Mediterranean Kaposis sarcoma.Lancet345, 761-762.[Medline]
Dupin, N., Fisher, C., Kellam, P., Ariad, S., Tulliez, M., Franck, N., van Marck, E., Salmon, D., Gorin, I., Escande, J. P., Weiss, R. A., Alitalo, K. & Boshoff, C. (1999). Distribution of human herpesvirus-8 latently infected cells in Kaposis sarcoma, multicentric Castlemans disease, and primary effusion lymphoma.Proceedings of the National Academy of Sciences, USA96, 4546-4551.
Foreman, K. E., Alkan, S., Krueger, A. E., Panella, J. R., Swinnen, L. J. & Nickoloff, B. J. (1998). Geographically distinct HHV-8 DNA sequences in Saudi Arabian iatrogenic Kaposis sarcoma lesions.American Journal of Pathology153, 1001-1004.
Friborg, J.Jr, Kong, W., Hottiger, M. O. & Nabel, G. J. (1999). p53 inhibition by the LANA protein of KSHV protects against cell death.Nature402, 889-894.[Medline]
Gao, S. J., Kingsley, L., Hoover, D. R., Spira, T. J., Rinaldo, C. R., Saah, A., Phair, J., Detels, R., Parry, P., Chang, Y. & Moore, P. S. (1996a). Seroconversion to antibodies against Kaposis sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposis sarcoma.New England Journal of Medicine335, 233-241.
Gao, S. J., Kingsley, L., Li, M., Zheng, W., Parravicini, C., Ziegler, J., Newton, R., Rinaldo, C. R., Saah, A., Phair, J., Detels, R., Chang, Y. & Moore, P. S. (1996b). KSHV antibodies among Americans, Italians and Ugandans with and without Kaposis sarcoma.Nature Medicine2, 925-928.[Medline]
Gao, S. J., Zhang, Y. J., Deng, J. H., Rabkin, C. S., Flore, O. & Jenson, H. B. (1999). Molecular polymorphism of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) latent nuclear antigen: evidence for a large repertoire of viral genotypes and dual infection with different viral genotypes.Journal of Infectious Diseases180, 1466-1476.[Medline]
Gessain, A., Sudaka, A., Briere, J., Fouchard, N., Nicola, M. A., Rio, B., Arborio, M., Troussard, X., Audouin, J., Diebold, J. and others (1996). Kaposis sarcoma-associated herpes-like virus (human herpesvirus type 8) DNA sequences in multicentric Castlemans disease: is there any relevant association in non-human immunodeficiency virus-infected patients? Blood87, 414416.
Gessain, A., Briere, J., Angelin-Duclos, C., Valensi, F., Beral, H. M., Davi, F., Nicola, M. A., Sudaka, A., Fouchard, N., Gabarre, J., Troussard, X., Dulmet, E., Audouin, J., Diebold, J. & de The, G. (1997). Human herpesvirus 8 (Kaposis sarcoma herpesvirus) and malignant lymphoproliferations in France: a molecular study of 250 cases including two AIDS-associated body cavity-based lymphomas.Leukemia11, 266-272.[Medline]
Glenn, M., Rainbow, L., Aurad, F., Davison, A. & Schulz, T. F. (1999). Identification of a spliced gene from Kaposis sarcoma-associated herpesvirus encoding a protein with similarities to latent membrane proteins 1 and 2A of EpsteinBarr virus.Journal of Virology73, 6953-6963.
Grulich, A. E., Olsen, S. J., Luo, K., Hendry, O., Cunningham, P., Cooper, D. A., Gao, S. J., Chang, Y., Moore, P. S. & Kaldor, J. M. (1999). Kaposis sarcoma-associated herpesvirus: a sexually transmissible infection.Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology20, 387-393.[Medline]
Kasolo, F. C., Monze, M., Obel, N., Anderson, R. A., French, C. & Gompels, U. A. (1998). Sequence analyses of human herpesvirus-8 strains from both African human immunodeficiency virus-negative and -positive childhood endemic Kaposis sarcoma show a close relationship with strains identified in febrile children and high variation in the K1 glycoprotein.Journal of General Virology79, 3055-3065.[Abstract]
Kedes, D. H., Operskalski, E., Busch, M., Kohn, R., Flood, J. & Ganem, D. (1996). The seroepidemiology of human herpesvirus 8 (Kaposis sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.Nature Medicine2, 918-924.[Medline]
Lee, M. A., Diamond, M. E. & Yates, J. L. (1999). Genetic evidence that EBNA-1 is needed for efficient, stable latent infection by EpsteinBarr virus.Journal of Virology73, 2974-2982.
Lennette, E. T., Blackbourn, D. J. & Levy, J. A. (1996). Antibodies to human herpesvirus type 8 in the general population and in Kaposis sarcoma patients.Lancet348, 858-861.[Medline]
Luppi, M., Barozzi, P., Marasca, R., Ferrari, M. G. & Torelli, G. (1997). Human herpesvirus 8 strain variability in clinical conditions other than Kaposis sarcoma.Journal of Virology71, 8082-8083.[Medline]
Martin, J. N., Ganem, D. E., Osmond, D. H., Page-Shafer, K. A., Macrae, D. & Kedes, D. H. (1998). Sexual transmission and the natural history of human herpesvirus 8 infection.New England Journal of Medicine338, 948-954.
Mayama, S., Cuevas, L. E., Sheldon, J., Omar, O. H., Smith, D. H., Okong, P., Silvel, B., Hart, C. A. & Schulz, T. F. (1998). Prevalence and transmission of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents.International Journal of Cancer77, 817-820.
Melbye, M., Cook, P. M., Hjalgrim, H., Begtrup, K., Simpson, G. R., Biggar, R. J., Ebbesen, P. & Schulz, T. F. (1998). Risk factors for Kaposis-sarcoma-associated herpesvirus (KSHV/HHV-8) seropositivity in a cohort of homosexual men, 19811996.International Journal of Cancer77, 543-548.
Memar, O. M., Rady, P. L. & Tyring, S. K. (1995). Human herpesvirus-8: detection of novel herpesvirus-like DNA sequences in Kaposis sarcoma and other lesions.Journal of Molecular Medicine73, 603-609.[Medline]
Meng, Y. X., Spira, T. J., Bhat, G. J., Birch, C. J., Druce, J. D., Edlin, B. R., Edwards, R., Gunthel, C., Newton, R., Stamey, F. R., Wood, C. & Pellett, P. E. (1999). Individuals from North America, Australia, and Africa are infected with four different genotypes of human herpesvirus 8.Virology261, 106-119.[Medline]
Miller, G., Rigsby, M. O., Heston, L., Grogan, E., Sun, R., Metroka, C., Levy, J. A., Gao, S. J., Chang, Y. & Moore, P. (1996). Antibodies to butyrate-inducible antigens of Kaposis sarcoma-associated herpesvirus in patients with HIV-1 infection.New England Journal of Medicine334, 1292-1297.
Moore, P. S. & Chang, Y. (1995). Detection of herpesvirus-like DNA sequences in Kaposis sarcoma lesions from persons with and without HIV infection.New England Journal of Medicine332, 1181-1185.
Nador, R. G., Cesarman, E., Chadburn, A., Dawson, D. B., Ansari, M. Q., Sald, J. & Knowles, D. M. (1996). Primary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposis sarcoma-associated herpesvirus.Blood88, 645-656.
Nocera, A., Corbellino, M., Valente, U., Barocci, S., Torre, F., De Palma, R., Sementa, A., Traverso, G. B., Icardi, A., Fontana, I., Arcuri, V., Poli, F., Cagetti, P., Moore, P. & Parravicini, C. (1998). Posttransplant human herpes virus 8 infection and seroconversion in a Kaposis sarcoma affected kidney recipient transplanted from a human herpes virus 8 positive living related donor.Transplantation Proceedings30, 2095-2096.[Medline]
Olsen, S. J., Chang, Y., Moore, P. S., Biggar, R. J. & Melbye, M. (1998). Increasing Kaposis sarcoma-associated herpesvirus seroprevalence with age in a highly Kaposis sarcoma endemic region, Zambia in 1985.AIDS12, 1921-1925.[Medline]
Otsuki, T., Kumar, S., Ensoli, B., Kingma, D. W., Yano, T., Stetler-Stevenson, M., Jaffe, E. S. & Raffeld, M. (1996). Detection of HHV-8/KSHV DNA sequences in AIDS-associated extranodal lymphoid malignancies.Leukemia10, 1358-1362.[Medline]
Parravicini, C., Olsen, S. J., Capra, M., Poli, F., Sirchia, G., Gao, S. J., Berti, E., Nocera, A., Rossi, E., Bestetti, G., Pizzuto, M., Galli, M., Moroni, M., Moore, P. S. & Corbellino, M. (1997). Risk of Kaposis sarcoma-associated herpesvirus transmission from donor allografts among Italian posttransplant Kaposis sarcoma patients.Blood90, 2826-2829.
Poole, L. J., Zong, J. C., Ciufo, D. M., Alcendor, D. J., Cannon, J. S., Ambinder, R., Orenstein, J. M., Reitz, M. S. & Hayward, G. S. (1999). Comparison of genetic variability at multiple loci across the genomes of the major subtypes of Kaposis sarcoma-associated herpesvirus reveals evidence for recombination and for two distinct types of open reading frame K15 alleles at the right-hand end.Journal of Virology73, 6646-6660.
Rainbow, L., Platt, G. M., Simpson, G. R., Sarid, R., Gao, S. J., Stoiber, H., Herrington, C. S., Moore, P. S. & Schulz, T. F. (1997). The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.Journal of Virology71, 5915-5921.[Abstract]
Raje, N., Gong, J., Chauhan, D., Teoh, G., Avigan, D., Wu, Z., Chen, D., Treon, S. P., Webb, I. J., Kufe, D. W. & Anderson, K. C. (1999). Bone marrow and peripheral blood dendritic cells from patients with multiple myeloma are phenotypically and functionally normal despite the detection of Kaposis sarcoma herpesvirus gene sequences.Blood93, 1487-1495.
Regamey, N., Tamm, M., Wernli, M., Witschi, A., Thiel, G., Cathomas, G. & Erb, P. (1998). Transmission of human herpesvirus 8 infection from renal-transplant donors to recipients.New England Journal of Medicine339, 1358-1363.
Regamey, N., Tamm, M., Binet, I., Thiel, G., Erb, P. & Cathomas, G. (1999). Transplantation-associated Kaposis sarcoma: herpesvirus 8 transmission through renal allografts.Transplantation Proceedings31, 922-923.[Medline]
Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D. & Ganem, D. (1996). Lytic growth of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) in culture.Nature Medicine2, 342-346.[Medline]
Rettig, M. B., Ma, H. J., Vescio, R. A., Pold, M., Schiller, G., Belson, D., Savage, A., Nishikubo, C., Wu, C., Fraser, J., Said, J. W. & Berenson, J. R. (1997). Kaposis sarcoma-associated herpesvirus infection of bone marrow dendritic cells from multiple myeloma patients.Science276, 1851-1854.
Rezza, G., Lennette, E. T., Giuliani, M., Pezzotti, P., Caprilli, F., Monini, P., Butto, S., Lodi, G., Di Carlo, A., Levy, J. A. & Ensoli, B. (1998). Prevalence and determinants of anti-lytic and anti-latent antibodies to human herpesvirus-8 among Italian individuals at risk of sexually and parenterally transmitted infections.International Journal of Cancer77, 361-365.
Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y. & Moore, P. S. (1996). Nucleotide sequence of the Kaposis sarcoma-associated herpesvirus (HHV8).Proceedings of the National Academy of Sciences, USA93, 14862-14867.
Said, J. W., Rettig, M. R., Heppner, K., Vescio, R. A., Schiller, G., Ma, H. J., Belson, D., Savage, A., Shintaku, I. P., Koeffler, H. P., Asou, H., Pinkus, G., Pinkus, J., Schrage, M., Green, E. & Berenson, J. R. (1997). Localization of Kaposis sarcoma-associated herpesvirus in bone marrow biopsy samples from patients with multiple myeloma.Blood90, 4278-4282.
Schalling, M., Ekman, M., Kaaya, E. E., Linde, A. & Biberfeld, P. (1995). A role for a new herpesvirus (KSHV) in different forms of Kaposis sarcoma.Nature Medicine1, 707-708.[Medline]
Simpson, G. R., Schulz, T. F., Whitby, D., Cook, P. M., Boshoff, C., Rainbow, L., Howard, M. R., Gao, S. J., Bohenzky, R. A., Simmonds, P., Lee, C., de Ruiter, A., Hatzakis, A., Tedder, R. S., Weller, I. V., Weiss, R. A. & Moore, P. S. (1996). Prevalence of Kaposis sarcoma-associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen.Lancet348, 1133-1138.[Medline]
Smith, N. A., Sabin, C. A., Gopal, R., Bourboulia, D., Labbet, W., Boshoff, C., Barlow, D., Band, B., Peters, B. S., de Ruiter, A., Brown, D. W., Weiss, R. A., Best, J. M. & Whitby, D. (1999). Serologic evidence of human herpesvirus 8 transmission by homosexual but not heterosexual sex.Journal of Infectious Diseases180, 600-606.[Medline]
Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., dAgay, M. F., Clauvel, J. P., Raphael, M., Degos, L. and others (1995). Kaposis sarcoma-associated herpesvirus-like DNA sequences in multicentric Castlemans disease. Blood86, 12761280.
Su, I.-J., Hsu, Y.-S., Chang, Y.-C. & Wang, I.-W. (1995). Herpesvirus-like DNA sequence in Kaposis sarcoma from AIDS and non-AIDS patients in Taiwan.Lancet345, 722-723.[Medline]
Szekely, L., Kiss, C., Mattsson, K., Kashuba, E., Pokrovskaja, K., Juhasz, A., Holmvall, P. & Klein, G. (1999). Human herpesvirus-8-encoded LNA-1 accumulates in heterochromatin-associated nuclear bodies.Journal of General Virology80, 2889-2900.
Whitby, D., Howard, M. R., Tenant-Flowers, M., Brink, N. S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F. E., Aldam, D. M., Denton, A. S. and others (1995). Detection of Kaposis sarcoma-associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposis sarcoma. Lancet346, 799802.[Medline]
Zhong, W., Wang, H., Herndier, B. & Ganem, D. (1996). Restricted expression of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposis sarcoma.Proceedings of the National Academy of Sciences, USA93, 6641-6646.
Zong, J. C., Metroka, C., Reitz, M. S., Nicholas, J. & Hayward, G. S. (1997). Strain variability among Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) genomes: evidence that a large cohort of United States AIDS patients may have been infected by a single common isolate.Journal of Virology71, 2505-2511.[Abstract]
Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S. (1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposis sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations.Journal of Virology73, 4156-4170.
Received 22 February 2000;
accepted 12 April 2000.
This article has been cited by other articles:
![]() |
J. Hart, M. Ackermann, G. Jayawardane, G. Russell, D. M. Haig, H. Reid, and J. P. Stewart Complete sequence and analysis of the ovine herpesvirus 2 genome J. Gen. Virol., January 1, 2007; 88(1): 28 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Taus, D. R. Herndon, D. L. Traul, J. P. Stewart, M. Ackermann, H. Li, D. P. Knowles, G. S. Lewis, and K. A. Brayton Comparison of ovine herpesvirus 2 genomes isolated from domestic sheep (Ovis aries) and a clinically affected cow (Bos bovis) J. Gen. Virol., January 1, 2007; 88(1): 40 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Taylor, H. N. Bennett, B. A. Snyder, P. S. Moore, and Y. Chang Transcriptional Analysis of Latent and Inducible Kaposi's Sarcoma-Associated Herpesvirus Transcripts in the K4 to K7 Region J. Virol., December 15, 2005; 79(24): 15099 - 15106. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-C. Ye, F.-C. Zhou, S. M. Yoo, J.-P. Xie, P. J. Browning, and S.-J. Gao Disruption of Kaposi's Sarcoma-Associated Herpesvirus Latent Nuclear Antigen Leads to Abortive Episome Persistence J. Virol., October 15, 2004; 78(20): 11121 - 11129. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Dourmishev, A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis Microbiol. Mol. Biol. Rev., June 1, 2003; 67(2): 175 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Coulter and H. W. Reid Isolation and expression of three open reading frames from ovine herpesvirus-2 J. Gen. Virol., March 1, 2002; 83(3): 533 - 543. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Piolot, M. Tramier, M. Coppey, J.-C. Nicolas, and V. Marechal Close but Distinct Regions of Human Herpesvirus 8 Latency-Associated Nuclear Antigen 1 Are Responsible for Nuclear Targeting and Binding to Human Mitotic Chromosomes J. Virol., April 15, 2001; 75(8): 3948 - 3959. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |