J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Billecocq, A.
Right arrow Articles by Bouloy, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Billecocq, A.
Right arrow Articles by Bouloy, M.
Agricola
Right arrow Articles by Billecocq, A.
Right arrow Articles by Bouloy, M.
Journal of General Virology (2000), 81, 2161-2166.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Pathogen-specific resistance to Rift Valley fever virus infection is induced in mosquito cells by expression of the recombinant nucleoprotein but not NSs non-structural protein sequences

A. Billecocq1, M. Vazeille-Falcoz2, F. Rodhain2 and M. Bouloy1

Groupe des Bunyaviridés1 and Unité d’écologie des systèmes vectoriels2, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France

Author for correspondence: Michèle Bouloy. Fax +33 1 40 61 31 51. e-mail mbouloy{at}pasteur.fr


   Abstract
TOP
Abstract
Main text
References
 
Rift Valley fever virus (RVFV) is an arbovirus of the Bunyaviridae family, causing recurrent disease outbreaks in Africa. Natural vertebrate hosts include cattle and humans. Several mosquito species belonging to the Aedes and Culex generaact as vectors of this phlebovirus. To test whether pathogen-derived resistance against RVFV could be induced by expressing genomic sequences in mosquito cells, as has been shown for La Crosse and dengue 2 viruses, we generated various recombinant Semliki Forest viruses expressing the S segment (or its genes) in the genomic or antigenomic sense. Expression of the N but not the NSs gene interfered with the production of RVFV in mosquito cells and this phenomenon was RNA- but not protein-dependent. These results raise questions on the molecular mechanisms involved in virus resistance.


   Main text
TOP
Abstract
Main text
References
 
Rift Valley fever virus (RVFV) is an arbovirus responsible for recurrent disease epidemics and epizootics in Africa (Meegan & Bailey, 1989Down ; Peters & Linthicum, 1994Down ), the most recent of which occurred in Egypt in 1993, Madagascar in 1990–1991, Kenya, Somalia and Tanzania in 1997–1998 and Mauritania in 1998. Natural vertebrate hosts of RVFV include cattle and humans. Mosquito species of the Aedes and Culex genera were reported to be the main vectors in Kenya and Egypt, respectively (Gonzalez-Scarano & Nathanson, 1996Down ). RVFV (family Bunyaviridae, genus Phlebovirus) has a trisegmented RNA genome of negative (L and M segments) or ambisense (S segment) polarity (Giorgi, 1996Down ; Schmaljohn, 1996Down ). The L and M segments code, respectively, for the RNA-dependent RNA polymerase and for a polypeptide which is cleaved during translation, thus generating the envelope glycoproteins G1 and G2 and the nonstructural proteins 14K and 78K. The S segment utilizes an ambisense strategy: the 5' halves of the antigenomic and genomic strands contain, respectively, ORFs encoding the nucleoprotein N and the nonstructural protein NSs.

Homologous interference has been described for several arboviruses: togaviruses (Karpf et al., 1997Down ; Stollar & Shenk, 1973Down ), flaviviruses (Schmaljohn & Blair, 1977Down ), bunyaviruses (Beaty et al., 1983Down ; Elliott & Wilkie, 1986Down ) and RVFV (Turell et al., 1990Down ). More recently, B. J. Beaty’s group has developed recombinant Sindbis virus-based expression systems to produce intracellular immunity or pathogen-derived resistance against La Crosse virus or dengue virus in mosquitoes and in mosquito cells (Gaines et al., 1996Down ; Olson et al., 1996Down ; Powers et al., 1994Down , 1996Down ). Using recombinant Semliki Forest virus (SFV) replicons as a vector, we investigated the possibility of producing mosquito cells resistant to RVFV and showed that homologous interference was induced by N but not NSs sequences and was RNA-mediated. This raises questions on the molecular mechanisms involved in virus resistance.

SFV replicons carrying partial or complete sequences of the RVFV MP12 strain S segment were prepared by inserting the viral sequences into pSFV-1 at the unique SmaI or BamHI site, transcribed in vitro from plasmids linearized at the SpeI site and electroporated into BHK-21 cells together with the Helper 2-RNA to produce suicide particles, as described by Liljeström & Garroff (1991Down , 1995Down ).

To examine the effect of RVFV nucleoprotein sequences on replication of homologous virus we constructed pSFV-N, containing the sequence of the N ORF, and infected Aedes pseudoscutillaris (Ap61) cells with the recombinant SFV-N particles. Infection was monitored by immunofluorescence assay using the anti-SFV nsP3 or an anti-N monoclonal antibody and a fluorescein-labelled secondary antibody. In cells infected at an m.o.i. of 5 and examined at day 2 post-infection (p.i.), more than 80% of the cells exhibited a bright cytoplasmic fluorescence corresponding to the specific distribution of the RVFV N or SFV nsP3 proteins (Fig. 1A, BDown). Of the infected cells 50% were still positive on day 7 and 20% on day 12 p.i. (not shown), but staining was less intense, indicating that the replicons persisted in the cells but were diluted or became inefficient for protein expression as cells proliferated.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 1. Detection of viral proteins and RNAs after infection of Ap61 with recombinant SFV. Cells were infected with SFV-N (A, B) or SFV-NSs (C) at an m.o.i. of 5 or mock-infected (D). After 48 h they were fixed with methanol, incubated with an anti-N (A) or anti-NSs (C) mouse monoclonal antibody (gifts of J. Smith) or rabbit anti-nsP3 serum (B) (gift of L. Kääriäinen), followed by incubation with fluorescein-labelled goat anti-mouse or rabbit IgG (Sigma) and counterstaining with Evans blue. (E) Northern blot analysis of cytoplasmic RNA extracted from Ap61 cells infected for 48 h with SFV-1, SFV-N, SFV-Nanti, SFV-NSs, SFV-Sg or SFV-Sag at an m.o.i. of 5, or mock-infected. A 32P-labelled oligonucleotide complementary to the 5' terminal sequence of the SFV 26S subgenomic RNA (5' CAGAATTCTGTGTATTAACGCACC 3') was used as a probe.

 
At 48 h p.i. cultures infected with SFV-N were superinfected with the RVFV MP12 strain and the virus released into the extracellular medium 4 days later was plaque assayed, a method which titrated only RVFV since the recombinant SFV suicide particles did not produce any infectious virus. Preliminary experiments indicated that the kinetics of MP12 virus production by Ap61 cells showed an exponential curve and reached a plateau 4–5 days p.i. (not shown). When compared to the titre obtained in the mock-infected cells or in cells infected with SFV-1 or SFV-{beta}gal, the yield of MP12 virus in Ap61 cells infected with SFV-N was inhibited more than 1000-fold (Table 1Down). In addition, less than 5% of these superinfected cells exhibited positive staining by immunofluorescence assay (using a mixture of anti-G2 and anti-NSs RVFV-specific monoclonal antibodies on day 4 p.i.) whereas all the control cells were positive (not shown). Optimal conditions for interference were achieved when recombinant SFV and MP12 were used at m.o.i.s of 5 IU (infectious unit) and 0·01 p.f.u. per cell, respectively. Decreasing the m.o.i. of SFV-N to 1 did not significantly reduce the interference level. However, when superinfection with MP12 was carried out at an m.o.i. of 1, the phenomenon still occurred but virus production was inhibited only 10-fold. Interestingly, SFV-1 without insert or SFV-{beta}gal induced a positive interference toward RVFV, which was more pronounced during the first days after infection (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Production of MP12 virus by day 4 p.i. in Ap61 cells pre-infected with various recombinant SFVs expressing RVFV sequences

 
To determine whether interference was due to protein or RNA, pSFV-N was mutated into pSFV-Nstop by changing the initiation codon of the N ORF into a stop codon. Inhibition of MP12 production in Ap61 cells infected with SFV-Nstop was similar to that caused by SFV-N or even more (Table 1Up). Similar interference was observed in cells infected with SFV-Nanti, a replicon expressing the N sequence in the antisense orientation (Table 1Up). These results strongly suggest that the N sequence in sense or antisense orientation but not the protein is responsible for the inhibitory effect.

Because the S segment encodes two proteins in opposite orientations, we investigated the possible effect of the NSs sequences and constructed replicons SFV-NSs and SFV-NSsanti containing the NSs sequences in the sense and antisense orientation, respectively. Fluorescent nuclear filaments, as observed in RVFV infection, were seen in Ap61 cells infected with SFV-NSs (Fig. 1CUp). However, although the amounts of recombinant genomic and subgenomic RNAs estimated by Northern blot analysis were equivalent to those present in SFV-N-infected cells (Fig. 1EUp), expression of NSs sequences in Ap61 cells did not induce any homologous interference (Table 1Up). To eliminate a possible antagonistic effect of NSs protein toward putative inhibition induced by the NSs nucleotide sequence, we mutated the AUG of the initiation codon of SFV-NSs, generating replicon SFV-NSsstop. Infection with this virus did not induce any protection to superinfection by MP12 (Table 1Up), confirming that the NSs gene possesses no interfering potential.

Since the 3' and 5' halves of the S segment induced different effects on intracellular immunity, we tested the effect of complete S segment expression by generating SFV-Sg and SFV-Sag. Cells infected with SFV-Sag were resistant to MP12 infection to the same degree as cells infected with SFV-N but interference was significantly lower in cells expressing the S segment in the genomic orientation (Table 1Up). The degree of inhibition induced by SFV-Sg and SFV-Sag was not due to different amounts of RNAs synthesized by the recombinant SFVs, as revealed by Northern blot (Fig. 1EUp); increasing the m.o.i. of SFV-Sg to 20 IU per cell had no effect.

To address the question of whether the observed interference due to the N sequence of RVFV was restricted to the homologous virus or could be extended to other viruses, we challenged SFV-N-infected Ap61 cells with the heterologous RVFV Clone 13, the related virus Toscana phlebovirus, and the unrelated Germiston bunyavirus and yellow fever flavivirus (17D strain). A similar experiment with SFV-Nanti led to similar results. Pre-infection with SFV-N inhibited Clone 13 replication although to a lesser extent than MP12 (Table 2Down). Interestingly, the sequences encoding the N protein of Clone 13 and MP12 share 97·8% identity [16 mutations over 736 nucleotides (Müller et al., 1995Down )]. If intracellular immunity involves hybridization between the inducer and challenge RNAs, the fact that Clone 13 partially overcomes the resistance induced by the N sequences is likely to be due to an increased level of replication compared to MP12, a property repeatedly observed in cells infected with Clone 13. The sequences of RVFV N protein did not induce resistance toward Germiston or yellow fever viruses but resulted in a slightly reduced yield of Toscana virus (Table 2Down), the progeny of which contained a considerable amount of a small plaque variant when compared to the progeny grown in control cells. This result indicates that the related Toscana virus, sharing 59% identity, was inhibited to some extent by the RVFV N sequences. A similar observation was reported by Powers et al. (1996)Down who showed that La Crosse bunyavirus sequences, too, had an effect on the production of the related Trivittatus virus (62% identity).


View this table:
[in this window]
[in a new window]
 
Table 2. Heterologous interference in cells expressing MP12 RVFV sequences via infection with SFV-N or SFV-Nanti

 
In summary, expression of RNA molecules derived from the S segment of the RVFV MP12 genome in Ap61 cells showed that N, but not NSs, RNA molecules interfere with replication of the homologous virus. Interference was induced by RNA molecules in both orientations and was independent of protein expression. Using recombinant Sindbis virus to induce resistance against La Crosse virus, Powers et al. (1994Down , 1996Down ) reported a major effect of the N sequences and, concerning the role of the NSs sequence, the antisense orientation was found to interfere with the virus yield but the sense orientation could not be tested because expression of the protein was toxic for the cells. This is in contrast with the situation observed with the RVFV NSs sequences which did not interfere in any orientation. It is noteworthy that the S organization of bunyaviruses and phleboviruses is different: the N and NSs ORFs are in the same orientation and overlap in bunyaviruses whereas they are in opposite orientations and do not overlap in phleboviruses. Thus, since the N sequence of La Crosse virus inhibits virus production, the specific region corresponding to NSs would also be expected to interfere unless it is too short, a situation reported for tospoviruses where the inducer RNA must have a minimal size (Jan et al., 2000Down ). Although some sequences of La Crosse virus M segment (Powers et al., 1996Down ) or the L segment of RVFV (not shown) were also inefficient for interference, the fact that 5' and 3' regions of the S segment lead to a different effect is intriguing and raises questions on the molecular mechanisms involved in resistance. Since, when it occurs, the phenomenon is RNA-mediated, RNA duplexes between the RNA inducer and the targeted viral RNAs might be formed, blocking translation, replication, transcription or RNP formation, depending on the sense of the expressed RNA. If RVFV NSs is an accessory protein as suggested (Kohl et al., 1999Down ; Vialat et al., 2000Down ), inhibition of its translation by SFV-NSsanti would not have major consequences and would not cause interference. However, the NSs RNA could also hybridize with the genome (or with the antigenome in cells expressing SFV-NSs and SFV-NSsstop) and be expected to block transcription/replication or encapsidation. Obviously, this is not the case and it is difficult to understand why this inhibition occurs with the N sequences and not with the NSs sequences. As data accumulate on virus resistance and on post-transcriptional gene silencing in plants, fungi and higher organisms, it would be tempting to assume that interference in mosquito cells results from similar mechanisms (Baulcombe, 1999Down ; Cogoni & Macino, 1999Down ; Fire, 1999Down ; Hunter, 2000Down ; Waterhouse et al., 1998Down ). As in plants, synthesis of recombinant RNA may trigger degradation of the target viral RNA through the possible action of double-stranded targeted RNases or synthesis of RNases similar to the vertebrate RNase L, directly or after amplification by an RNA-dependent RNA polymerase. At the moment, we cannot explain why NSs sequences have no effect. In plants also, there exist sequences such as the 5' region of the {beta}-glucuronidase gene (English et al., 1996Down ) or the cowpea mosaic virus movement protein (Sijen et al., 1996Down ) which do not induce gene silencing or virus resistance. Numerous reports have emphasized the importance of double-stranded RNA, injected into cells [Fire (1999)Down and references cited], generated by transgenes containing sense and antisense sequences in fold-back configuration (Waterhouse et al., 1998Down ), or synthesized as replicative forms during replication of recombinant RNA viruses (Angell & Baulcombe, 1997Down ; Dalmay et al., 2000Down ), in the induction of gene silencing in plant and higher organisms. Here, the replicative forms synthesized via the SFV-NSs replicon might not be efficient enough to provoke interference. To test a possible role of an RNA duplex, we co-infected cells with the recombinants SFV-NSs and SFV-NSsanti but did not find any resistance (not shown), indicating that the double-stranded RNA is not a sufficient signal. Further experiments will be necessary to determine the mechanism involved in induction of resistance to RVFV.

In their studies, B. J. Beaty and colleagues utilized recombinant Sindbis viruses to express La Crosse or dengue virus sequences and showed that mosquito cells as well as mosquitoes were resistant to homologous infection (Olson et al., 1996Down ; Powers et al., 1996Down ). Here, for biosafety we used SFV suicide particles to orally infect Aedes aegypti mosquitoes but unfortunately, we were unable to detect replicon-driven expression probably because a very small number of cells had been infected. A replicative vector efficient for oral infection would be necessary to test the interfering effect in mosquitoes.


   Acknowledgments
 
We thank Drs J. Smith (Fort Detrick, MD, USA) and L. Kääriäinen (University of Helsinki, Finland) for kindly providing antibodies.


   References
TOP
Abstract
Main text
References
 
Angell, S. M. & Baulcombe, D. C. (1997). Consistent gene silencing in transgenic plants expressing a replicating potato virus X RNA.EMBO Journal16, 3675-3684.[Medline]

Baulcombe, D. (1999). Viruses and gene silencing in plants.Archives of Virology Supplementum15, 189-201.[Medline]

Beaty, B. J., Bishop, D. H., Gay, M. & Fuller, F. (1983). Interference between bunyaviruses in Aedes triseriatus mosquitoes.Virology127, 83-90.[Medline]

Cogoni, C. & Macino, G. (1999). Homology-dependent gene silencing in plants and fungi: a number of variations on the same theme. Current Opinion in Microbiology2, 657-662.[Medline]

Dalmay, T., Hamilton, A., Mueller, E. & Baulcombe, D. C. (2000). Potato virus X amplicons in Arabidopsis mediate genetic and epigenetic gene silencing.Plant Cell12, 369-379.[Abstract/Free Full Text]

Elliott, R. M. & Wilkie, M. L. (1986). Persistent infection of Aedes albopictus C6/36 cells by Bunyamwera virus. Virology150, 21-32.[Medline]

English, J. J., Mueller, E. & Baulcombe, D. C. (1996). Suppression of virus accumulation in transgenic plants exhibiting silencing of nuclear genes.Plant Cell8, 179-188.[Abstract]

Fire, A. (1999). RNA-triggered gene silencing. Trends in Genetics15, 358-363.[Medline]

Gaines, P. J., Olson, K. E., Higgs, S., Powers, A. M., Beaty, B. J. & Blair, C. D. (1996). Pathogen-derived resistance to dengue type 2 virus in mosquito cells by expression of the premembrane coding region of the viral genome.Journal of Virology70, 2132-2137.[Abstract]

Giorgi, C. (1996). Molecular biology of phlebovirus. In The Bunyaviridae, pp. 105-128. Edited by R. M. Elliott. New York: Plenum Press.

Gonzalez-Scarano, F. & Nathanson, N. (1996). Bunyaviridae. In Fields Virology, pp. 1473-1504. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Hunter, C. P. (2000). Gene silencing: shrinking the black box of RNAi.Current Biology10, R137-R140.[Medline]

Jan, F. J., Fagoaga, C., Pang, S. Z. & Gonsalves, D. (2000). A minimum length of N gene sequence in transgenic plants is required for RNA-mediated tospovirus resistance.Journal of General Virology81, 235-242.[Abstract/Free Full Text]

Karpf, A. R., Lenches, E., Strauss, E. G., Strauss, J. H. & Brown, D. T. (1997). Superinfection exclusion of alphaviruses in three mosquito cell lines persistently infected with Sindbis virus.Journal of Virology71, 7119-7123.[Abstract]

Kohl, A., di Bartolo, V. & Bouloy, M. (1999). The Rift Valley fever virus nonstructural protein NSs is phosphorylated at serine residues located in casein kinase II consensus motifs in the carboxy-terminus. Virology263, 517-525.[Medline]

Liljeström, P. & Garoff, H. (1991). A new generation of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnology9, 1356-1361.[Medline]

Liljeström, P. & Garoff, H. (1995). Expression of proteins using Semliki Forest virus vectors. In Current Protocols in Molecular Biology, pp. 16.20.1–16.20.16. Edited by F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith & K. Struhl. New York: Wiley.

Meegan, J. M. & Bailey, C. J. (1989). Rift Valley fever. In The Arboviruses: Epidemiology and Ecology, pp. 51-76. Edited by T. P. Monath. Boca Raton, FL: CRC Press.

Müller, R., Saluzzo, J. F., Lopez, N., Dreier, T., Turell, M., Smith, J. & Bouloy, M. (1995). Characterization of clone 13, a naturally attenuated avirulent isolate of Rift Valley fever virus, which is altered in the small segment.American Journal of Tropical Medicine and Hygiene53, 405-411.

Olson, K. E., Higgs, S., Gaines, P. J., Powers, A. M., Davis, B. S., Kamrud, K. I., Carlson, J. O., Blair, C. D. & Beaty, B. J. (1996). Genetically engineered resistance to dengue-2 virus transmission in mosquitoes. Science272, 884-886.[Abstract]

Peters, C. J. & Linthicum, K. J. (1994). Rift Valley fever. In Handbook of Zoonoses, section B, Viral, pp. 125-138. Edited by G. W. Beron & J. H. Steele. Boca Raton, FL: CRC Press.

Powers, A. M., Olson, K. E., Higgs, S., Carlson, J. O. & Beaty, B. J. (1994). Intracellular immunization of mosquito cells to La Crosse virus using a recombinant Sindbis virus vector.Virus Research32, 57-67.[Medline]

Powers, A. M., Kamrud, K. I., Olson, K. E., Higgs, S., Carlson, J. O. & Beaty, B. J. (1996). Molecularly engineered resistance to California serogroup virus replication in mosquito cells and mosquitoes.Proceedings of the National Academy of Sciences, USA93, 4187-4191.[Abstract/Free Full Text]

Schmaljohn, C. S. (1996). Bunyaviridae: the viruses and their replication. In Fields Virology, pp. 1447-1471. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Schmaljohn, C. & Blair, C. D. (1977). Persistent infection of cultured mammalian cells by Japanese encephalitis virus. Journal of Virology24, 580-589.[Abstract/Free Full Text]

Sijen, T., Wellink, J., Hiriart, J. B. & Kammen, A. V. (1996). RNA-mediated virus resistance: role of repeated transgenes and delineation of targeted regions.Plant Cell8, 2277-2294.[Abstract]

Stollar, V. & Shenk, T. E. (1973). Homologous viral interference in Aedes albopictus cultures chronically infected with Sindbis virus.Journal of Virology11, 592-595.[Abstract/Free Full Text]

Turell, M. J., Saluzzo, J. F., Tammariello, R. F. & Smith, J. F. (1990). Generation and transmission of Rift Valley fever viral reassortants by the mosquito Culex pipiens.Journal of General Virology71, 2307-2312.[Abstract/Free Full Text]

Vialat, P., Billecocq, A., Kohl, A. & Bouloy, M. (2000). The S segment of Rift Valley fever phlebovirus (Bunyaviridae) carries determinants for attenuation and virulence in mice.Journal of Virology74, 1538-1543.[Abstract/Free Full Text]

Waterhouse, P. M., Graham, M. W. & Wang, M. B. (1998). Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA.Proceedings of the National Academy of Sciences, USA95, 13959-13964.[Abstract/Free Full Text]

Received 5 May 2000; accepted 19 June 2000.


This article has been cited by other articles:


Home page
J. Virol.Home page
G. Attarzadeh-Yazdi, R. Fragkoudis, Y. Chi, R. W. C. Siu, L. Ulper, G. Barry, J. Rodriguez-Andres, A. A. Nash, M. Bouloy, A. Merits, et al.
Cell-to-Cell Spread of the RNA Interference Response Suppresses Semliki Forest Virus (SFV) Infection of Mosquito Cell Cultures and Cannot Be Antagonized by SFV
J. Virol., June 1, 2009; 83(11): 5735 - 5748.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Garcia, A. Billecocq, J.-M. Crance, U. Munderloh, D. Garin, and M. Bouloy
Nairovirus RNA Sequences Expressed by a Semliki Forest Virus Replicon Induce RNA Interference in Tick Cells
J. Virol., July 15, 2005; 79(14): 8942 - 8947.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. Andersson, L. Bladh, M. Mousavi-Jazi, K.-E. Magnusson, A. Lundkvist, O. Haller, and A. Mirazimi
Human MxA Protein Inhibits the Replication of Crimean-Congo Hemorrhagic Fever Virus
J. Virol., April 15, 2004; 78(8): 4323 - 4329.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Geib, C. Sauder, S. Venturelli, C. Hassler, P. Staeheli, and M. Schwemmle
Selective Virus Resistance Conferred by Expression of Borna Disease Virus Nucleocapsid Components
J. Virol., April 1, 2003; 77(7): 4283 - 4290.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
H. Li, W. X. Li, and S. W. Ding
Induction and Suppression of RNA Silencing by an Animal Virus
Science, May 17, 2002; 296(5571): 1319 - 1321.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Billecocq, A.
Right arrow Articles by Bouloy, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Billecocq, A.
Right arrow Articles by Bouloy, M.
Agricola
Right arrow Articles by Billecocq, A.
Right arrow Articles by Bouloy, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS