|
|
||||||||
Animal: DNA Viruses |
Hepatitis and Retrovirus Laboratory, Central Public Health Laboratory, 61 Colindale Avenue, London NW9 5HT, UK1
The Liver Unit, Birmingham Childrens Hospital, Whittal Street, Birmingham B4 6NH, UK2
Author for correspondence: Rachel Hallett. Fax +44 20 8200 1569. e-mail rachel.hallett{at}virgin.net
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
TTV was initially reported to share some physical characteristics with the Parvoviridae, although no nucleotide similarity was demonstrated. A resemblance between TTV and chicken anaemia virus (CAV), a circovirus, has been described by Takahashi et al. (1998a)
on the basis of arginine-rich regions in the open reading frames (ORFs) from both viruses, and on similarities in their genomic arrangements (Miyata et al., 1999
). However, no significant sequence similarity to any other member of the Circoviridae has been shown, and this has led Mushahwar et al. (1999)
to propose that TTV be placed in a new virus family called Circinoviridae. Recently, three novel human DNA virus sequences (CBD203, CBD231 and CBD279) have been described that appear to be intermediately related to TTV and CAV (Takahashi et al., 2000
). They have been named TTV-like mini virus (TLMV). It is not clear from these reports whether TTV, CAV and TLMV belong to one family of viruses.
Considerable genetic variability of TTV has been demonstrated, with a 222 bp fragment of the genome from the longest ORF (ORF-1) showing as much as 65% divergence between sequences. Several groups have assigned up to 16 genotypes based on the sequence variability in short TTV PCR products (Tanaka et al., 1998
; Okamoto et al., 1999b
). In contrast, phylogenetic analysis of full-length or near full-length TTV sequences reveals division into three main types, represented by the prototype TA278 in group 1, US35 in group 2 and JA10 in group 3 (Erker et al., 1999
). Most of the sequence variability occurs in the coding regions. In addition to these three TTV groups there are two other highly divergent complete sequences, TUS01 and SANBAN (Okamoto et al., 1999b
; Hijikata et al., 1999
).
In this study we have sequenced the full genome of another TTV-like virus, named PMV, with a view to characterizing its genetic organization and to ascertaining its taxonomic status. We have also conducted a survey of its prevalence.
| Methods |
|---|
|
|
|---|
Specimens.
DNA extraction.
DNA was extracted from serum (100 µl volumes) by a guanidinium thiocyanatesilica method (Boom et al., 1990
). DNA was also extracted from paraffin-embedded liver biopsy samples by sequential treatments with Tween 20, proteinase K, Chelex-100 and chloroform, as described by Coombs et al. (1999)
.
PCR.
A semi-nested PCR was used to amplify part of ORF-1 as previously described (Okamoto et al., 1998
). A PCR using primers located within the conserved non-coding region (set B; Leary et al., 1999
) was also used. All positive PCR products were gel-purified and sequenced as described below.
PCR product cloning and sequencing.
PCR products were recovered from 2% agarose gels after staining with ethidium bromide and visualization under UV, and were purified with an Igenie DNA Extraction Kit (Helena BioSciences). They were sequenced in both directions using an ABI Prism DNA Sequencing Kit and an ABI 373 automated sequencer (PE Applied Biosystems). ORF-1 PCR products were cloned using an Invitrogen TOPO TA Cloning Kit and colony PCRs performed using the TTV-specific inner primers NG061 and NG063 (Okamoto et al., 1998
). Ten colony PCR products from each sample were sequenced.
PMV genome sequencing.
PCR products covering the whole genome were generated using an Expand High Fidelity PCR System (Roche Diagnostics) according to the manufacturers protocol for amplification of products up to 3 kb, and with a Clontech Advantage-GC 2 PCR kit. All PCRs were carried out in a 50 µl volume. First or single round PCRs contained 10 µl of extracted DNA as template; second round PCRs used 2 µl of first round product. The PCR primers used to generate the entire PMV genome sequence were: for fragment A, T801 and NG063 (Takahashi et al., 1998b
; Okamoto et al., 1998
); for fragment B, NG059, NG061 and BR1 (Okamoto et al., 1998
; Leary et al., 1999
); for fragment C, first round sense INV1 (5' CCTTACAGACACCCCTTACTACCCT), first round antisense INV2 (5' CAGTGGCACTTTCCTTTTCTTTC), and second round sense INV3 (5' ACTAAGCACTCCGAGCGAAGC) with second round antisense INV4 (5' ATAACCCTAAGAGCCTTGCCCATAG).
The positions of the three PCR products are indicated in Fig. 1
. All three were cloned using an Invitrogen TOPO TA Cloning Kit. Plasmid DNA containing the inserted PCR products was purified using a QIAfilter Plasmid Midi Kit (Qiagen) and sequencing was carried out by Cambridge Bioscience. The resulting three fragments were assembled using programs EditSeq and MegAlign in the Lasergene Navigator package (Dnastar) to give the complete genome sequence of 3736 nucleotides.
|
Sequence analysis.| Results |
|---|
|
|
|---|
Genome analysis
The entire genome of PMV was sequenced by producing three overlapping PCR products, as shown in Fig. 1
. PCR products A and B were generated with standard long-range amplification conditions. However, PCR product C was not amplifiable this way due to the presence of a GC-rich region in the template DNA, and a PCR under conditions specific for GC templates was necessary to amplify this fragment (see Methods). A database homology search was carried out using the nucleotide sequence of the PMV genome. It did not reveal any significant nucleotide similarity between the PMV sequence and other sequences, other than TTV sequences.
In a comparison with full or near full-length TTV genomes it was found that PMV shared characteristics, including the positions of ORFs 1 and 2 and the non-coding regions, a GC-rich string of bases and a TATA box (Fig. 1
). A polyadenylation signal (AATAAA), starting at position 3028 in PMV, was found in all full and near full-length genomes with the exception of SANBAN (Hijikata et al., 1999
).
Open reading frames
The longest ORF, ORF-1, of the PMV genome encodes 767 amino acids and has an average amino acid identity of only 31·1% with the corresponding ORFs of other TTVs. It has an N-terminal arginine-rich region, noted previously in other TTVs (Takahashi et al., 1998a
). When the amino acid sequence of ORF-1 was used to BLAST search the SWISS-PROT database, 37% identity to a cuttlefish protamine protein (PRT2 SEPOF) was revealed.
A shorter ORF, ORF-2, was found in PMV, but again there was a high degree of sequence divergence from other TTVs, the average amino acid identity being 32·7%. The sequence motif (ACCATGG) containing the initiation codon of ORF-1 in PMV had a single nucleotide difference from that described by Kozak (1986)
as the optimal sequence for translation initiation. The ORF-2 initiation motif had two suboptimal nucleotides. Conserved Sp1 (GGCGGG) and Cap (CAATTC) sites, immediately upstream of the ORF-2 initiation codon, were also present in the PMV genome (Hijikata et al., 1999
).
The putative ORF-3 proposed by Erker et al. (1999)
was 165 nucleotides long in PMV. However, it overlapped with the C-terminal end of ORF-1 by 40 nucleotides, a feature not seen in TTV genome sequences so far described. Erker et al. (1999)
reported ORF-3 to be highly conserved, but when the full or near full-length TTV sequences from their study were analysed with sequences TUS01, SANBAN and PMV, ORF-3 was revealed to be variable. The average amino acid sequence identity between PMV and these ORF-3 sequences was 46·3%. The Kozak initiation motif was not identified at the start codon in PMV.
Non-coding region
A conserved non-coding region was found to stretch from the polyadenylation signal to the initiation codon of ORF-2, encompassing the GC-rich region. Comparisons were carried out between PMV and five full-length TTV sequences (TA278, JA20, US35, TUS01 and SANBAN). For four of these, the non-coding region was about 1040 nucleotides long; in TUS01 it was shorter at 1014 nucleotides. The equivalent region in PMV was only 972 nucleotides long, the most noticeable truncation being in the GC-rich region, which was 58 nucleotides in length compared to 117 in the prototype TTV genome TA278 (Miyata et al., 1999
). The average nucleotide identity between PMV and the five analysed sequences in this region was 69·8%.
Hijikata et al. (1999)
proposed that the domain immediately downstream of the polyadenylation signal in the non-coding region of TTV forms a stemloop structure. The corresponding region in PMV, analysed in this way, predicted a secondary structure that was very similar to the TTV structure (Fig. 2a
). By contrast, the secondary structure of the GC-rich region of the PMV genome is likely to be affected by deletions: Fig. 2(b)
shows how the GC-rich region of PMV might be different from the GC-rich stretch in isolates TA278 and TUS01 (Okamoto et al., 1999b
).
|
|
|
|
| Discussion |
|---|
|
|
|---|
The non-coding region is relatively conserved, suggesting that it plays an important regulatory role in virus replication. The effect that the truncated GC-rich stretch may have on the replication of PMV is yet to be determined.
Representative full-length and near full-length genomes of TTV-like viruses fall into six major groups on phylogenetic analysis, with an average genetic distance of 0·48 between them (Fig. 4
). The groupings observed on analysis of the overlapping nucleotide sequences are also seen when the amino acid sequences of ORF-1 are aligned (data not shown). The six groups correspond to the previously defined groups 1a (the prototype TA278) and 1b (JA20), 2 (US35) and 3 (JA10) (Erker et al., 1999
), with TUS01, SANBAN and PMV forming three new branches. Following the nomenclature of Erker et al. (1999)
, TUS01, SANBAN and PMV could be considered new genotypes. However, the level of genetic divergence within the TTV cluster is higher than would be expected if all these sequences were from viruses of the same species. Several groups have postulated a genotyping system based on the phylogenetic analysis of short PCR products (Tanaka et al., 1998
; Okamoto et al., 1999a
; Mulyanto et al., 2000
). The analysis presented here, using full and near full-length genomes, suggests that until the full extent of divergence within the TTVs is known, it is premature to classify short TTV-like sequences in this way. The possibility that further divergent genomes remain to be discovered cannot be excluded.
Several groups have reported short stretches of sequence similarity between TTV and CAV (Miyata et al., 1999
; Hijikata et al., 1999
). Furthermore, TLMV was recently discovered in human serum and reported as an intermediate relative of TTV and CAV (Takahashi et al., 2000
). In order to further assess the relationships between these viruses, we compared representative TTV sequences, a CAV genome and a TLMV genome (Fig. 5
). Phylogenetic analysis shows that six lineages can be discerned: the lineage to which the TTV cluster of groups 1, 2 and 3 belongs, and five others (PMV, SANBAN, TLMV, TUS01 and CAV).
The Circoviridae has recently been divided into two genera: Gyrovirus, containing CAV; and Circovirus, with porcine circovirus (PCV) and beak and feather disease virus (BFDV) as members (Pringle, 1999
). Although there is very little sequence similarity between them, individual isolates of each virus are moderately conserved; for example, the maximum divergence shown between six full-length CAV genomes, available in GenBank, was 5% (not shown). By this criterion, TUS01, SANBAN, PMV and TLMV individually, and TA278, JA20, US35 and JA10 as a cluster, should have equal taxonomic rank with each other and with the Gyrovirus and Circovirus genera of Circoviridae.
Although TTV was initially considered a hepatitis virus, this is not yet substantiated. PMV may be hepatotropic as its sequence was also detected in liver, but since a pre-hepatitis serum specimen from the patient was not available we were unable to determine if PMV infection was associated with onset of disease. It is noted that circoviruses showing less sequence divergence than the TTV group can cause different clinical syndromes. For example, a strain of PCV, reported to be associated with a disease in pigs known as postweaning multisystemic wasting syndrome, shows only 26% divergence from the genome of the prototype PCV, which is common in domestic herds and apparently does not cause disease (Morozov et al., 1998
).
Further study is required to unravel the precise evolutionary and taxonomic connections between the circular single-stranded genomes examined here. While PMV may be unique genetically and might be hepatotropic, it appears to be a rare virus in humans. The emerging pattern of infection with TTV-like viruses is that of a collection of related but different viruses, with varying prevalences. Their pathogenic potential has yet to be elucidated.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E. & van der Noordaa, J. (1990). Rapid and simple method for purification of nucleic acids.Journal of Clinical Microbiology28, 495-503.
Coombs, N. J., Gough, A. C. & Primrose, J. N. (1999). Optimization of DNA and RNA extraction from archival formalin-fixed tissue.Nucleic Acids Research27, 12-14.
Erker, J. C., Leary, T. P., Desai, S. M., Chalmers, M. L. & Mushahwar, I. K. (1999). Analyses of TT virus full-length genomic sequences.Journal of General Virology80, 1743-1750.[Abstract]
Felsenstein, J. (1993). PHYLIP (phylogeny inference package) v3.5c. Department of Genetics, University of Washington, Seattle, USA.
Hijikata, M., Takahashi, K. & Mishiro, S. (1999). Complete circular DNA genome of a TT virus variant (isolate name SANBAN) and 44 partial ORF2 sequences implicating a great degree of diversity beyond genotypes.Virology260, 17-22.[Medline]
Jaeger, J. A., Turner, D. H. & Zuker, M. (1989). Improved predictions of secondary structures for RNA.Proceedings of the National Academy of Sciences, USA86, 7706-7710.
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.Cell44, 283-292.[Medline]
Leary, T. P., Erker, J. C., Chalmers, M. L., Desai, S. M. & Mushahwar, I. K. (1999). Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals.Journal of General Virology80, 2115-2120.
Miyata, H., Tsunoda, H., Kazi, A., Yamada, A., Khan, M. A., Murakami, J., Kamahora, T., Shiraki, K. & Hino, S. (1999). Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus.Journal of Virology73, 3582-3586.
Morozov, I., Sirinarumitr, T., Sorden, S. D., Halbur, P. G., Morgan, M. K., Yoon, K.-J. & Paul, P. S. (1998). Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome.Journal of Clinical Microbiology36, 2535-2541.
Mulyanto, M., Hijikata, M., Matsushita, M., Ingkokusmo, G., Widjaya, A., Sumarsidi, D., Kanai, K., Ohta, Y. & Mishiro, S. (2000). TT virus (TTV) genotypes in native and non-native prostitutes of Irian Jaya, Indonesia: implication for non-occupational transmission.Archives of Virology145, 63-72.[Medline]
Mushahwar, I. K., Erker, J. C., Muerhoff, A. S., Leary, T. P., Simons, J. N., Birkenmeyer, L. G., Chalmers, M. L., Pilot-Matias, T. J. & Desai, S. M. (1999). Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans.Proceedings of the National Academy of Sciences, USA96, 3177-3182.
Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1997). A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology.Biochemical and Biophysical Research Communications241, 92-97.[Medline]
Nishizawa, T., Okamoto, H., Tsuda, F., Aikawa, T., Sugai, Y., Konishi, K., Akahane, Y., Ukita, M., Tanaka, T., Miyakawa, Y. & Mayumi, M. (1999). Quasispecies of TT virus (TTV) with sequence divergence in hypervariable regions of the capsid protein in chronic TTV infection.Journal of Virology73, 9604-9608.
Okamoto, H., Akahane, Y., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1998). Fecal excretion of a nonenveloped DNA virus (TTV) associated with posttransfusion non A-G hepatitis.Journal of Medical Virology56, 128-132.[Medline]
Okamoto, H., Takahashi, M., Nishizawa, T., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1999a). Marked heterogeneity and frequent mixed infection of TT virus demonstrated by PCR with primers from coding and noncoding regions.Virology259, 428-436.[Medline]
Okamoto, H., Nishizawa, T., Ukita, M., Takahashi, M., Fukuda, M., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1999b). The entire nucleotide sequence of a TT virus isolate from the United States (TUS01): comparison with reported isolates and phylogenetic analysis.Virology259, 437-448.[Medline]
Page, R. D. M. (1996). Treeview: an application to display phylogenetic trees on personal computers.Computer Applications in the Biosciences 12, 357-358.
Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison.Proceedings of the National Academy of Sciences, USA85, 2444-2448.
Pringle, C. L. (1999). Virus taxonomy at the XIth International Congress of Virology, Sydney, Australia, 1999.Archives of Virology144, 2065-2068.[Medline]
Takahashi, K., Ohta, Y. & Mishiro, S. (1998a). Partial ~2·4-kb sequences of TT virus (TTV) genome from eight Japanese isolates: diagnostic and phylogenetic implications.Hepatology Research12, 111-120.
Takahashi, K., Hoshino, H., Ohta, Y., Yoshida, N. & Mishiro, S. (1998b). Very high prevalence of TT virus (TTV) infection in general population of Japan revealed by a new set of PCR primers.Hepatology Research12, 233-239.
Takahashi, K., Iwasa, Y., Hijikata, M. & Mishiro, S. (2000). Identification of a new human DNA virus (TTV-like mini virus: TLMV) intermediately related to TT virus and chicken anaemia virus. Archives of Virology (in press).
Tanaka, Y., Mizokami, M., Orito, E., Ohno, T., Nakano, T., Kato, T., Kato, H., Mukaide, M., Park, Y.-M., Kim, B.-S. & Ueda, R. (1998). New genotypes of TT virus (TTV) and a genotyping assay based on restriction fragment length polymorphism.FEBS Letters437, 201-206.[Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Research22, 4673-4680.
Received 15 May 2000;
accepted 19 June 2000.
This article has been cited by other articles:
![]() |
M. Ninomiya, T. Nishizawa, M. Takahashi, F. R. Lorenzo, T. Shimosegawa, and H. Okamoto Identification and genomic characterization of a novel human torque teno virus of 3.2 kb J. Gen. Virol., July 1, 2007; 88(7): 1939 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Maggi, E. Andreoli, L. Lanini, S. Meschi, J. Rocchi, C. Fornai, M. L. Vatteroni, M. Pistello, and M. Bendinelli Rapid Increase in Total Torquetenovirus (TTV) Plasma Viremia Load Reveals an Apparently Transient Superinfection by a TTV of a Novel Group 2 Genotype. J. Clin. Microbiol., July 1, 2006; 44(7): 2571 - 2574. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Hu, M. I. Al-Moslih, M. T. Al Ali, S. R. Khameneh, H. Perkins, F. Diaz-Mitoma, J. N. Roy, S. Uzicanin, and E. G. Brown Molecular Detection Method for All Known Genotypes of TT Virus (TTV) and TTV-Like Viruses in Thalassemia Patients and Healthy Individuals J. Clin. Microbiol., August 1, 2005; 43(8): 3747 - 3754. [Full Text] [PDF] |
||||
![]() |
F. Maggi, M. Pifferi, C. Fornai, E. Andreoli, E. Tempestini, M. Vatteroni, S. Presciuttini, S. Marchi, A. Pietrobelli, A. Boner, et al. TT Virus in the Nasal Secretions of Children with Acute Respiratory Diseases: Relations to Viremia and Disease Severity J. Virol., February 15, 2003; 77(4): 2418 - 2425. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Okamoto, M. Takahashi, T. Nishizawa, A. Tawara, K. Fukai, U. Muramatsu, Y. Naito, and A. Yoshikawa Genomic characterization of TT viruses (TTVs) in pigs, cats and dogs and their relatedness with species-specific TTVs in primates and tupaias J. Gen. Virol., June 1, 2002; 83(6): 1291 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Okamoto, T. Nishizawa, M. Takahashi, A. Tawara, Y. Peng, J. Kishimoto, and Y. Wang Genomic and evolutionary characterization of TT virus (TTV) in tupaias and comparison with species-specific TTVs in humans and non-human primates J. Gen. Virol., September 1, 2001; 82(9): 2041 - 2050. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |