J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Niekerk, M.
Right arrow Articles by Huismans, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Niekerk, M.
Right arrow Articles by Huismans, H.
Agricola
Right arrow Articles by van Niekerk, M.
Right arrow Articles by Huismans, H.
Journal of General Virology (2001), 82, 149-158.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Variation of African horsesickness virus nonstructural protein NS3 in southern Africa

M. van Niekerk1, V. van Staden1, A. A. van Dijk2 and H. Huismans1

Department of Genetics, Faculty of Biological and Agricultural Sciences, University of Pretoria, Lunnon Road, Hillcrest, Pretoria 0002, South Africa1
Biochemistry Division, Onderstepoort Veterinary Institute, Onderstepoort 0110, South Africa2

Author for correspondence: H. Huismans. Fax +27 12 3625327. e-mail hhuisman{at}postino.up.ac.za


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
NS3 protein sequences of recent African horsesickness virus (AHSV) field isolates, reference strains and current vaccine strains in southern Africa were determined and compared. The variation of AHSV NS3 was found to be as much as 36·3% across serotypes and 27·6% within serotypes. NS3 proteins of vaccine and field isolates of a specific serotype were found to differ between 2·3% and 9·7%. NS3 of field isolates within a serotype differed up to 11·1%. Our data indicate that AHSV NS3 is the second most variable AHSV protein, the most variable being the major outer capsid protein, VP2. The inferred phylogeny of AHSV NS3 corresponded well with the described NS3 phylogenetic clusters. The only exception was AHSV-8 NS3, which clustered into different groups than previously described. No obvious sequence markers could be correlated with virulence. Our results suggest that NS3 sequence variation data could be used to distinguish between field isolates and live attenuated vaccine strains of the same serotype.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
African horsesickness virus (AHSV) is the aetiological agent of African horsesickness (AHS), a noncontagious, Culicoides-transmitted disease of equids. AHS is one of the most lethal of horse diseases and has been allocated Office International des Epizooties (OIE) List A status. The disease is enzootic in eastern and central Africa and occurs regularly throughout sub-Saharan Africa (Coetzer & Erasmus, 1994Down ). Sporadic outbreaks have occurred in Spain, North Africa and the Middle East (Mellor, 1993Down ). Donkeys in southern Africa are more resistant to AHS than horses (Coetzer & Erasmus, 1994Down ). Four distinct clinical presentations of AHS have been described, each associated with a specific pathogenesis and mortality ranging between 95% (pulmonary form) to 0% (fever form). The most common form is, however, the mixed pulmonary and cardiac form that approaches a mortality rate of 70%. There are nine AHSV serotypes (McIntosh, 1956Down ; Howell, 1962Down ). Several serotypes circulate every season with zebras often harbouring multiple serotypes at a given time (Barnard, 1993Down ). The clinical form of the disease expressed is not dependent on the serotype of the virus and the basis for AHS virulence is poorly understood (Laegreid et al., 1993Down ). The disease does not only have a large impact on the export of horses from South Africa, but also affects the export of zebras to international conservation reserves (Lubroth, 1988Down ).

AHSV is a member of the family Reoviridae, genus Orbivirus, of which bluetongue virus (BTV) is the prototype member. The virion consists of a double-layered protein coat. The outer capsid (VP2 and VP5) probably mediates infection of mammalian cells, while the inner core (VP3 and VP7) remains intact inside infected cells as a replication complex. The viral genome has ten double-stranded (ds)RNA genome segments that encode at least seven structural (designated VP1 to VP7) and four nonstructural (designated NS1, NS2, NS3 and NS3A) proteins (reviewed by Roy et al., 1994Down ). The functions of the nonstructural proteins are still under investigation. The smallest genome segment, S10, encodes the membrane-associated nonstructural proteins NS3 and NS3A (Van Staden & Huismans, 1991Down ; Stoltz et al., 1996Down ). Baculovirus-expressed NS3 is cytotoxic in insect cells (Sf9 cells), possibly as a result of membrane damage (Van Staden et al., 1998Down ), and is associated with events of AHSV release from infected Vero cells (Stoltz et al., 1996Down ). AHSV NS3 is likely to have an analogous function to NS3 of BTV, which is proposed to play a role in the final stages of BTV morphogenesis and release of virions (Hyatt et al., 1993Down ). In addition, AHSV NS3 may be involved in determining the virulence potential of a particular strain in a mouse model system (O’Hara et al., 1998Down ) and influencing the timing of virus release from infected cells (Martin & Meyer, 1998Down ). A number of conserved domains of AHSV NS3 have been identified (Van Staden et al., 1995Down ). A possible membrane insertion peptide proposed by Jensen & Wilson (1995)Down for oribivirus NS3 proteins includes four highly positive charged residues preceding the first hydrophobic domain of 16 residues and a strong polar stretch of 7 residues distal to the hydrophobic domain. However, the membrane targeting signal of the orbivirus NS3 protein has not been identified.

Published phylogenetic studies on AHSV NS3 gene and protein sequences describe three distinct NS3 genetic lineages designated groups {alpha}, {beta} and {gamma}, respectively, with a maximum variation of 35% between different serotypes (Sailleau et al., 1997Down ; Martin & Meyer, 1998Down ). BTV NS3 groups into three monophyletic clusters (Bonneau et al., 1999Down ) independent of BTV serotype, year of isolation, geographical origin and host species of isolation (Pierce et al., 1998Down ), and variation within the NS3 protein of BTV isolates is reported to be only 7% (Hwang et al., 1992Down ). Limited NS3 sequence data for other orbiviruses, however, restrict a comprehensive comparison of the typical variation for this nonstructural protein of the orbivirus serogroup. Genetic characterization of the corresponding protein to NS3 in rotavirus (family Reoviridae) NSP4 suggests the presence of four NSP4 genotypes of which the most recently recognized, genotype D, is the most divergent (Kirkwood & Palombo, 1997Down ; Ciarlet et al., 2000Down ). The variation between the NSP4 protein of genotype A and B rotavirus isolates is greater than that of BTV NS3 and approaches 20%.

Since NS3 is a potential contributing factor to AHSV virulence, it was of interest to investigate the genetic variation between recent South African AHSV field isolates in comparison to vaccine and laboratory reference strains of different serotypes. It may be possible to use NS3 sequence data together with serotyping to distinguish between different outbreaks of the same serotype as well as between field isolates and live attenuated vaccine strains. We found that the variation of AHSV NS3 is as much as 36·3% across AHSV serotypes and 27·6% within a serotype. NS3 proteins of vaccine and field isolates of the same serotype were found to differ between 2·3% and 9·7%. The inferred phylogeny of AHSV NS3 indicated an alternative grouping of AHSV-8 NS3 proteins. We also identified a highly conserved possible myristylated region that is followed by basic amino acids within the amino-terminal conserved domain of orbivirus NS3 proteins.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
Monolayer cultures of Vero cells were propagated in minimal essential medium supplemented with 5% foetal calf serum, penicillin, streptomycin and Fungizone. Cells were infected with AHSV isolates at a confluency of 80%. The OIE AHS Reference Laboratory at the Onderstepoort Veterinary Institute (OVI), South Africa provided and serotyped all the viruses. The AHSV strains that were used in this study included recent field isolates of serotypes 2, 3, 4, 6, 7 and 8 obtained from fatal AHSV infections of horses as well as a dog and current vaccine and laboratory reference strains (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. List of AHSV isolates used in this study

 
{blacksquare} RNA isolations, complementary DNA synthesis and PCR.
Total RNA was extracted from two 75 cm3 flasks of AHSV-infected Vero cells showing 80 to 90% cytopathic effect, usually 3 to 5 days post-infection, using TRIZOL reagent (Gibco BRL). The RNA sample was resuspended in DEPC-treated water and stored at -20 °C. The dsRNA of S10 was reverse transcribed into a complementary DNA (cDNA) copy using primers that annealed to the 5' and 3' terminal regions of the RNA segment, namely NS3pEco (5' cggaattcgtaagtcgttatcccgg) and NS3pBam (5' cgggatccgtttaaattatcccttg) respectively. The primers contained restriction enzyme sites for cloning purposes. Complementary DNA was synthesized as previously described (Zientara et al., 1998Down ; Wade-Evans, 1990Down ). Briefly, 250 to 500 ng of RNA was denatured with an equal volume of 10 mM methylmercuric hydroxide (MMOH) for 10 min at room temperature. The MMOH was reduced by addition of 2 µl 0·7 M {beta}-mercaptoethanol in the presence of 159 U RNase inhibitor (Amersham) and left for a further 5 min at room temperature. The denatured RNA was added to a cDNA reaction mix containing 100 pmol of each primer, 2 µl 10 mM dNTP mix (in sodium salt), 2·4 µl 5x reaction buffer and 5U AMV reverse transcriptase (Promega). The reaction was incubated for 90 min at 42 °C. The S10 cDNA was amplified in a subsequent PCR using 1 to 4 µl of cDNA, 10x reaction buffer including optimized MgCl2 concentration, 4 µl of each primer (100 ng/µl), 5 µl 1 mM dNTPs and 1 U Taq polymerase (Takara ExTaq) in a reaction volume of 50 µl. The reaction conditions were set for one cycle of 3 min at 94 °C, followed by 30 cycles of 1 min at 94 °C, 45 s at 50 °C and 1 min at 72 °C and a final cycle as above except that the elongation time was extended for a further 4 min.

{blacksquare} DNA sequencing and analysis.
S10 PCR amplicons were purified using a commercial purification kit (Roche Diagnostics) and sequenced according to the manufacturer’s recommendations using an ABI 377 automated sequencer (Perkin Elmer). In addition to the above-mentioned primers, an additional internal primer, NS3C2.rev (5' gccccactcgcaccag) was designed to sequence the 5' region of the gene. The AHSV S10 gene sequences were translated into subsequent NS3 amino acid sequences and aligned using ClustalX (Thompson et al., 1997Down ). The aligned NS3 sequences were used to generate a table of pairwise distances (PAUP version 4.0b3) to evaluate the variation within AHSV NS3. Accession numbers for the AHSV protein sequences retrieved from GenBank used in variation comparisons are listed in Table 2Down. The phylogeny of AHSV NS3 was investigated with the construction of phylogenetic trees using the neighbour-joining and parsimony methods (PAUP version 4.0b3). A gamma test was done on the aligned nucleotide sequences to evaluate whether the genes displayed unequal rates of mutation. Bootstrap analysis was done (1000 replicates) and confidence scores are shown on the branches of the neighbour-joining tree (PAUP version 4.0b3).


View this table:
[in this window]
[in a new window]
 
Table 2. Accession numbers of additional sequences used in this study

 

   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The NS3 gene nucleic acid sequences of 18 AHSV isolates were determined and aligned (Fig. 1Down). The open reading frame of the NS3 gene encoded a protein of 217 amino acids in the case of AHSV-3, -4, -5, -6, -7, -8 and -9 and 218 amino acids in the case of AHSV-2. Conserved regions identified by Van Staden et al. (1995)Down are evident, namely the NS3A initiation codon, a proline-rich region, a highly conserved region from amino acids 43–92, and two predicted hydrophobic domains. Most of the amino acid differences grouped within three regions, namely the first 43 residues at the N-terminal, the region between residues 93 and 153 and the 15 C-terminal residues of NS3. The most variable region (82·4% variation) was located between amino acids 136 and 153. The NS3 membrane-associated model proposed by Van Staden et al. (1995)Down maps this region to the exterior of the cell membrane. The NS3 proteins of all AHSV serotypes, with the exception of serotype 2, showed a conserved cysteine residue in position 123. In AHSV-2 the cysteine is located in position 120 (Fig. 1Down). The position of the second cysteine residue (164) is, however, fully conserved amongst all serotypes.



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1. AHSV NS3 amino acid sequence alignment comparisons. Dots indicate identity to AHSV-8 reference strain NS3. The NS3A start codon is blocked; the proline-rich region is underlined and blocked (amino acids 32–44). The highly conserved region is blocked (amino acids 53–92); the myristylation motif within this region is indicated by bold type and the corresponding sequences in the other AHSV NS3 proteins are shaded light grey. The two hydrophobic domains (amino acids 116–146 and 164–186) are shaded in dark grey.

 
In addition to the above-mentioned domains, a highly conserved N-myristylation motif was identified for AHSV (amino acids 60–65 or 59–64). Distal to the myristylation motif is a region of positively charged residues. Both these features are located within the conserved domain (amino acids 43–92) previously reported by Van Staden et al. (1995)Down . Upon comparison with other orbivirus NS3 proteins it was observed that the N-myristylation motif was highly conserved in the amino-terminal region of all these proteins. The motif was located between amino acids 66–71 for BTV, amino acids 47–52 for CHV (Chuzan virus, a member of the Palyam serogroup), amino acids 62–67 for EHDV (epizootic haemorrhagic disease virus) and amino acids 37–42 for BRDV (Broadhaven virus) (Fig. 2Down). These myristylation motifs were in all cases followed by a number of basic amino acids that have a random order, as seen for AHSV NS3.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Proposed orbivirus NS3 myristylation motif. The bipartite signal consists of a myristylation motif (underlined and in italics) followed by a number of basic residues (bold type). The similar membrane-targeting signal identified for HIV-1 Gag (Zhou et al., 1994Down ) is shown.

 
The amino acid sequence variation within the NS3 proteins of AHSV was investigated with an inferred distance matrix (Fig. 3Down). These results were compared to the level of NS3 variation in other orbiviruses as well as the level of NSP4 variation within the genus Rotavirus. AHSV NS3 variation was furthermore compared to that of other AHSV proteins (Fig. 4Down). Distance scores from the matrix, shown as histograms, indicated that AHSV NS3 varied by as much as 27·6% (between S8FLD2 and S8REF) within a serotype and up to 36·3% (between S8REF and S2VAC or S2FLD) amongst different serotypes (Fig. 4aDown). This is in strong contrast to the 7% variation of BTV NS3 (Hwang et al., 1992Down ). The cognate protein in rotaviruses, NSP4, varies by 19·4% (Kirkwood & Palombo, 1997Down ), which is significantly less than the AHSV NS3 protein. Sequence alignment of orbivirus NS3 proteins indicated that AHSV NS3 differed by a maximum of 69·4% from CHV NS3, by 74·5% from EHDV NS3 and by 75·3% from BTV NS3. BRDV NS3 was found to be the most divergent NS3 protein in the orbivirus group.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 3. Distance matrix showing the percentage amino acid differences between AHSV NS3 sequences of this study: BTV NS3, EHDV NS3, CHV NS3 and BRDV NS3. AHSV NS3 phylogenetic clusters {alpha}, {beta} and {gamma} are indicated by large blocks and percentages of NS3 variation frequently referred to in the text are blocked.

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. Comparative variation of AHSV NS3. (a) Total level of variation of AHSV NS3 across serotypes compared to that of BTV NS3 and rotavirus NSP4. The internal levels of AHSV NS3 variation within serotypes, between vaccine and virulent field strains of the same serotype and between field strains of the same serotype are shown. Maximum and minimum variation percentages are indicated to the right of the bars. (b) Level of AHSV NS3 variation compared to that found in other AHSV-encoded proteins.

 
The variation between virulent field isolates within AHSV-3, -6, -7 and -8 was investigated and found to range from 2·3% (AHSV-7 field isolates) to a maximum of 11·1% (AHSV-3 field isolates). The AHSV-3 field isolates displayed the highest variation and originated from geographically distinct areas as well as different years, i.e. Gauteng (S3FLD1) in 1997 and Kwa-Zulu Natal (S3FLD2) in 1998. The field isolates of AHSV-6 differed from one another by 3·7% and were isolated from quite different geographical regions in South Africa (Kwa-Zulu Natal and Free State) in the same year. The field isolates with the least variation, i.e. AHSV-7 (2·3%) and AHSV-8 (2·8%), were all isolated from the same geographical area (Gauteng) in the same year. The variation in NS3 sequence between different field isolates, such as the AHSV-3 field isolates in this study, is often large enough to distinguish between sub-populations within a serotype. This could be of some advantage when outbreaks of the same serotype occur in different localities in the country and there is a request to link the outbreak to the transport of animals between these different regions.

The NS3 sequences of the virulent field isolates were compared to the avirulent vaccine strain NS3 sequences of the corresponding serotype. The amount of variation was found to be 2·3% for AHSV-2, 7·4–8·8% for AHSV-3, 2·3–6·0% for AHSV-6, 6·0–6·5% for AHSV-7 and 7·8–9·7% for AHSV-8 (Fig. 4 aUp). With the exception of AHSV-8 vaccine and reference strains (26·2% variation), comparisons of NS3 sequence variation of vaccine and reference strains within a particular serotype ranged between 1·8–3·2%. The AHSV-2 vaccine strain was produced from the reference strain 82/61. It is not known if the AHSV-3 and -6 vaccine strains are attenuated forms of the respective reference strains used in this study. The high level of NS3 sequence variation between the AHSV-8 vaccine and reference strains suggests that the vaccine strain of AHSV-8 was not derived directly from the AHSV-8 reference strain analysed in this study.

In comparison to the other AHSV proteins (Fig. 4bUp), NS3 is the second most variable virus protein with approximately 20% less variation than the observed 56% variation between the outer capsid proteins (VP2) of different serotypes. Other AHSV proteins (VP3, VP5, VP6, VP7 and NS1) have an internal variation ranging between 19% (VP5) and 0·2% (VP7). As expected, the sequence conservation of the inner core proteins (VP3 and VP7) is significantly higher than that of the outer capsid proteins (VP5 and VP2).

To investigate the phylogeny between virulent field isolates, vaccine strains and laboratory reference strains, the aligned NS3 amino acid sequences were used to construct phylogenetic trees (PAUP version 4.0b3) (Fig. 5Down). The estimated value of the gamma shape parameter was 0·58 and the small distances obtained using this value in a gamma test indicated that the NS3 gene was subject to unequal rates of mutation. Certain algorithms used to construct phylogenetic trees, such as that used by the unweighted pairgroup method with arithmetic mean (UPGMA), assume equal rates of mutation and were therefore not used in this analysis. Results of the aligned S10 gene nucleotide sequences and inferred phylogenetic trees generated the same results as found for the NS3 protein sequences and are thus not shown. The NS3 proteins of related orbiviruses retrieved from GenBank (Table 2Up), namely BTV, EHDV, CHV and BRDV (selected as outgroup), were included for comparative purposes.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. Phylogenetic tree of AHSV NS3 and other orbivirus NS3 protein sequences. The horizontal branch lengths are indicative of the genetic distance between the sequences. The tree was constructed using the neighbour-joining method (PAUP version 4.0b3) and bootstrapped with 1000 replicates. Confidence levels are as indicated.

 
Various methods of tree construction all showed similar internal grouping of AHSV NS3. NS3 grouping of the related orbiviruses gave distinct clusters with a difference in the placement of CHV NS3 depending on the method of tree construction used. CHV NS3 grouped closer to AHSV when analysing the data with neighbour-joining while it grouped closely with BTV and EHDV when using parsimony. The bootstrap value of the node that connected CHV and AHSV NS3 in the neighbour-joining tree was 53%, indicating a low confidence for the grouping in this branch. However, a high bootstrap value (>90%) for the CHV and BTV branch with parsimony suggests that CHV NS3 is closer related to the BTV and EHDV NS3 sequences than to NS3 of AHSV.

The inferred phylogenetic trees of the isolates that we included indicated the presence of the same three distinct NS3 phylogenetic clusters previously described, viz. {alpha}, {beta} and {gamma} (Martin & Meyer, 1998Down ; Sailleau et al., 1997Down ) with AHSV-4,-5, -6, -8 and -9 clustering in {alpha}, AHSV-3, -7 and -8 in {beta} and AHSV-2 in {gamma}. The {alpha} and {beta} clusters were found to share the most recent common ancestor and are therefore closer related to one another than to the {gamma} cluster of AHSV-2 viruses. NS3 of the AHSV-8 isolates that we studied clustered into two different phylogenetic groups and did not cluster with AHSV-2 as reported previously. The AHSV-8 field and vaccine strains grouped with AHSV-4, -5, -6 and -9 ({alpha}), while the AHSV-8 reference strain grouped with AHSV-3 and AHSV-7 ({beta}). The {gamma} cluster showed that the AHSV-2 reference and vaccine strain NS3 proteins are more closely related to one another than to NS3 of the AHSV-2 field strain. The grouping pattern of the {beta} cluster indicated no sub-clustering of NS3 based on AHSV serotype. NS3 of AHSV-3 vaccine and reference strains were sisters while the NS3 of AHSV-7 vaccine and AHSV-8 reference strains were closely related. The AHSV-7 field isolates were closely related while NS3 of AHSV-3 field isolates did not share the same common internal node in the tree and are therefore more distantly related. The largest cluster in this study, {alpha}, grouped NS3 of all the AHSV-4, -5, -6 and -9 isolates and three of the AHSV-8 isolates together. The AHSV-6 NS3 proteins were found to form a distinct lineage within this cluster. The AHSV-6 field isolates were closely related to one another and the AHSV-6 vaccine and reference strains were sisters in this sub-cluster. The AHSV-8 NS3 proteins were more dispersed through this cluster. The AHSV-8 field isolates grouped in a separate lineage to that of the AHSV-8 vaccine strain, which was in turn closely related to the AHSV-5 and -9 reference strains.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The overall NS3 protein sequences of the AHSV isolates in our study varied by 36·3%, which is in strong contrast to the much lower NS3 sequence variation reported for BTV (7%). The variation is also greater than the variation in the NSP4 protein of rotaviruses (19·4%). The observed large inter-serotype genetic variability of 27·6% for AHSV-8 is furthermore significantly larger than the highest inter-serotype variation of 15% previously documented for AHSV-4 (Sailleau et al., 1997Down ). The large inter-serotype variation is a useful target for distinguishing between sub-populations of the same serotype. It is of particular interest to distinguish between vaccine and field isolates of the same serotype. With respect to those serotypes investigated as part of this study, the variation in the range of 2·3–9·7% is large enough to make such a distinction, particularly when combined with phylogenetic analysis (Fig. 5Up).

This AHSV NS3 phylogenetic study confirms the grouping of the majority of AHSV NS3 proteins into three distinct phylogenetic lineages (Martin & Meyer, 1998Down ). In exception, NS3 of four different AHSV-8 isolates in this study grouped in two separate clusters ({beta} and {alpha}) and not together with NS3 of serotypes 1 and 2 in the {gamma} cluster as predicted from the literature. Therefore, it may be assumed that although three distinct NS3 phylogenetic clusters are evident, the placement of a specific AHSV NS3 is not exclusively defined by the serotype. Reassortment of AHSV genome segments may be able to explain some of this large variation. Reassortment is a natural occurrence in the case of viruses with segmented genomes such as orthomyxo- and reoviruses. Multiple AHSV serotypes simultaneously present in zebras (Barnard, 1993Down ) and mixed AHSV infections in horses could facilitate S10 reassortment between virus populations of different serotypes. The serotype groupings in the NS3 phenogroups (Fig. 5Up) appear to indicate a certain tendency for serotypes (i.e. those within the same NS3 cluster) to exchange the NS3 gene more readily. These serotypes may further have a higher incidence of co-circulation. BTV NS3 also shows extensive shifting as NS3 clusters do not conform with BTV serotypes (Pierce et al., 1998Down ). AHSV field isolates of the same season (usually commencing from early January to late May) and same serotype are closely related, while those of different seasons are more distantly related. The close relatedness of the NS3 sequence of viruses of the same serotype that were isolated from nearby geographical locations agrees with generally accepted epidemiological principles. In no instance was NS3 of a vaccine strain identical to NS3 of field isolates of the same serotype.

The origin of the observed NS3 variation in AHSV is not clear and can include many different variables. For example, the intermediate vector (Culicoides imicola) may tolerate a large amount of random variation in NS3 without an adverse affect on virion viability. NS3 is membrane-associated and may be under some immunological pressure, unlike the inner capsid proteins and other nonstructural proteins (NS1 and NS2) which seem to remain within cells. The large variation in the NS3 region between the two hydrophobic membrane-spanning domains illustrates that this area is able to tolerate a large amount of variation. A particularly intriguing question that remains to be investigated is why BTV NS3 seems to be so much more conserved. It has been proposed that variation of BTV NS3 is limited by structural constraints important for its function (Pierce et al., 1998Down ). Why these limitations do not apply to the same degree for AHSV NS3 remains uncertain.

Despite the extensive variation, higher-order structures of AHSV NS3 predicted to be of importance, for example membrane-anchoring domains, are highly conserved. A highly conserved myristylation motif was also identified within the conserved N-terminal region of the orbivirus NS3 proteins. Although this sequence is common to a vast number of proteins and, therefore, does not imply that a protein is myristylated, it is nevertheless of interest in view of the fact that a major function of protein acylation is membrane targeting and association. Myristylation alone does, however, not provide sufficient energy to attach the protein to the phospholipid bilayer (McLaughlin & Aderem, 1995Down ). Membrane-associated proteins of other viruses, such as Gag of human immunodeficiency virus (HIV)-1 (Zhou et al., 1994Down ) and Src of Rous sarcoma virus (Silverman & Resh, 1992Down ), contain a region of basic amino acid residues that stabilize membrane interactions. We identified a similar bipartite motif in all orbivirus NS3 proteins investigated that may function as a membrane-targeting signal of cleaved orbivirus NS3 proteins.

The two hydrophobic regions of AHSV NS3 have been associated with the cytotoxic effect of this protein (Van Staden et al., 1998Down ). Any variation in these hydrophobic regions would therefore have the potential to abolish or alter the cytotoxic effect of NS3. This investigation did not show any differences between the hydrophobic domains of vaccine and field isolates that could be used as a virulence marker. Avirulence in rotavirus infections can be associated with mutations in NSP4, in particular between amino acids 131 and 140, that mediate binding to another viral protein, VP4 (Zhang et al., 1998Down ). It was also observed that a single codon difference between the authentic sequence of rotavirus SA11 NSP4 and the commonly used NSP4 cDNA clone (amino acid 47) enhances the cytotoxicity of authentic NSP4 and calcium influx properties when expressed as a baculovirus recombinant (Tian et al., 2000Down ). The significance of single amino acid differences can therefore not be underestimated.

This study is the first investigation of the variation in NS3 between recent virulent field isolates of AHSV and their relatedness to the current vaccine strains. Sequencing of the comparatively small NS3 gene in outbreaks of the disease may provide significant epidemiological information as to the origin of a virus involved in an outbreak. This is supported by preliminary, unpublished results on a recent outbreak of AHSV-7 in a region of South Africa (Western Cape) that has been free from AHSV for a large number of years.


   Acknowledgments
 
We thank Mr J. J. O. Koekemoer for assistance with propagation of viruses and RNA purification and David L. Swofford for permission to use the test version of PAUP.


   Footnotes
 
The GenBank accession numbers of the sequences reported in this paper are AF276685 to AF276702.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Barnard, B. J. H.(1993). Circulation of African horse sickness virus in zebra (Equus burchelli) in the Kruger National Park, South Africa, as measured by the prevalence of type specific antibodies. Onderstepoort Journal of Veterinary Research 60, 111-117.[Medline]

Bonneau, K. R., Zhang, N., Zhu, J., Zhang, F., Li, Z., Zhang, K., Xiao, L., Xiang, W. & MacLachlan, N. J.(1999). Sequence comparison of the L2 and S10 genes of bluetongue viruses from the United States and the People’s Republic of China. Virus Research 61, 153-160.[Medline]

Ciarlet, M., Liprandi, F., Conner, M. E. & Estes, M. K.(2000). Species specificity and interspecies relatedness of NSP4 genetic groups by comparative NSP4 sequence analyses of animal rotaviruses. Archives of Virology 145, 371-383.[Medline]

Coetzer, J. A. & Erasmus, B. J.(1994). African horsesickness. In Infectious Disease of Livestock with Special Reference to Southern Africa, vol. 1 , pp. 460-475. Edited by J. A. Coetzer, C. R. Thomson& R. C. Tustin. Oxford:Oxford University Press.

Howell, P. G.(1962). The isolation and identification of further antigenic types of African horsesickness virus. Onderstepoort Journal of Veterinary Research 29, 139-147.

Hwang, G., Yang, Y., Chiou, J. & Li, J. K.(1992). Sequence conservation among the cognate nonstructural NS3/NS3A protein genes of six bluetongue viruses. Virus Research 23, 151-161.[Medline]

Hyatt, A. D., Zhao, Y. & Roy, P.(1993). Release of bluetongue virus-like particles from insect cells is mediated by BTV nonstructural protein NS3/NS3A. Virology 193, 592-603.[Medline]

Jensen, M. J. & Wilson, W. C.(1995). A model for the membrane topology of the NS3 protein as predicted from the sequence of segment 10 of epizootic haemorrhagic disease virus serotype 1. Archives of Virology 140, 799-805.[Medline]

Kirkwood, C. D. & Palombo, E. A.(1997). Genetic characterization of the rotavirus nonstructural protein, NSP4. Virology 236, 258-265.[Medline]

Laegreid, W., Skowronek, W. A., Stone-Marschat, M. & Burrage, T.(1993). Characterization of virulence variants of African horsesickness virus. Virology 195, 836-839.[Medline]

Lubroth, J.(1988). African horsesickness and the epidemiology in Spain. Equine Practice 10, 26-33.

McIntosh, B. M.(1956). Complement fixation with horsesickness virus. Onderstepoort Journal of Veterinary Research 27, 165-169.

McLaughlin, S. & Aderem, A.(1995). The myristoyl-electrostatic switch: a modulator of reversible protein–membrane interaction. Trends in Biochemical Sciences 20, 272-275.[Medline]

Martin, L. A. & Meyer, A. J.(1998). Phylogenetic analysis of African horse sickness virus segment 10: sequence variation, virulence characteristics and cell exit. Archives of Virology Supplement 14, 281-293.[Medline]

Mellor, P. S.(1993). African horsesickness: transmission and epidemiology. Veterinary Research 24, 199-212.[Medline]

O’Hara, R. S., Meyer, A. J., Burroughs, J. N., Pullen, L., Martin, L. A. & Mertens, P. P.(1998). Development of a mouse model system, coding assignments and identification of the genome segments controlling virulence of African horse sickness virus serotypes 3 and 8. Archives of Virology Supplement 14, 259-279.[Medline]

Pierce, C. M., Balasuriya, U. B. & Maclachlan, N. J.(1998). Phylogenetic analysis of the S10 gene of field and laboratory strains of bluetongue virus from the United States. Virus Research 55, 15-27.[Medline]

Roy, P., Mertens, P. P. & Cascal, I.(1994). African horse sickness virus structure. Comparative Immunology Microbiology and Infectious Diseases 17, 243-273.[Medline]

Sailleau, C., Moulay, S. & Zientara, S.(1997). Nucleotide sequence comparisons of the segment s10 of the nine African horsesickness virus serotypes. Archives of Virology 14, 965-978.

Silverman, L. & Resh, M. D.(1992). Lysine residues form an integral component of a novel NH2-terminal membrane targeting motif for myristylated pp60v-src. Journal of Cellular Biology 119, 415-425.

Stoltz, M. A., van der Merwe, C. F., Coetzee, J. & Huismans, H.(1996). Subcellular localization of the nonstructural protein NS3 of African horsesickness virus. Onderstepoort Journal of Veterinary Research 63, 57-61.[Medline]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.(1997). The CLUSTAL-X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882.[Abstract/Free Full Text]

Tian, P., Ottaiano, A., Reilly, P. A., Udem, S. & Zamb, T.(2000). The authentic sequence of rotavirus SA11 nonstructural protein NSP4. Virus Research 66, 117-122.[Medline]

Van Staden, V. & Huismans, H.(1991). A comparison of the genes which encode nonstructural protein NS3 of different orbiviruses. Journal of General Virology 72, 1073-1079.[Abstract/Free Full Text]

Van Staden, V., Stoltz, M. A. & Huismans, H.(1995). Expression of nonstructural protein NS3 of African horsesickness virus (AHSV): evidence for a cytotoxic effect of NS3 in insect cells, and characterization of the gene products in AHSV infected Vero cells. Archives of Virology 140, 289-306.[Medline]

Van Staden, V., Smit, C. C., Stoltz, M. A., Maree, F. F. & Huismans, H.(1998). Characterization of two African horse sickness virus nonstructural proteins, NS1 and NS3. Archives of Virology Supplement 14, 251-258.[Medline]

Wade-Evans, A. M.(1990). Complete sequence of genome segment 10, encoding the NS3 protein, of bluetongue virus, serotype 1 from South Africa. Nucleic Acids Research 18, 4920.[Free Full Text]

Zhang, M., Zeng, C. Q.-Y., Dong, Y., Ball, J. M., Saif, L. J., Morris, A. P. & Estes, K. M.(1998). Mutations in rotavirus nonstructural glycoprotein NSP4 are associated with altered virus virulence. Journal of Virology 72, 3666-3672.[Abstract/Free Full Text]

Zhou, W., Parent, L. J., Wills, J. W. & Resh, M. D.(1994). Identification of a membrane-binding domain within the amino terminal region of human immunodeficiency virus type 1 Gag protein which interacts with acidic phospholipids. Journal of Virology 68, 2556-2569.[Abstract/Free Full Text]

Zientara, S., Sailleau, C., Plateau, E., Moulay, S., Mertens, P. P. & Cruciere, C.(1998). Molecular epidemiology of African horse sickness virus based on analyses and comparisons of genome segments 7 and 10. Archives of Virology Supplement 14, 221-234.[Medline]

Received 23 June 2000; accepted 15 September 2000.


This article has been cited by other articles:


Home page
jvdiHome page
M. Aguero, C. Gomez-Tejedor, M. Angeles Cubillo, C. Rubio, E. Romero, and A. Jimenez-Clavero
Real-time fluorogenic reverse transcription polymerase chain reaction assay for detection of African horse sickness virus
J Vet Diagn Invest, May 1, 2008; 20(3): 325 - 328.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Quan, M. van Vuuren, P. G. Howell, D. Groenewald, and A. J. Guthrie
Molecular epidemiology of the African horse sickness virus S10 gene
J. Gen. Virol., May 1, 2008; 89(5): 1159 - 1168.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. C. Potgieter, M. Cloete, P. J. Pretorius, and A. A. van Dijk
A first full outer capsid protein sequence data-set in the Orbivirus genus (family Reoviridae): cloning, sequencing, expression and analysis of a complete set of full-length outer capsid VP2 genes of the nine African horsesickness virus serotypes
J. Gen. Virol., May 1, 2003; 84(5): 1317 - 1326.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. van Niekerk, M. Freeman, J. T. Paweska, P. G. Howell, A. J. Guthrie, A. C. Potgieter, V. van Staden, and H. Huismans
Variation in the NS3 gene and protein in South African isolates of bluetongue and equine encephalosis viruses
J. Gen. Virol., March 1, 2003; 84(3): 581 - 590.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Niekerk, M.
Right arrow Articles by Huismans, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Niekerk, M.
Right arrow Articles by Huismans, H.
Agricola
Right arrow Articles by van Niekerk, M.
Right arrow Articles by Huismans, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS