J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jan, F.-J.
Right arrow Articles by Gonsalves, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jan, F.-J.
Right arrow Articles by Gonsalves, D.
Agricola
Right arrow Articles by Jan, F.-J.
Right arrow Articles by Gonsalves, D.
Journal of General Virology (2000), 81, 2103-2109.
© 2000 Society for General Microbiology


Plant

A single chimeric transgene derived from two distinct viruses confers multi-virus resistance in transgenic plants through homology-dependent gene silencing

Fuh-Jyh Jan1, Carmen Fagoagab,1, Sheng-Zhi Pangc,1 and Dennis Gonsalves1

Department of Plant Pathology, Cornell University, NYSAES, Geneva, NY 14456, USA1

Author for correspondence: Dennis Gonsalves. Fax +1 315 787 2389. e-mail dg12{at}cornell.edu


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We showed previously that 218 and 110 bp N gene segments of tomato spotted wilt virus (TSWV) that were fused to the non-target green fluorescent protein (GFP) gene were able to confer resistance to TSWV via post-transcriptional gene silencing (PTGS). N gene segments expressed alone did not confer resistance. Apparently, the GFP DNA induced PTGS that targetted N gene segments and the incoming homologous TSWV for degradation, resulting in a resistant phenotype. These observations suggested that multiple resistance could be obtained by replacing the GFP DNA with a viral DNA that induces PTGS. The full-length coat protein (CP) gene of turnip mosaic virus (TuMV) was linked to 218 or 110 bp N gene segments and transformed into Nicotiana benthamiana. A high proportion (4 of 18) of transgenic lines with the 218 bp N gene segment linked to the TuMV CP gene were resistant to both viruses, and resistance was transferred to R2 plants. Nuclear run-on and Northern experiments confirmed that resistance was via PTGS. In contrast, only one of 14 transgenic lines with the TuMV CP linked to a 110 bp N gene segment yielded progeny with multiple resistance. Only a few R1 plants were resistant and resistance was not observed in R2 plants. These results clearly show the applicability of multiple virus resistance through the fusion of viral segments to DNAs that induce PTGS.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Tomato spotted wilt virus (TSWV) and turnip mosaic virus (TuMV) are among the ten most important viruses worldwide that infect vegetables (Tomlinson, 1987Down ). TSWV, the type species of the genus Tospovirus, has a wide host range and is transmitted by several species of thrip (German et al., 1992Down ). The virus genome consists of three ssRNAs designated as small (S), medium (M) and large (L). The L RNA is of negative polarity and encodes a 331·5 kDa putative viral polymerase (de Haan et al., 1991Down ), while the S and M RNAs contain two open reading frames, in an ambisense gene arrangement (de Haan et al., 1990Down ; Maiss et al., 1991Down ; Kormelink et al., 1992bDown ), which are expressed via the synthesis of subgenomic mRNAs (Kormelink et al., 1992aDown ). The M RNA encodes the precursor of the envelope glycoproteins G1 and G2 and the non-structural protein NSM (Kormelink et al., 1994Down ). The S RNA encodes a non-structural protein, NSS, and the structural nucleocapsid (N) protein. TuMV is a member of the genus Potyvirus in the family Potyviridae (Shukla et al., 1994Down ). The monopartite genome of potyviruses consists of a positive-sense ssRNA of about 10 kb with a 5'-linked virus-encoded protein (VPg) and a polyadenylate tract at the 3’ end (Dougherty & Carrington, 1988Down ). The coat protein (CP) gene is localized at the 3’ end of the genome and the CP is generated by proteolytic cleavage of the virus-encoded polyprotein (Dougherty & Carrington, 1988Down ).

Post-transcriptional gene silencing (PTGS) has been reported to be one of the major mechanisms of RNA-mediated resistance in transgenic plants (Dougherty & Parks, 1995Down ; Baulcombe, 1996Down ; Baulcombe & English, 1996Down ; Dawson, 1996Down ; Prins & Goldbach, 1996Down ; Beachy, 1997Down ; van den Boogaart et al., 1998Down ). Recently, we showed that transgenes consisting of ~400 bp segments of the N gene of TSWV conferred resistance to TSWV in transgenic plants through PTGS (Pang et al., 1997Down ), but N gene segments of 92–235 bp did not. However, transgenic plants expressing transgenes consisting of 218 or 110 bp N gene segments linked to the 720 bp green fluorescent protein (GFP) gene were resistant to TSWV (Pang et al., 1997Down ). Further work showed that transgenic plants with transgenes consisting of N gene segments of 59 or 24 bp similarly linked to GFP were not resistant to TSWV, even though the transgene showed PTGS (Jan et al., 2000Down ). Collectively, these data suggested that segments of the N gene of 110 bp or more could confer resistance when linked to a transcribed DNA (designated ‘silencer’ DNA) that induces PTGS. This observation opened the possibility of developing multiple virus resistance in transgenic plants by using viral DNA as a ‘silencer’ and linking it to segments of other viral DNA.

In order to test this strategy for multiple virus resistance, we linked the 867 bp TuMV CP gene (Jan et al., 1999Down ) to a 218 bp N gene segment of TSWV and transferred the construct into Nicotiana benthamiana. The CP gene of TuMV was used as a ‘silencer’ DNA because TuMV is considered to be the most important virus of cultivated cruciferous cash crops (Green & Deng, 1985Down ) and it is known that the CP gene of TuMV induces PTGS and confers resistance to TuMV (Jan et al., 1999Down ). Here, we report that transgenic plants expressing a transgene consisting of TuMV CP fused with a 218 bp N gene segment of TSWV are resistant to TSWV and TuMV via the PTGS mechanism.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Vector construction and plant transformation.
The N gene of the lettuce isolate of TSWV (TSWV-BL; Pang et al., 1992Down ) and the CP gene of the garden balsam isolate of TuMV (TuMV-ESC8; Jan et al., 1999Down ) were used as templates for constructing hybrid transgenes with N gene segments of various lengths fused to the CP gene (Fig. 1Down). The terminology of the gene segments was described previously and indicates their size and location (Pang et al., 1997Down ). The 3/4 N gene fragment corresponds to nt ~400–600 of the 866 nt N gene (Pang et al., 1997Down ), while the 5/8 N gene fragment corresponds to nt ~400–500. The forward primers for the N gene segments were designed to contain an out-of-frame ATG and/or stop codon to ensure the production of untranslatable N gene transcripts (Pang et al., 1997Down ). The 3/4 N gene segment (Panget al., 1997Down ) was amplified by PCR with oligomer primers 92-55 (5’ AGATTCTCTAGACCATGGTGACTTGATGAGCAAAGTCTGTGAGGCTTGC), which is identical to the S RNA (Pang et al., 1992Down ) of TSWV-BL at nt 2373–2354, and 93-86 (5’ TCTTGAGGATCCATGGCTGATCTTCATTCATTTCAA), which is complementary to the S RNA at nt 2158–2177. The 5/8 N gene segment (Panget al., 1997Down ) was generated by PCR with oligomer primers 92-55 and 93-90 (5’ TCTTGAGGATCCATGGATCCTGATATATAGCCAAGA), which is located at nt 2269–2288 of the S RNA (Pang et al., 1992Down ). The 3/4 N and 5/8 N segments were cloned as transcriptional fusions in the sense orientation into the XbaI/BamHI sites downstream of the TuMV CP gene in the plant expression vector pBI525-TuMVCP+ (Jan et al., 1999Down ). The resulting plant expression vectors were digested with HindIII and EcoRI and the HindIII–EcoRI segments containing the corresponding gene cassettes were isolated and introduced into the plant transformation vector pBIN19 (Clontech) that had been digested with the same restriction enzymes. The resulting binary vectors were then transferred into Agrobacterium tumefaciens LBA4404 (Clontech) and A. tumefaciens containing the transformation vectors was used to inoculate leaf discs of N. benthamiana plants essentially as described by Horsch et al. (1985)Down .



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 1. Maps of the transgenes used in this study. Non-translatable N gene segments were fused transcriptionally with the TuMV CP gene. Each transgene was driven by a double-enhanced (Enh) CaMV 35S promoter (35S-P), the 5' untranslated leader (UT) of AlMV and the 3' untranslated sequence of the nopaline synthase gene (NOS-T).

 
{blacksquare} ELISA, Northern blot analyses and nuclear run-on transcription assays of transgenic plants.
Antibodies to the CP of TuMV (Ling et al., 1995Down ) and N protein of TSWV (Wang & Gonsalves, 1990Down ) were used in double-antibody-sandwich (DAS)-ELISA to detect virus infection. An nptII ELISA kit (5 Prime to 3 Prime) was used to detect the neomycin phosphotransferase enzyme in transgenic plants. For the estimation of RNA transcript levels in transgenic plants by Northern blot, total plant RNAs were isolated according to the procedure described by Napoli et al. (1990)Down . Ten µg total RNA per well was electrophoresed on a formaldehyde-containing agarose gel (Sambrook et al., 1989Down ) and the gel was stained with ethidium bromide to monitor the relative amount of total plant RNAs in each well. Hybridization conditions were those suggested in the manufacturer’s protocol of the GeneScreen Plus membrane (Dupont), using random priming methods to generate probes (Feinberg & Vogelstein, 1983Down ). Isolation of nuclei and nuclear run-on transcription assays were performed essentially as described by Dehio & Schell (1994)Down . The same amount of labelled nascent RNA was hybridized to identical Southern blot membranes that contained 0·2 µg CP, actin, nptII and N genes that had been restriction enzyme-digested and separated electrophoretically as described by Pang et al. (1996)Down . To compare the signal densities in Northern and nuclear run-on assays, images of some autoradiograms were photographed with a CCD camera (COHU, model 4915-2000). Signals were quantified by using the US NIH Image program version 1.59.

{blacksquare} Inoculation of transgenic plants.
TuMV-ESC8 and TSWV-BL were propagated in turnip cultivar Presto and N. benthamiana, respectively. For inoculations with single viruses, inocula (1:30 dilutions of crude sap) were prepared by grinding TuMV- or TSWV-infected leaves (1 g) in 30 ml 10 mM phosphate buffer (pH 7·0) or buffer 4 (0·033 M KH2PO4, 0·067 M K2HPO4 and 0·01M Na2SO3), respectively. Inocula consisting of both TuMV and TSWV were prepared by mixing equal aliquots of 1:15 dilutions of crude sap from plants infected with each of these viruses, using buffer 4 to prepare extracts. Test plants were inoculated at the 5–7 leaf stage, except where indicated, by rubbing leaf extracts onto carborundum-dusted leaves and subsequently rinsing the leaves with water. To monitor for the possibility of escapes, control non-transformed plants were inoculated in each experiment and each batch of inoculum extract was applied first to transgenic plants and then to control plants. Inoculated plants were grown in the greenhouse and observed daily for at least 45 days.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Generation of transgenic plants expressing N gene segments fused with TuMV CP
The untranslatable 3/4 N and 5/8 N gene segments of 218 and 110 bp were cloned as transcriptional fusions in the sense orientation into the XbaI/BamHI sites downstream of the TuMV CP gene in the plant expression vector pBI525-TuMVCP+ (Fig. 1Up; Jan et al., 1999Down ). Several clones with the proper insert were isolated, identified by restriction enzyme site mapping and sequenced to confirm their identity. The constructs containing the 3/4 N or 5/8 N gene segment fused to the TuMV CP were designated pBI525-TuMVCP+3/4N and pBI525-TuMVCP+5/8N, respectively (Fig. 1Up). Expression of those fusions is thus controlled by the double-enhanced cauliflower mosaic virus (CaMV) 35S promoter, the 5’ untranslated region from alfalfa mosaic virus (AlMV) and the 3’ untranslated region of the nopaline synthase (NOS) gene (Fig. 1Up). The expression cassettes were then moved to the plant transformation vector pBIN19 and used to obtain transgenic N. benthamiana plants via Agrobacterium-mediated transformation.

A total of 23 R0 transgenic plants with TuMVCP+3/4N and 21 with TuMVCP+5/8N were initially confirmed to be transgenic by PCR analysis and nptII ELISA. Northern analysis of some R0 plants showed that the level of TuMV CP transcript was tightly correlated with that of the N gene transcript, indicating that they are transcribed as a single transcription unit as designed (data not shown). All of the R0 plants were self-pollinated to produce R1 seeds for inoculation tests.

A TSWV N gene segment fused to the TuMV CP gene confers resistance to both viruses
Prior to testing for resistance, R1 seedlings from the transgenic lines were screened by nptII ELISA to identify transgenic and non-transgenic plants in the populations. Unlike negative-control plants, which were all susceptible to the virus, a proportion of R1 plants expressing the TuMVCP+3/4N and TuMVCP+5/8N transgenes were resistant to TuMV and TSWV. Table 1Down summarizes the reactions of the inoculated R1 plants to TSWV-BL and TuMV-ESC8. The reactions could be grouped into three different categories: (i) resistant to both TuMV and TSWV, (ii) resistant to TuMV but susceptible to TSWV and (iii) susceptible to both TuMV and TSWV. No resistance to TSWV and TuMV was observed in a total of 262 plants examined from nine of the 18 TuMVCP+3/4N transgene lines (Table 1Down). Some plants from four of the other nine lines (55-4, 55-6, 55-9, 55-17) displayed resistance to TSWV and TuMV while, interestingly, the five remaining lines (55-8, 55-11, 55-16, 55-20, 55-21) had plants that were resistant to TuMV but susceptible to TSWV (Table 1Down). In contrast, plants resistant to TSWV and TuMV were found in only one of the 14 tested lines with the TuMVCP+5/8N transgene (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Inoculation of TuMV and TSWV to R1 plants expressing the 3/4 N or 5/8 N gene segment linked to TuMV CP

 
Northern and nuclear run-on experiments showed that TuMV- and TSWV-resistant plants displayed PTGS of the TuMV CP and TSWV N genes (Fig. 2aDown). Selected TuMV- or TSWV-resistant plants of lines 55-4, 55-6 and 55-9 (Table 1Up) had relatively low RNA accumulation of CP and N gene transcripts, while selected susceptible plants from the same lines and plants from the susceptible line 55-15 showed high levels of CP and N gene transcripts (Fig. 2aDown). Nuclear run-on experiments showed that the transgene was being actively transcribed in the virus-resistant but low-message-accumulating plants of line 55-9 (Fig. 2bDown; line 55-9) (Fig. 2aDown) compared with plants of the susceptible line 55-15 (Fig. 2aDown, bDown). These results suggested that the reduced steady-state levels of the transcripts and virus resistance were due to PTGS.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2. Northern blot and nuclear run-on transcription analyses of R1 plants carrying the CP+3/4N fusion gene. (a) Northern blot analysis of R1 plants. RNA (10 µg per lane) was isolated from transgenic plants before inoculation and subsequently probed with the N gene of TSWV-BL (top) or the CP gene of TuMV (bottom). Plants were inoculated and scored as resistant (R) or susceptible (S). Lanes: 1–17, R1 plants of lines 55-4 (lanes 1–4), 55-6 (5–8), 55-9 (9–12) and 55-15 (13–17); 18, non-transgenic control. (b) Nuclear run-on transcription analysis of R1 plants. Labelled nuclear RNAs were hybridized to restriction enzyme-digested fragments of the nptII (lane 1), TSWV N (2), TuMV CP (3) and actin (4) genes separated on an agarose gel and blotted onto a membrane. The nuclei used in the assays were isolated from two resistant plants of line 55-9, two susceptible plants of line 55-15 and a non-transgenic control (NT).

 
Multiple resistance in R2 plants
Progeny (R2 plants) from several TSWV- or TuMV-resistant R1 plants from lines 55-9, 55-21 and 125-12 were evaluated for resistance to both viruses. Line 55-9 contained the CP+3/4N gene and had R1 plants resistant to both TuMV and TSWV. Line 55-21 had the same gene as line 55-9, but the R1 plants were resistant only to TuMV. Line 125-12 had the CP+5/8N gene and had R1 plants resistant to both viruses (Table 1Up). Plants were evaluated in two ways. In one set of experiments, plants were inoculated with either TSWV or TuMV and observed for 34 days and then the resistant plants were inoculated with the virus that had not been inoculated previously. In the other experiments, plants were inoculated with extracts containing a mixture of both viruses. Results from the three experiments were similar and are summarized in Table 2Down. A proportion of the progeny from five of the six R1 plants of line 55-9 were resistant to both viruses. Plants that were resistant to the first virus were also resistant to the second virus. These results showed clearly that multiple virus resistance was carried into the R2 plants. A proportion of the progeny (R2 plants) from 10 R1 plants of line 55-21 were resistant to TuMV, but none of them were resistant to TSWV. This was consistent with the data generated from the R1 plants (Table 1Up). In contrast, R2 plants of line 125-12 with the CP+5/8N gene had almost no resistance (Table 2Down). Only two of the 104 plants that were tested showed resistance, one to TSWV and the other to TuMV. Furthermore, while a number of plants from lines 55-9 and 55-21 showed delayed symptom development following virus inoculation, symptom delay was not observed in R2 plants from line 125-12.


View this table:
[in this window]
[in a new window]
 
Table 2. Inoculations of TSWV and TuMV to R2 progeny of TuMV- or TSWV-resistant R1 plants of lines 55-9, 55-21 and 125-12

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We showed recently that transgenic plants with a transgene of GFP fused to small segments of the N gene of TSWV are resistant to TSWV through the mechanism of PTGS (Pang et al., 1997Down ; Jan et al., 2000Down ). Thus, multiple resistance was likely to be obtained if a viral gene was substituted for the GFP gene. We show now that transgenic plants containing a transgene consisting of the TuMV CP gene fused to a short TSWV N gene segment are resistant to both viruses via the PTGS mechanism. This is the first report of multiple virus resistance obtained using this approach.

Transgenic plants with multiple resistance have also been generated previously by combining the entire CP genes of more than one virus, with each gene being driven by a promoter and a terminator. Transgenic potato expressing the CP genes of potato virus X and potato virus Y were resistant to both viruses (Lawson et al., 1990Down ; Kaniewski et al., 1990Down ). Similarly, transgenic tobacco with resistance to three tospoviruses (TSWV, tomato chlorotic spot virus and groundnut ringspot virus) (Prins et al., 1995Down ), transgenic squash with resistance to two or three viruses [cucumber mosaic virus (CMV), watermelon mosaic virus 2 (WMV2) and zucchini yellow mosaic virus (ZYMV)] (Fuchs & Gonsalves, 1995Down ; Tricoli et al., 1995Down ; Fuchs et al., 1998Down ), transgenic cantaloupe with resistance to CMV, ZYMV and WMV2 (Fuchs et al., 1997Down ) and transgenic tomato with resistance to CMV isolates of subgroups I and II (Kaniewski et al., 1999Down ) have been developed. Our approach differs from these in that we need only one transgene with a promoter and a terminator and the transgene may contain only a segment of one of the viral genes.

PTGS is homology dependent and is the apparent mechanism for RNA-mediated virus resistance. It is, thus, reasonable to think that transgenic plants with resistance to three or more viruses can be obtained simply by transforming plants with a transgene consisting of fused gene segments of different viruses linked to a ‘silencer’ DNA (e.g. GFP, TuMV CP). Recent data from our laboratory provide support for this approach (unpublished results). N. benthamiana plants with a chimeric transgene consisting of three small N gene segments of three different tospoviruses linked to GFP DNA were resistant to all three tospoviruses. This novel approach has several advantages for controlling viruses. Firstly, multiple resistance could be generated to desired viruses. Secondly, the small non-translatable segments minimize the risks of recombination, transcapsidation, synergism or complementation, which have been raised as disadvantages of some strategies that use full-length viral genes. Thirdly, a chimeric transgene requires only limited genetic elements for expression in transgenic plants, thus reducing the demand for genetic elements to engineer multiple traits into a single biotech product. Finally, the CP gene has been shown to be very effective in conferring resistance and many viral CP genes have been identified and are readily available. In addition, it is likely that this strategy could be used in functional genomics to down-regulate multiple genes coordinately in plants, to identify genes responsible for biochemical pathways or to develop new biotech products with multiple traits.

Similar co-suppression of two genes in a chimeric transgene has been described in a few reports. Introduction in tomato of a chimeric gene construct containing 244 bp of the 5' end of the polygalacturonase gene linked to the 5' end of a 1320 bp pectinesterase gene was able to trigger co-suppression of both genes (Seymour et al., 1993Down ). Gene constructs consisting of the {beta}-glucuronidase gene (uidA) linked to the full-length chalcone synthase (chsA) cDNA or the 5' half or the 3' half triggered PTGS of both genes in transgenic petunia (Van Blokland et al., 1994Down ; Stam et al., 1997Down ). These results, along with our own, show that silencer sequences are effective when they are located either at the 5'-end (Fig. 1Up; Van Blokland et al., 1994Down ; Stam et al., 1997Down ; Jan et al., 2000Down ) or the 3'-end (Seymour et al., 1993Down ) of chimeric transgenes. Moreover, our results are consistent with observations from other groups, who have shown that there are multiple target sites for PTGS along the transgene. Marano & Baulcombe (1998)Down showed that transgenic tobacco plants containing the TMV-U1 54 kDa replicase gene were resistant to potato virus X vectors containing the first half, the middle half or the second half of the replicase gene. Jacobs et al. (1999)Down reported that sequences throughout the basic {beta}-1,3-glucanase mRNA coding region are targets for PTGS in transgenic tobacco.

We observed that the 110 bp N gene segment was much less efficient than the 218 bp segment in conferring resistance to TSWV (Table 2Up), confirming our previous observations (Pang et al., 1997Down ; Jan et al., 2000Down ). This also suggests that the minimum N gene length for conferring resistance is between 59 and 110 bp, since the former length does not confer resistance (Jan et al., 2000Down ). However, the minimum gene segment length for conferring resistance to other viruses or for inactivating other homologous mRNAs probably differs from our observations with the N gene. Recently, Crété & Vaucheret (1999)Down showed that transformation of chimeric nii1uidA, uidAnii1 and nii1uidAnii1 transgenes carrying 186 bp of the 5' end and/or 241 bp of the 3' end of the tobacco nitrite reductase nii1 cDNA fused with the uidA gene did not trigger co-suppression of endogenous nii genes in transgenic tobacco. A possible reason for these results might be that the minimum length of nii gene required to trans-inactivate the nii genes is larger than 241 bp. Alternatively, the 5'- and 3'-terminal regions of the nii1 gene may be relatively inefficient targets for PTGS, as was recently reported by Jacobs et al. (1999)Down for transgenic tobacco with the gn1 {beta}-1,3-glucanase gene.

Interestingly, we also obtained plants that were resistant to TuMV (e.g. line 55-21 in Tables 1Up and 2Up) and susceptible to TSWV, but not vice versa. These results suggest that there are differences between regions of a transgene in the effectiveness at conferring resistance within the same plant. Logically, one would assume that the chances of obtaining resistance to a particular virus via PTGS get higher as the length of the homologous DNA segment, and thus the target area for degradation, increases. Further analyses of these plants should shed light on the reasons for the occurrence of plants with resistance only to TuMV. Such studies will provide insights into the most effective gene segment lengths to use in developing multiple virus resistance by the above approach.

In summary, we have shown that transgenic plants with resistance to both a potyvirus and a tospovirus can be obtained by fusing a segment of the tospovirus N gene to the potyvirus CP gene. This provides a simple approach to develop plants with resistance to two viruses. More importantly, this work provides strong evidence that transgenic plants with resistance to three or more viruses can be obtained by transforming plants with a transgene consisting of viral segments linked to a DNA silencer, which could also be a viral gene. The practical value of multiple virus resistance is obvious, since crops are frequently infected with more than one virus.


   Acknowledgments
 
We thank S. Day for technical assistance in the greenhouse. This study was supported in part by a grant (no. 97-35303-4624) to D.G. from the US Department of Agriculture National Competitive Research Initiative program. F.-J.J. was supported by a fellowship from the Ministry of Education, Taiwan, and C.F. was supported by a fellowship from the Ministerio Español de Educación y Ciencia.


   Footnotes
 
b Present address: Instituto Valenciano de Investigaciones Agrarias, Apartat Oficial 46113, Moncada, Valencia, Spain. Back

c Present address: BB5F, Monsanto Company, 700 Chesterfield Village Pkwy N., St Louis, MO 63198, USA. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Baulcombe, D. C. (1996). Mechanisms of pathogen-derived resistance to viruses in transgenic plants.Plant Cell8, 1833-1844.[Medline]

Baulcombe, D. C. & English, J. J. (1996). Ectopic pairing of homologous DNA and post-transcriptional gene silencing in transgenic plants.Current Opinion in Biotechnology7, 173-180.

Beachy, R. N. (1997). Mechanisms and applications of pathogen-derived resistance in transgenic plants.Current Opinion in Biotechnology8, 215-220.[Medline]

Crété, P. & Vaucheret, H. (1999). Expression and sequence requirements for nitrite reductase co-suppression.Plant Molecular Biology41, 105-114.[Medline]

Dawson, W. D. (1996). Gene silencing and virus resistance: a common mechanism.Trends in Plant Science1, 107-108.

de Haan, P., Wagemakers, L., Peters, D. & Goldbach, R. (1990). The S RNA segment of tomato spotted wilt virus has an ambisense character.Journal of General Virology71, 1001-1007.[Abstract/Free Full Text]

de Haan, P., Kormelink, R., Resende, R. de O., van Poelwijk, F., Peters, D. & Goldbach, R. (1991). Tomato spotted wilt virus L RNA encodes a putative RNA polymerase.Journal of General Virology72, 2207-2216.[Abstract/Free Full Text]

Dehio, C. & Schell, J. (1994). Identification of plant genetic loci involved in a posttranscriptional mechanism for meiotically reversible transgene silencing.Proceedings of the National Academy of Sciences, USA91, 5538-5542.[Abstract/Free Full Text]

Dougherty, W. G. & Carrington, J. C. (1988). Expression and function of potyviral gene products.Annual Review of Phytopathology26, 123-143.

Dougherty, W. G. & Parks, T. D. (1995). Transgenes and gene suppression: telling us something new?Current Opinion in Cell Biology7, 399-405.[Medline]

Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.Analytical Biochemistry132, 6-13.[Medline]

Fuchs, M. & Gonsalves, D. (1995). Resistance of transgenic hybrid squash ZW-20 expressing the coat protein genes of zucchini yellow mosaic virus and watermelon mosaic virus 2 to mixed infections by both potyviruses.Bio/Technology13, 1466-1473.

Fuchs, M., McFerson, J. R., Tricoli, D. M., McMaster, J. R., Deng, R. Z., Boeshore, M. L., Reynolds, J. F., Russell, P. F., Quemada, H. D. & Gonsalves, D. (1997). Cantaloupe line CZW-30 containing coat protein genes of cucumber mosaic virus, zucchini yellow mosaic virus, and watermelon mosaic virus-2 is resistant to these three viruses in the field.Molecular Breeding3, 279-290.

Fuchs, M., Tricoli, D. M., Carney, K. J., Schesser, M., McFerson, J. R. & Gonsalves, D. (1998). Comparative virus resistance and fruit yield of transgenic squash with single and multiple coat protein genes.Plant Disease82, 1350-1356.

German, T. L., Ullman, D. E. & Moyer, J. W. (1992). Tospoviruses (i): diagnosis, molecular biology, phylogeny, and vector relationships.Annual Review of Phytopathology30, 315-348.

Green, S. K. & Deng, T. C. (1985). Turnip mosaic virus strains in cruciferous hosts in Taiwan.Plant Disease69, 28-31.

Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz, D., Rogers, S. G. & Fraley, R. T. (1985). A simple and general method for transferring genes into plants.Science227, 1229-1231.[Abstract/Free Full Text]

Jacobs, J. J. M. R., Sanders, M., Bots, M., Andriessen, M., van Eldik, G. J., Litière, K., Van Montagu, M. & Cornelissen, M. (1999). Sequences throughout the basic {beta}-1,3-glucanase mRNA coding region are targets for homology dependent post-transcriptional gene silencing.Plant Journal20, 143-152.[Medline]

Jan, F.-J., Pang, S.-Z., Fagoaga, F. & Gonsalves, D. (1999). Turnip mosaic potyvirus resistance in Nicotiana benthamiana derived by post-transcriptional gene silencing.Transgenic Research8, 203-213.[Medline]

Jan, F.-J., Fagoaga, C., Pang, S.-Z. & Gonsalves, D. (2000). A minimum length of N gene sequence in transgenic plants is required for RNA-mediated tospovirus resistance.Journal of General Virology81, 235-242.[Abstract/Free Full Text]

Kaniewski, W., Lawson, C., Sammons, B., Haley, L., Hart, J., Delannay, X. & Tumer, N. E. (1990). Field resistance of transgenic Russet Burbank potato to effects of infection by potato virus X and potato virus Y.Bio/Technology8, 750-754.

Kaniewski, W., Ilardi, V., Tomassoli, L., Mitsky, T., Layton, J. & Barba, M. (1999). Extreme resistance to cucumber mosaic virus (CMV) in transgenic tomato expressing one or two viral coat proteins.Molecular Breeding5, 111-119.

Kormelink, R., de Haan, P., Peters, D. & Goldbach, R. (1992a). Viral RNA synthesis in tomato spotted wilt virus-infected Nicotiana rustica plants.Journal of General Virology73, 687-693.[Abstract/Free Full Text]

Kormelink, R., de Haan, P., Meurs, C., Peters, D. & Goldbach, R. (1992b). The nucleotide sequence of the M RNA segment of tomato spotted wilt virus, a bunyavirus with two ambisense RNA segments.Journal of General Virology73, 2795-2804.[Abstract/Free Full Text]

Kormelink, R., Storms, M., van Lent, J., Peters, D. & Goldbach, R. (1994). Expression and subcellular location of the NSM protein of tomato spotted wilt virus (TSWV), a putative viral movement protein.Virology200, 56-65.[Medline]

Lawson, C., Kaniewski, W., Haley, L., Rozman, R., Newell, C., Sanders, P. & Tumer, N. E. (1990). Engineering resistance to mixed virus infection in a commercial potato cultivar: resistance to potato virus X and potato virus Y in transgenic Russet Burbank.Bio/Technology8, 127-134.[Medline]

Ling, K. S., Provvidenti, R. & Gonsalves, D. (1995). Detection of turnip mosaic virus isolates using an antiserum to coat protein breakdown products.Plant Disease79, 809-812.

Maiss, E., Ivanova, L., Breyel, E. & Adam, G. (1991). Cloning and sequencing of the S RNA from a Bulgarian isolate of tomato spotted wilt virus.Journal of General Virology72, 461-464.[Abstract/Free Full Text]

Marano, M. R. & Baulcombe, D. (1998). Pathogen-derived resistance targeted against the negative-strand RNA of tobacco mosaic virus: RNA strand-specific gene silencing?Plant Journal13, 537-546.

Napoli, C., Lemieux, C. & Jorgensen, R. (1990). Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans.Plant Cell2, 279-290.[Abstract/Free Full Text]

Pang, S.-Z., Nagpala, P., Wang, M., Slightom, J. L. & Gonsalves, D. (1992). Resistance to heterologous isolates of tomato spotted wilt virus in transgenic tobacco expressing its nucleocapsid protein gene.Phytopathology82, 1223-1229.

Pang, S.-Z., Jan, F.-J., Carney, K., Stout, J., Tricoli, D. M., Quemada, H. D. & Gonsalves, D. (1996). Post-transcriptional transgene silencing and consequent tospovirus resistance in transgenic lettuce are affected by transgene dosage and plant development.Plant Journal9, 899-909.

Pang, S.-Z., Jan, F.-J. & Gonsalves, D. (1997). Nontarget DNA sequences reduce the transgene length necessary for RNA-mediated tospovirus resistance in transgenic plants.Proceedings of the National Academy of Sciences, USA94, 8261-8266.[Abstract/Free Full Text]

Prins, M. & Goldbach, R. (1996). RNA-mediated virus resistance in transgenic plants.Archives of Virology141, 2259-2276.[Medline]

Prins, M., de Haan, P., Luyten, R., van Veller, M., van Grinsven, M. Q. J. M. & Goldbach, R. (1995). Broad resistance to tospoviruses in transgenic tobacco plants expressing three tospoviral nucleoprotein gene sequences.Molecular Plant–Microbe Interactions8, 85-91.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Seymour, G. B., Fray, R. G., Hill, P. & Tucker, G. A. (1993). Down-regulation of two non-homologous tomato genes with a single chimaeric sense gene construct.Plant Molecular Biology23, 1-9.[Medline]

Shukla, D. D., Ward, C. W. & Brunt, A. A. (1994). The Potyviridae. Wallingford, UK: CAB International.

Stam, M., de Bruin, R., Kenter, S., van der Hoorn, R. A. L., van Blokland, R., Mol, J. N. M. & Kooter, J. M. (1997). Post-transcriptional silencing of chalcone synthase in Petunia by inverted transgene repeats.Plant Journal12, 63-82.

Tomlinson, J. A. (1987). Epidemiology and control of virus diseases of vegetables.Annals of Applied Biology110, 661-681.

Tricoli, D. M., Carney, K. J., Russell, P. F., McMaster, J. R., Groff, D. W., Hadden, K. C., Himmel, P. T., Hubbard, J. P., Boeshore, M. L. & Quemada, H. D. (1995). Field evaluation of transgenic squash containing single or multiple virus coat protein gene constructs for resistance to cucumber mosaic virus, watermelon mosaic virus 2, and zucchini yellow mosaic virus.Bio/Technology13, 1458-1465.

Van Blokland, R., Van der Geest, N., Mol, J. N. M. & Kooter, J. M. (1994). Transgene-mediated suppression of chalcone synthase expression in Petunia hybrida results from an increase in RNA turnover.Plant Journal6, 861-877.

van den Boogaart, T., Lomonossoff, G. P. & Davies, J. W. (1998). Can we explain RNA-mediated virus resistance by homology-dependent gene silencing?Molecular Plant–Microbe Interactions11, 717-723.

Wang, M. & Gonsalves, D. (1990). ELISA detection of various tomato spotted wilt virus isolates using specific antisera to structural proteins of the virus.Plant Disease74, 154-158.

Received 20 January 2000; accepted 10 April 2000.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jan, F.-J.
Right arrow Articles by Gonsalves, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jan, F.-J.
Right arrow Articles by Gonsalves, D.
Agricola
Right arrow Articles by Jan, F.-J.
Right arrow Articles by Gonsalves, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS