J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laurent, S.
Right arrow Articles by Rasschaert, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laurent, S.
Right arrow Articles by Rasschaert, D.
Agricola
Right arrow Articles by Laurent, S.
Right arrow Articles by Rasschaert, D.
Journal of General Virology (2001), 82, 233-240.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Detection of avian oncogenic Marek’s disease herpesvirus DNA in human sera

S. Laurent1, E. Esnault1, G. Dambrine2, A. Goudeau3, D. Choudat4 and D. Rasschaert1

Laboratoire de Virologie et Barrière d’Espèce, Station de Pathologie aviaire et de parasitologie, INRA, Centre de recherches de Tours, 37380 Nouzilly, France1
Laboratoire de Virologie et d’Oncogénèse Aviaire, Station de Pathologie aviaire et de parasitologie, INRA, Centre de recherches de Tours, France2
Département de Microbiologie Médicale et Moléculaire, Faculté de Médecine de Tours, France3
Département Médecine du Travail, Faculté de Médecine Cochin-Port Royal, Paris 14ème, France4

Authors for correspondence: D. Rasschaert and S. Laurent. Fax +33 02 47 42 77 74. e-mail rasschae{at}tours.inra.fr and slaurent@tours.inra.fr

Authors for correspondence: D. Rasschaert and S. Laurent. Fax +33 02 47 42 77 74. e-mail rasschae{at}tours.inra.fr and slaurent@tours.inra.fr


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The avian herpesvirus Marek’s disease virus (MDV) has a worldwide distribution and is responsible for T-lymphoma in chickens. The question as to whether MDV poses a public health hazard to humans was first raised when the virus was isolated in 1967. However, no irrefutable results have been obtained in immunological and virological studies. We used a nested-PCR to detect MDV DNA in human serum samples. A total of 202 serum samples from individuals exposed and not exposed to poultry was tested by nested-PCR for a target sequence located in the MDV gD gene. The assay system was specific and sensitive, making it possible to detect a single copy of the target sequence. Forty-one (20%) of the 202 serum samples tested positive for MDV DNA. The prevalence of MDV DNA was not significantly different in the group exposed to poultry and the group not exposed to poultry. There was also no difference due to age or sex. Alignment of the 41 gD sequences amplified from human sera with eight gD sequences amplified from MDV-infected chicken sera showed a maximum nucleotide divergence of 1·65%. However, four ‘hot-spot’ mutation sites were identified, defining four groups. Interestingly, two groups contained only human MDV-gD sequences. The status of the MDV genome detected in human blood is discussed.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The emergence of a new form of human Creutzfeldt-Jakob disease probably caused by bovine prions (Bruce et al., 1997Down ), and of new fatal human diseases caused by animal viruses such as horse morbillivirus (Murray et al., 1995Down ), rodent hantaviruses (Khan et al., 1996Down ) and avian influenza virus (Yuen et al., 1998Down ), raises questions about the ability of other animal pathogens to spread to humans. We therefore studied Marek’s disease virus (MDV), a ubiquitous avian oncogenic herpesvirus that may be involved in human lymphoproliferative disorders. MDV has been classified as an alphaherpesvirus on the basis of its genome organization, which contains long and short unique sequences (UL and US) each flanked by internal and terminal repeat sequences (TRL/IRL and IRS/TRS respectively) (Cebrian et al., 1982Down ; Lee et al., 2000Down ). MDV causes T-cell lymphomas in chickens. It is distributed worldwide and acute explosive outbreaks caused by very virulent forms of the virus are frequently reported despite the availability of vaccines. The nononcogenic MDV strains used as a vaccine prevent tumour growth but do not prevent the replication of either vaccine or virulent strains and infectious virus particles survive at room temperature for several months (Calnek & Witter, 1991Down ).

Since the first isolation of MDV in 1967, many studies have investigated whether MDV can spread to humans and whether there is a correlation between human cancers and exposure to MDV (Purchase & Witter, 1986Down ). Most previous studies support the conclusion that MDV does not spread to humans and that there is no relationship between avian herpesvirus and human cancer. However, it should be pointed out that all of these studies were carried out using immunological, virological or epidemiological methods that may not be the most sensitive or appropriate methods for detecting MDV in humans, and indeed, Purchase & Witter (1986)Down stated that ‘there is no convincing evidence for rejecting the hypothesis that avian herpesvirus are not a public health problem’. As they further suggested, a new way to attempt to resolve this issue is to use molecular tools. The aim of this study was to use sensitive molecular biology methods to determine whether MDV genomic DNA sequences are detectable in human blood. The amplification of nucleic acid extracted directly from serum samples is increasingly being used for virus detection [e.g. parvovirus (Zerbini et al., 1999Down ) and hepatitis E virus (Erker et al., 1999Down )]. Such methods have been successfully developed for the detection of human lymphotropic herpesviruses such as Epstein–Barr virus (EBV; Gan et al., 1994Down ), cytomegalovirus (Brytting et al., 1992Down ) and human herpesvirus (HHV)-6 (Osiowy et al., 1998Down ).

We have used a similar approach to investigate whether avian lymphotropic herpesvirus DNA was present in human sera. An MDV-specific nested-PCR for detection of a portion of the MDV-gD gene was developed. This was used to amplify MDV-gD sequence in DNA extracted from 202 human sera. The specificity of the MDV-gD sequence amplified was verified by sequencing and a multiple sequence alignment was performed for MDV sequences of avian and human origin.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Human serum samples.
A representative panel of 202 human serum samples was selected from 500 serum samples collected between November 1990 and May 1991 for an immunological study (Choudat et al., 1996Down ). The questionnaire administered to the subjects was as previously described (Choudat et al., 1996Down ). In 1990–1991, two samples were collected from each subject. One was used in the previous immunological study (Choudat et al., 1996Down ) and the other, which had been stored at -20 °C for 8 years, was used in this study. Subjects were divided into three groups according to their occupational exposure to poultry. The first group consisted of 137 individuals exposed to chickens (divided into three subgroups: intensive chicken farms, chicken slaughterhouses and traditional farms with poultry), the second group included 27 individuals occupationally exposed to pigs or cattle (but not to poultry) and the third group consisted of 38 office staff.

{blacksquare} Chicken samples.
Five serum samples (p8508, p8507, p8518, p10230 and p10426) were collected in 1998–1999 from chickens with clinical signs of Marek’s disease. The diagnosis of Marek’s disease was further confirmed by histopathological studies. The chickens came from different poultry farms in the west of France. Serum from a laboratory SPF-chicken was used as a negative control in the PCR test and DNA was also extracted from a non-pathogenic MDV vaccine strain (CVI-988).

{blacksquare} Extraction of DNA and amplification of MDV DNA.
Serum (500 µl) was incubated with 500 µg/ml proteinase K, 0·5% SDS and 10 mM Tris, pH 8 for 2 h at 70 °C. Nucleic acid was then extracted with phenol-chloroform followed by ethanol precipitation. The resulting pellet was suspended in 50 µl of water.

Serum DNA extracts were used for nested-PCR in which a portion of the gD gene of the MDV genome (strain RB1B) (Ross et al., 1991Down ) was specifically amplified. The first round of PCR was performed with the primer pair gDF (5’ ATGAAAACCTCCGGGCTACTCTC 3’) and gDR (5’ GATTATTGCAGCACCCAGT 3’); this yielded a 383 bp fragment. The second round of nested-PCR was performed with the primer pair gDNF (5’ ATGAATACAAAATCCCGTCTCC 3’) and gDNR (5’ GTCCCTAGGATGGTGGGATAG 3’), resulting in amplification of a 295  bp fragment. All PCRs were performed in a final volume of 30 µl including 5 µl of DNA extract or 5 µl products of the first round of PCR, 0·05 U/µl Taq polymerase (Promega), 1 pmol/µl of each primer, 200 mM of each dNTP, 10 mM Tris–HCl (pH 9), 50 mM KCl, 0·1% Triton X-100 and 1·5 mM MgCl2. Thermocycling conditions were as follows: (i) 30 cycles of 45 s of denaturation at 94 °C, 1 min of annealing at 59 °C and 1 min of extension at 72 °C for each cycle; (ii) a final extension step of 10 min at 72 °C.

As a positive control, the gD gene of MDV strain RB1B (Ross et al., 1991Down ) was inserted into the pGEM cloning vector (Promega) to produce pGEM-gD. Serial dilutions of plasmid were used to determine the detection threshold of the technique. A positive control for each PCR assay was performed using the dilution of plasmid that resulted in the detection of a PCR product only by nested-PCR.

Standard precautions were used (i.e. manipulations in separate rooms, use of aerosol-barrier tips, mineral oil, gloves) were used to prevent possible PCR contamination and false-positive results.

We identified false-negative results due to the presence of PCR inhibitors or too little DNA using PCR to amplify a 125 bp fragment of the human {beta}-globin gene (V00500) from each human serum DNA extract with the primer pair {beta}-gF (5’ GGGCAACCCTAAGGTGAAGGC 3’) and {beta}-gR (5’ GAGCTGCACTGTGACAAGCTGC 3’) and the thermocycling conditions described above.

{blacksquare} Analysis of amplified products.
All PCR products were separated electrophoretically in 2 or 3% agarose gels containing ethidium bromide.

PCR products were sequenced by the dye-terminator method (Perkin-Elmer) using amplicons separated on agarose gel and directly extracted from the gel with a purification kit (Amicon).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Sensitivity of nested-PCR detection of MDV
The first PCR assay was performed with DNA extracted from sera from MDV-infected chickens. A very weak signal was detectable in a few samples after analysis of the first round PCR products. Following nested-PCR amplification, a single 295 bp band was detected by agarose gel electrophoresis for sera from MDV-infected chickens, whereas no PCR product was detectable for serum from an SPF chicken (Fig. 1ADown). One-hundred to 1000 copies of the gD-plasmid were required to obtain a positive signal in the first round of PCR and the detection limit was 100 to 1000 times higher after the second round of PCR, making it possible to detect one copy of the target sequence (corresponding to 10-18 g of plasmid) (Fig. 1BDown).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1. Detection of MDV DNA in human serum. In each case, 1/10 of the total volume of the PCR reaction was loaded onto an agarose gel. (A) Analysis of the gD nested-PCR products amplified from DNA extracted from the sera of MDV-infected chickens; chicken samples are identified. (B) Detection limit of the gD nested-PCR test. Serial 1 in 10 dilutions of pGEM-gD from 10-14 to 10-20 g were amplified by gD nested-PCR. (C) The quality of the DNA extracted from serum samples was checked by analysis of {beta}-globin PCR products amplified from DNA extracted from 10 randomly chosen human serum samples. (D) Detection of the MDV gD gene in human serum. Analysis of the gD nested-PCR products amplified from the same DNA samples shown in (C). (E) Control for pGEM-gD plasmid contamination of human DNA. Analysis of nested-PCR products amplified from 10 MDV-positive human sera with primer T7 and both reverse primers of the gD nested-PCR test.

 
We used the same PCR assay to test for MDV DNA in human serum. The quality of the DNA extracted from human serum was first assayed by amplification of a sequence in the human {beta}-globin gene (Fig. 1CUp). No PCR inhibitor was present in the serum DNA extracts, as all DNA extracts tested were positive for {beta}-globin by PCR. Nested-PCR gD amplification from DNA extracted from human sera yielded a single 295 bp band, as observed with the DNA extracted from chicken sera (Fig. 1DUp). The identity of all PCR products was confirmed by sequencing.

To ensure that there was no PCR contamination, assays were carried out in laboratories in a different building. For that purpose, we tested a panel of 20 human sera chosen at random from the sera collected in 1990–1991 (Choudat et al., 1996Down ), but which had not been selected for this study. A nested-PCR test was performed with newly purchased primer sets, PCR apparatus and the PCR reagents currently used in these other laboratories where MDV had never been manipulated. The results of the test confirmed our previous observations as 3 of the 20 sera tested positive for MDV (data not shown). Moreover, to ensure that there was no plasmid contamination, a nested-PCR assay was performed using 10 serum samples from MDV-positive subjects, the T7 primer located downstream from the gD gene and the two reverse primers of our nested-PCR test. As expected, no PCR product was detectable with sera whereas the dilution of gD-plasmid used as a control in the nested-PCR assay gave a strong signal (Fig. 1EUp).

Detection of MDV DNA in human sera
The MDV-gD target sequence was amplified from all categories of serum tested, regardless of whether the individual had been occupationally exposed to poultry or not (Table 1Down). For the entire collection, 41 of the 202 sera (20%) tested positive for MDV DNA. The distribution of MDV-DNA-positive sera did not depend on occupational exposure to poultry. In the poultry-exposed group, 26 of the 137 sera (19%) were positive for gD DNA and in the group not exposed to poultry, 15 of the 65 sera (23%) were positive for gD DNA. No significant difference in the frequency of MDV DNA detection was observed between men and women. MDV DNA was detected in 28 of 131 serum samples (21%) collected from men and in 13 of 71 serum samples (18%) collected from women. Similarly, age did not affect MDV DNA detection (Table 2Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Detection of MDV DNA in human sera according to occupational exposure to poultry

 

View this table:
[in this window]
[in a new window]
 
Table 2. Detection of MDV DNA in human sera according to age

 
Multiple gD sequence alignment
Nested-PCR amplification of the gD fragment yielded a PCR product of a 295 bp. We reduced the length of the sequence to 248 bp for alignment (by excluding the primer and first ambiguous nucleotides). There is no significant identity with the gD gene of HHV (<20% at the nucleotides levels). The human gD sequences were aligned with the three published sequences from different avian MDV strains [RB1B (Ross et al., 1991Down ), Woodland no. 1 (U60352) and GA (M80595)] and with the avian sequences from the five serum samples (p8508, p8507, p8518, p10230 and p10426) collected from chickens infected with MDV (Fig. 2Down). The maximum nucleotide divergence for all MDV-gD sequences was 1·65%. Nucleotide substitutions were scattered throughout the sequence. Ten of the 13 nucleotides changes were transitions and no deletions or insertions were observed. Six of the 13 nucleotides changes resulted in amino acid changes (Fig. 2Down). However, only four nucleotide changes (nt35, nt69, nt130 and nt159) were found in several sequences and designated ‘hot-spot’ mutations. The ‘hot-spot’ mutation at nt 35 changed the TAT codon to a TGT codon (Tyr->Cys) and the ‘hot-spot’ mutation at nt 130 changed the ATG codon to a GTG codon (Met->Val). The other two ‘hot-spot’ mutations (nt 69 and nt 159) were silent and were linked (always simultaneously muted). Four groups (A, B, C and D) were defined accordingly to these four characteristic ‘hot-spot’. Group A clustered 58·5% of the gD sequences whereas groups B, C and D clustered 17, 15 and 10% respectively. Both groups A and C clustered avian and human gD sequence whereas only human gD sequences were present in groups B and D. However, it should be noted that only eight avian sequences were analysed versus 41 human sequences. Hence, too few chicken samples were analysed to draw firm conclusions about the existence of specific human MDV groups. A larger number of samples should be analysed.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2. Alignment of gD sequences including sequences amplified from 46 serum samples investigated in this study and three gD sequences [RB1B (Ross et al., 1991Down ), Woodland (U60352) and GA (M80595) published elsewhere]. The RB1B sequence was chosen as the reference sequence. Dots indicate nucleotides identical to those of RB1B and nucleotides changes are indicated. The predicted peptide sequence of the protein encoded by the RB1B gD gene is indicated under the nucleotide sequence and amino acid changes are indicated. The four groups, A, B, C and D, are indicated to the right of the alignment.

 
Within a group, there was no association in terms of exposure to poultry, age or sex between the human subjects from whom the DNA was amplified.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We describe herein the first unambiguous detection of avian oncogenic herpesvirus genomic DNA sequences in human sera. Our results conflict with those of a recent report in which MDV DNA was not detected in leukocyte DNA from patients suffering from multiple sclerosis (Hennig et al., 1998Down ). However, the previous study used the TaqMan fluorogenic system. Therefore, as the authors themselves suggested, their negative results may be due to there being only a small number of MDV genome copies in the blood of the patients, below the detection limit of the TaqMan method (Hennig et al., 1998Down ). The difference in sensitivity between the TaqMan and the nested-PCR techniques may account for the differences between our results and those of Hennig et al. (1998)Down . Furthermore, in their study, they used a single fragment of the UL48 gene, which may not be a suitable target sequence for MDV DNA detection. The choice of target sequence seems to be an important factor for PCR efficiency, as demonstrated for cytomegalovirus (Mendez et al., 1998Down ) and EBV detection tests (Haque & Crawford, 1997Down ). More recently Leary et al. (1999)Down reported a rate of detection range between 27·1 and 60·4% for TTV DNA on the same sera depending on the set of primers used. To prevent such biases, we chose the target sequence that yielded the largest amount of amplification product after testing five different target sequences from the MDV genome using DNA extracted from the sera of MDV-infected chickens (data not shown).

Using PCR, we found no differences in the prevalence of MDV DNA in human sera from poultry-exposed or non-exposed individuals. There was also no difference in prevalence due to sex or age of the subjects. In all cases, MDV DNA was detected with a frequency of approximately 20%. Our results did not correlate with the previous immunological analysis of the same set of human sera, in which the prevalence of antibodies against MDV was found to be significantly higher in the poultry-exposed group than in the unexposed group (Choudat et al., 1996Down ). However, MDV was present at a very high density in the air at the chicken farms and slaughterhouses where the exposed group worked, and poultry workers continuously inhaled virus particles during their work. Therefore, an immune reaction, corresponding to antibody production against inert circulating antigen, may account for the high prevalence of antibodies against MDV in the sera of poultry-exposed individuals (Choudat et al., 1996Down ). Furthermore, it should be noted that several MDV and HHV proteins have epitopes in common (Davidson et al., 1995Down ; McHatters & Scham, 1995Down ).

PCR detects DNA from free virus circulating in the blood and also from intracellular virus, as a result of cell lysis during serum collection, separation or centrifugation. The likelihood that MDV DNA detected in serum represent intracellular form of MDV is high given the presence of cellular DNA in the sample. The presence of the latter is revealed by amplification of a portion of the cellular {beta}-globin gene. In its natural host, MDV replicates in B-lymphocytes and then persists in a latent state in T-lymphocytes in which MDV DNA integrates into chicken chromosomes (Delecluse & Hammerschmidt, 1993Down ). The status of MDV DNA detected in human blood has not been determined, but the possibility of integration of MDV DNA into the human genome cannot be excluded. This notion is supported by the identification of a GGGTTA repeat sequence in the genomic termini of MDV (Kishi et al., 1988Down ) that corresponds to telomeric sequences found in chickens, humans and other mammalian species. MDV integration sites have been observed at or near the telomeres of chicken chromosomes (Delecluse & Hammerschmidt, 1993Down ) implying telomeric integration of MDV, as has been observed for HHV-6 (Morris et al., 1999Down ). Furthermore, Daibata et al. (1999)Down recently described a case of vertical transmission of HHV-6 from two parents to their daughter. The HHV-6 DNA carried by the parents was integrated at two different chromosome loci which were identified in the child. Vertical transmission of MDV DNA has already been hypothesized for quail, where a portion of the MDV genome has been identified in the germline (Shih et al., 1989Down ). Knowing that in humans MDV DNA detection does not correlate with exposure to poultry and as exposure of the whole population to poultry is unlikely, chromosomal transmission of MDV-integrated DNA is a reasonable hypothesis.

Regardless of the status of MDV DNA in humans, our results demonstrate that MDV is or was able to cross the species barrier. This is not the first time that this has been described for herpesviruses: herpesvirus saimiri C, a primate lymphoproliferative herpesvirus, is known to induce tumours in rabbits (Medveczky et al., 1989Down ) and herpesvirus B, an enzootic virus in monkeys, is able to infect humans causing high mortality (Holmes et al., 1995Down ). Bovine herpesvirus-5 has recently been demonstrated to be infectious for sheep (Belak et al., 1999Down ) and a new fatal disease was described following the passage of an endotheliotropic herpesvirus from African to Asian elephants (Richman et al., 1999Down ). To test the possibility of MDV passing to species other than humans, we are currently testing whether MDV DNA is present in the blood of pigs, cattle and various domestic and wild birds. If animals are found to be MDV-positive, the status of the MDV genome in these hosts should also be determined. It should be noted that in a recent report Leary et al. (1999)Down found TT virus in the sera of cows, sheep, pigs and chickens. The discovery of ubiquitous agents, which may be benign for many hosts, will probably intensify with extensive use of the molecular tools.

Alignment of MDV-gD sequences amplified from avian and human sera demonstrated very weak divergence (between 0 and 1·6% divergence at the nucleotide level). This indicates that MDV genomes present in humans are not distinct from those found in chickens. However, it should not be forgotten that herpesviruses have a high degree of conservation of their genes. The gD sequence was chosen as the target sequence because of the large amount of product when amplified, because there is no significant identity between MDV-gD and gD of HHV and because gD is not essential for the oncogenicity and horizontal transmission of MDV (Anderson et al., 1998Down ). Thus, we hoped to observe a greater genetic diversity in gD sequences than in the sequences of other essential MDV genes. However, the weak divergence observed with MDV-gD sequences was similar in magnitude to that observed in many phylogenetic studies of HHV (Franti et al., 1998Down ; Lo et al., 1999Down ). For instance, the HHV-7 gB alleles have been defined on the basis of five nucleotide differences in 2700 bp (Franti et al., 1998Down ); Zong et al. (1999)Down have tested six gene loci in the HHV-8 (Kaposi’s sarcoma-associated herpesvirus, KSHV) genome, also showing a maximum of only 1 to 2% nucleotide variation. Complete sequences of different strains of MDV have been published recently (Lee et al., 2000Down ; Tulman et al., 2000Down ) and will be of use in finding a more variable sequence in the MDV genome.

Despite the weak divergence of MDV-gD sequences, we were able to define four groups on the basis of the same criteria previously used to define HHV-7 alleles (Franti et al., 1998Down ) and cytomegalovirus subtypes (Lo et al., 1999Down ). Of particular interest was the observation that two groups contained only human MDV-gD sequences. However, there were far fewer chicken samples than human samples (8 versus 41) so it is impossible to draw conclusions yet as to whether specific human groups exist. We are currently sequencing human and chicken MDV-gD amplicons from subjects differing in geographical origin and from whom samples were taken at different times.

The detection of MDV DNA in human sera revives the question as to whether avian oncogenic herpesviruses are involved in human lymphoproliferative disorders. At least two human herpesviruses (EBV and KSHV) show remarkably strong associations with some human cancers (Griffin & Xue, 1998Down ; Schulz, 1998Down ). We intend to determine the prevalence of the MDV genome in the blood of cancer patients versus healthy persons to investigate a potential relationship between the presence of MDV and unexplained human lymphomas.


   Acknowledgments
 
S. Laurent was supported by a Ligue contre le Cancer post-doctoral fellowship and this work was carried out within the Institut Fédératif de Recherche: Biologie comparée des transposons et des virus. We thank F. Coudert and members of Mutualité Sociale Agricole for providing their human serum collection, as well as S. Billard from the veterinary Réseau Cristal for sending us serum samples from MDV-infected chickens.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Anderson, A. S., Parcells, M. S. & Morgan, R. W.(1998). The glycoprotein D (US6) homolog is not essential for oncogenicity or horizontal transmission of Marek’s disease virus. Journal of Virology 72, 2548-2553.[Abstract/Free Full Text]

Belak, K., Kucsera, L., Ros, C., Kulcsar, G., Makranszki, L., Soos, T. & Belak, S.(1999). Studies on the pathogenicity of bovine herpesvirus type 5 in sheep. Comparative Immunology, Microbiology and Infectious Diseases 22, 207-220.[Medline]

Bruce, M. E., Will, R. G., Ironside, J. W., McConnell, I., Drummond, D., Suttie, A., McCardle, L., Chree, A., Hope, J., Birkett, C., Cousens, S., Fraser, H. & Bostock, C. J.(1997). Transmissions to mice indicate that ‘new variant’ CJD is caused by the BSE agent. Nature 389, 498-501.[Medline]

Brytting, M., Xu, W., Wahren, B. & Sundqvist, V. A.(1992). Cytomegalovirus DNA detection in sera from patients with active cytomegalovirus infections. Journal of Clinical Microbiology 30, 1937-1941.[Abstract/Free Full Text]

Calnek, B. W. & Witter, R. L. (1991). Neoplasic disease/Marek disease. In Disease of Poultry, pp. 342–385. Ames, IA: Iowa State University Press.

Cebrian, J., Kaschka-Dierich, C., Berthelot, N. & Sheldrick, P.(1982). Inverted repeat nucleotide sequences in the genomes of Marek disease virus and the herpesvirus of the turkey. Proceedings of the National Academy of Sciences, USA 79, 555-558.[Abstract/Free Full Text]

Choudat, D., Dambrine, G., Delemotte, B. & Coudert, F.(1996). Occupational exposure to poultry and prevalence of antibodies against Marek’s disease virus and avian leukosis retroviruses. Occupational and Environmental Medicine 53, 403-410.[Abstract]

Daibata, M., Taguchi, T., Nemoto, Y., Taguchi, H. & Miyoshi, I.(1999). Inheritance of chromosomally integrated human herpesvirus 6 DNA. Blood 94, 1545-1549.[Abstract/Free Full Text]

Davidson, I., Tanaka, A. & Nonoyama, M.(1995). Common antigenic epitopes are present on heat-labile oligomers of MDV glycoprotein B and on HSV glycoprotein B. Virus Research 35, 233-245.[Medline]

Delecluse, H. J. & Hammerschmidt, W.(1993). Status of Marek’s disease virus in established lymphoma cell lines: herpesvirus integration is common. Journal of Virology 67, 82-92.[Abstract/Free Full Text]

Erker, J. C., Desai, S. M. & Mushahwar, I. K.(1999). Rapid detection of hepatitis E virus RNA by reverse transcription-polymerase chain reaction using universal oligonucleotide primers. Journal of Virological Methods 81, 109-113.[Medline]

Franti, M., Aubin, J. T., Poirel, L., Gautheret-Dejean, A., Candotti, D., Huraux, J. M. & Agut, H.(1998). Definition and distribution analysis of glycoprotein B gene alleles of human herpesvirus 7. Journal of Virology 72, 8725-8730.[Abstract/Free Full Text]

Gan, Y. J., Sullivan, J. L. & Sixbey, J. W.(1994). Detection of cell-free Epstein-Barr virus DNA in serum during acute infectious mononucleosis. Journal of Infectious Diseases 170, 436-439.[Medline]

Griffin, B. E. & Xue, S. A.(1998). Epstein-Barr virus infections and their association with human malignancies: some key questions. Annals of Medicine 30, 249-259.[Medline]

Haque, T. & Crawford, D. H.(1997). PCR amplification is more sensitive than tissue culture methods for Epstein-Barr virus detection in clinical material. Journal of General Virology 78, 3357-3360.[Abstract]

Hennig, H., Wessel, K., Sondermeijer, P., Kirchner, H. & Wandinger, K. P.(1998). Lack of evidence for Marek’s disease virus genomic sequences in leukocyte DNA from multiple sclerosis patients in Germany. Neuroscience Letters 250, 138-140.[Medline]

Holmes, G. P., Chapman, L. E., Stewart, J. A., Straus, S. E., Hilliard, J. K. & Davenport, D. S.(1995). Guidelines for the prevention and treatment of B-virus infections in exposed persons. The B virus Working Group. Clinical Infectious Diseases 20, 421-439.[Medline]

Khan, A. S., Khabbaz, R. F., Armstrong, L. R., Holman, R. C., Bauer, S. P., Graber, J., Strine, T., Miller, G., Reef, S., Tappero, J., Rollin, P. E., Nichol, S. T., Zaki, S. R., Bryan, R. T., Chapman, L. E., Peters, C. J. & Ksiazek, T. G.(1996). Hantavirus pulmonary syndrome: the first 100 US cases. Journal of Infectious Diseases 173, 1297-1303.[Medline]

Kishi, M., Harada, H., Takahashi, M., Tanaka, A., Hayashi, M., Nonoyama, M., Josephs, S. F., Buchbinder, A., Schachter, F., Ablashi, D. V. and others (1988). A repeat sequence, GGGTTA, is shared by DNA of human herpesvirus 6 and Marek’s disease virus. Journal of Virology 62, 4824–4827.[Abstract/Free Full Text]

Leary, T. P., Erker, J. C., Chalmers, M. L., Desai, S. M. & Mushahwar, I. K.(1999). Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals. Journal of General Virology 80, 2115-2120.[Abstract/Free Full Text]

Lee, L. F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H. J. & Witter, R. L.(2000). The complete unique long sequence and the overall genomic organization of the GA strain of Marek’s disease virus. Proceedings of the National Academy of Sciences, USA 97, 6091-6096.[Abstract/Free Full Text]

Lo, S. K., Woo, P. C. & Yuen, K. Y.(1999). Hot spot mutations in morphological transforming region II (ORF 79) of cytomegalovirus strains causing disease from bone marrow transplant recipients. Archives of Virology 144, 601-612.[Medline]

McHatters, G. R. & Scham, R. G.(1995). Bird viruses in multiple sclerosis: combination of viruses or Marek’s alone? Neuroscience Letters 188, 75-76.[Medline]

Medveczky, M. M., Szomolanyi, E., Hesselton, R., DeGrand, D., Geck, P. & Medveczky, P. G.(1989). Herpesvirus saimiri strains from three DNA subgroups have different oncogenic potentials in New Zealand White rabbits. Journal of Virology 63, 3601-3611.[Abstract/Free Full Text]

Mendez, J. C., Espy, M. J., Smith, T. F., Wilson, J. A. & Paya, C. V.(1998). Evaluation of PCR primers for early diagnosis of cytomegalovirus infection following liver transplantation. Journal of Clinical Microbiology 36, 526-530.[Abstract/Free Full Text]

Morris, C., Luppi, M., McDonald, M., Barozzi, P. & Torelli, G.(1999). Fine mapping of an apparently targeted latent human herpesvirus type 6 integration site in chromosome band 17p13.3. Journal of Medical Virology 58, 69-75.[Medline]

Murray, K., Selleck, P., Hooper, P., Hyatt, A., Gould, A., Gleeson, L., Westbury, H., Hiley, L., Selvey, L., Rodwell, B. and others (1995). A morbillivirus that caused fatal disease in horses and humans. Science 268, 94–97.[Abstract/Free Full Text]

Osiowy, C., Prud’homme, I., Monette, M. & Zou, S.(1998). Detection of human herpesvirus 6 DNA in serum by a microplate PCR-hybridization assay. Journal of Clinical Microbiology 36, 68-72.[Abstract/Free Full Text]

Purchase, H. G. & Witter, R. L.(1986). Public health concerns from human exposure to oncogenic avian herpesviruses. Journal of the American Veterinary Medical Association 189, 1430-1436.[Medline]

Richman, L. K., Montali, R. J., Garber, R. L., Kennedy, M. A., Lehnhardt, J., Hildebrandt, T., Schmitt, D., Hardy, D., Alcendor, D. J. & Hayward, G. S.(1999). Novel endotheliotropic herpesviruses fatal for Asian and African elephants. Science 283, 1171-1176.[Abstract/Free Full Text]

Ross, L. J., Binns, M. M. & Pastorek, J.(1991). DNA sequence and organization of genes in a 5·5 kbp EcoRI fragment mapping in the short unique segment of Marek’s disease virus (strain RB1B). Journal of General Virology 72, 949-954.[Abstract/Free Full Text]

Schulz, T. F.(1998). Kaposi’s sarcoma-associated herpesvirus (human herpesvirus-8). Journal of General Virology 79, 1573-1591.[Medline]

Shih, J. C., Pyrzak, R. & Guy, J. S.(1989). Discovery of noninfectious viral genes complementary to Marek’s disease herpes virus in quail susceptible to cholesterol-induced atherosclerosis. Journal of Nutrition 119, 294-298.

Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Rock, D. L. & Kutish, G. F.(2000). The genome of a very virulent Marek’s disease virus. Journal of Virology 74, 7980-7988.[Abstract/Free Full Text]

Yuen, K. Y., Chan, P. K., Peiris, M., Tsang, D. N., Que, T. L., Shortridge, K. F., Cheung, P. T., To, W. K., Ho, E. T., Sung, R. & Cheng, A. F.(1998). Clinical features and rapid viral diagnosis of human disease associated with avian influenza A H5N1 virus. Lancet 351, 467-471.[Medline]

Zerbini, M., Gallinella, G., Manaresi, E., Musiani, M., Gentilomi, G. & Venturoli, S.(1999). Standardization of a PCR-ELISA in serum samples: diagnosis of active parvovirus B19 infection. Journal of Medical Virology 59, 239-244.[Medline]

Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S.(1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposi’s sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.[Abstract/Free Full Text]

Received 19 July 2000; accepted 27 September 2000.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
S. Laurent, E. Esnault, and D. Rasschaert
Single-nucleotide polymorphisms in two Marek's disease virus genes (Meq and gD): application to a retrospective molecular epidemiology study (1982-1999) in France
J. Gen. Virol., June 1, 2004; 85(6): 1387 - 1392.
[Abstract] [Full Text] [PDF]


Home page
Occup. Environ. Med.Home page
L Fritschi, S Fenwick, and M Bulsara
Mortality and cancer incidence in a cohort of meatworkers
Occup. Environ. Med., September 1, 2003; 60(9): e4 - 4.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
H. Hennig, N. Osterrieder, M. Muller-Steinhardt, H.-M. Teichert, H. Kirchner, and K.-P. Wandinger
Detection of Marek's Disease Virus DNA in Chicken but Not in Human Plasma
J. Clin. Microbiol., June 1, 2003; 41(6): 2428 - 2432.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Fragnet, M. A. Blasco, W. Klapper, and D. Rasschaert
The RNA Subunit of Telomerase Is Encoded by Marek's Disease Virus
J. Virol., May 15, 2003; 77(10): 5985 - 5996.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laurent, S.
Right arrow Articles by Rasschaert, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laurent, S.
Right arrow Articles by Rasschaert, D.
Agricola
Right arrow Articles by Laurent, S.
Right arrow Articles by Rasschaert, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS