|
|
||||||||
Animal: DNA Viruses |
Laboratoire de Virologie et Barrière dEspèce, Station de Pathologie aviaire et de parasitologie, INRA, Centre de recherches de Tours, 37380 Nouzilly, France1
Laboratoire de Virologie et dOncogénèse Aviaire, Station de Pathologie aviaire et de parasitologie, INRA, Centre de recherches de Tours, France2
Département de Microbiologie Médicale et Moléculaire, Faculté de Médecine de Tours, France3
Département Médecine du Travail, Faculté de Médecine Cochin-Port Royal, Paris 14ème, France4
Authors for correspondence: D. Rasschaert and S. Laurent. Fax +33 02 47 42 77 74. e-mail rasschae{at}tours.inra.fr and slaurent@tours.inra.fr
Authors for correspondence: D. Rasschaert and S. Laurent. Fax +33 02 47 42 77 74. e-mail rasschae{at}tours.inra.fr and slaurent@tours.inra.fr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Since the first isolation of MDV in 1967, many studies have investigated whether MDV can spread to humans and whether there is a correlation between human cancers and exposure to MDV (Purchase & Witter, 1986
). Most previous studies support the conclusion that MDV does not spread to humans and that there is no relationship between avian herpesvirus and human cancer. However, it should be pointed out that all of these studies were carried out using immunological, virological or epidemiological methods that may not be the most sensitive or appropriate methods for detecting MDV in humans, and indeed, Purchase & Witter (1986)
stated that there is no convincing evidence for rejecting the hypothesis that avian herpesvirus are not a public health problem. As they further suggested, a new way to attempt to resolve this issue is to use molecular tools. The aim of this study was to use sensitive molecular biology methods to determine whether MDV genomic DNA sequences are detectable in human blood. The amplification of nucleic acid extracted directly from serum samples is increasingly being used for virus detection [e.g. parvovirus (Zerbini et al., 1999
) and hepatitis E virus (Erker et al., 1999
)]. Such methods have been successfully developed for the detection of human lymphotropic herpesviruses such as EpsteinBarr virus (EBV; Gan et al., 1994
), cytomegalovirus (Brytting et al., 1992
) and human herpesvirus (HHV)-6 (Osiowy et al., 1998
).
We have used a similar approach to investigate whether avian lymphotropic herpesvirus DNA was present in human sera. An MDV-specific nested-PCR for detection of a portion of the MDV-gD gene was developed. This was used to amplify MDV-gD sequence in DNA extracted from 202 human sera. The specificity of the MDV-gD sequence amplified was verified by sequencing and a multiple sequence alignment was performed for MDV sequences of avian and human origin.
| Methods |
|---|
|
|
|---|
Human serum samples.
Chicken samples.
Five serum samples (p8508, p8507, p8518, p10230 and p10426) were collected in 19981999 from chickens with clinical signs of Mareks disease. The diagnosis of Mareks disease was further confirmed by histopathological studies. The chickens came from different poultry farms in the west of France. Serum from a laboratory SPF-chicken was used as a negative control in the PCR test and DNA was also extracted from a non-pathogenic MDV vaccine strain (CVI-988).
Extraction of DNA and amplification of MDV DNA.
Serum (500 µl) was incubated with 500 µg/ml proteinase K, 0·5% SDS and 10 mM Tris, pH 8 for 2 h at 70 °C. Nucleic acid was then extracted with phenol-chloroform followed by ethanol precipitation. The resulting pellet was suspended in 50 µl of water.
Serum DNA extracts were used for nested-PCR in which a portion of the gD gene of the MDV genome (strain RB1B) (Ross et al., 1991
) was specifically amplified. The first round of PCR was performed with the primer pair gDF (5 ATGAAAACCTCCGGGCTACTCTC 3) and gDR (5 GATTATTGCAGCACCCAGT 3); this yielded a 383 bp fragment. The second round of nested-PCR was performed with the primer pair gDNF (5 ATGAATACAAAATCCCGTCTCC 3) and gDNR (5 GTCCCTAGGATGGTGGGATAG 3), resulting in amplification of a 295 bp fragment. All PCRs were performed in a final volume of 30 µl including 5 µl of DNA extract or 5 µl products of the first round of PCR, 0·05 U/µl Taq polymerase (Promega), 1 pmol/µl of each primer, 200 mM of each dNTP, 10 mM TrisHCl (pH 9), 50 mM KCl, 0·1% Triton X-100 and 1·5 mM MgCl2. Thermocycling conditions were as follows: (i) 30 cycles of 45 s of denaturation at 94 °C, 1 min of annealing at 59 °C and 1 min of extension at 72 °C for each cycle; (ii) a final extension step of 10 min at 72 °C.
As a positive control, the gD gene of MDV strain RB1B (Ross et al., 1991
) was inserted into the pGEM cloning vector (Promega) to produce pGEM-gD. Serial dilutions of plasmid were used to determine the detection threshold of the technique. A positive control for each PCR assay was performed using the dilution of plasmid that resulted in the detection of a PCR product only by nested-PCR.
Standard precautions were used (i.e. manipulations in separate rooms, use of aerosol-barrier tips, mineral oil, gloves) were used to prevent possible PCR contamination and false-positive results.
We identified false-negative results due to the presence of PCR inhibitors or too little DNA using PCR to amplify a 125 bp fragment of the human
-globin gene (V00500) from each human serum DNA extract with the primer pair
-gF (5 GGGCAACCCTAAGGTGAAGGC 3) and
-gR (5 GAGCTGCACTGTGACAAGCTGC 3) and the thermocycling conditions described above.
Analysis of amplified products.
All PCR products were separated electrophoretically in 2 or 3% agarose gels containing ethidium bromide.
PCR products were sequenced by the dye-terminator method (Perkin-Elmer) using amplicons separated on agarose gel and directly extracted from the gel with a purification kit (Amicon).
| Results |
|---|
|
|
|---|
|
-globin gene (Fig. 1C
-globin by PCR. Nested-PCR gD amplification from DNA extracted from human sera yielded a single 295 bp band, as observed with the DNA extracted from chicken sera (Fig. 1D
To ensure that there was no PCR contamination, assays were carried out in laboratories in a different building. For that purpose, we tested a panel of 20 human sera chosen at random from the sera collected in 19901991 (Choudat et al., 1996
), but which had not been selected for this study. A nested-PCR test was performed with newly purchased primer sets, PCR apparatus and the PCR reagents currently used in these other laboratories where MDV had never been manipulated. The results of the test confirmed our previous observations as 3 of the 20 sera tested positive for MDV (data not shown). Moreover, to ensure that there was no plasmid contamination, a nested-PCR assay was performed using 10 serum samples from MDV-positive subjects, the T7 primer located downstream from the gD gene and the two reverse primers of our nested-PCR test. As expected, no PCR product was detectable with sera whereas the dilution of gD-plasmid used as a control in the nested-PCR assay gave a strong signal (Fig. 1E
).
Detection of MDV DNA in human sera
The MDV-gD target sequence was amplified from all categories of serum tested, regardless of whether the individual had been occupationally exposed to poultry or not (Table 1
). For the entire collection, 41 of the 202 sera (20%) tested positive for MDV DNA. The distribution of MDV-DNA-positive sera did not depend on occupational exposure to poultry. In the poultry-exposed group, 26 of the 137 sera (19%) were positive for gD DNA and in the group not exposed to poultry, 15 of the 65 sera (23%) were positive for gD DNA. No significant difference in the frequency of MDV DNA detection was observed between men and women. MDV DNA was detected in 28 of 131 serum samples (21%) collected from men and in 13 of 71 serum samples (18%) collected from women. Similarly, age did not affect MDV DNA detection (Table 2
).
|
|
Cys) and the hot-spot mutation at nt 130 changed the ATG codon to a GTG codon (Met
Val). The other two hot-spot mutations (nt 69 and nt 159) were silent and were linked (always simultaneously muted). Four groups (A, B, C and D) were defined accordingly to these four characteristic hot-spot. Group A clustered 58·5% of the gD sequences whereas groups B, C and D clustered 17, 15 and 10% respectively. Both groups A and C clustered avian and human gD sequence whereas only human gD sequences were present in groups B and D. However, it should be noted that only eight avian sequences were analysed versus 41 human sequences. Hence, too few chicken samples were analysed to draw firm conclusions about the existence of specific human MDV groups. A larger number of samples should be analysed.
|
| Discussion |
|---|
|
|
|---|
Using PCR, we found no differences in the prevalence of MDV DNA in human sera from poultry-exposed or non-exposed individuals. There was also no difference in prevalence due to sex or age of the subjects. In all cases, MDV DNA was detected with a frequency of approximately 20%. Our results did not correlate with the previous immunological analysis of the same set of human sera, in which the prevalence of antibodies against MDV was found to be significantly higher in the poultry-exposed group than in the unexposed group (Choudat et al., 1996
). However, MDV was present at a very high density in the air at the chicken farms and slaughterhouses where the exposed group worked, and poultry workers continuously inhaled virus particles during their work. Therefore, an immune reaction, corresponding to antibody production against inert circulating antigen, may account for the high prevalence of antibodies against MDV in the sera of poultry-exposed individuals (Choudat et al., 1996
). Furthermore, it should be noted that several MDV and HHV proteins have epitopes in common (Davidson et al., 1995
; McHatters & Scham, 1995
).
PCR detects DNA from free virus circulating in the blood and also from intracellular virus, as a result of cell lysis during serum collection, separation or centrifugation. The likelihood that MDV DNA detected in serum represent intracellular form of MDV is high given the presence of cellular DNA in the sample. The presence of the latter is revealed by amplification of a portion of the cellular
-globin gene. In its natural host, MDV replicates in B-lymphocytes and then persists in a latent state in T-lymphocytes in which MDV DNA integrates into chicken chromosomes (Delecluse & Hammerschmidt, 1993
). The status of MDV DNA detected in human blood has not been determined, but the possibility of integration of MDV DNA into the human genome cannot be excluded. This notion is supported by the identification of a GGGTTA repeat sequence in the genomic termini of MDV (Kishi et al., 1988
) that corresponds to telomeric sequences found in chickens, humans and other mammalian species. MDV integration sites have been observed at or near the telomeres of chicken chromosomes (Delecluse & Hammerschmidt, 1993
) implying telomeric integration of MDV, as has been observed for HHV-6 (Morris et al., 1999
). Furthermore, Daibata et al. (1999)
recently described a case of vertical transmission of HHV-6 from two parents to their daughter. The HHV-6 DNA carried by the parents was integrated at two different chromosome loci which were identified in the child. Vertical transmission of MDV DNA has already been hypothesized for quail, where a portion of the MDV genome has been identified in the germline (Shih et al., 1989
). Knowing that in humans MDV DNA detection does not correlate with exposure to poultry and as exposure of the whole population to poultry is unlikely, chromosomal transmission of MDV-integrated DNA is a reasonable hypothesis.
Regardless of the status of MDV DNA in humans, our results demonstrate that MDV is or was able to cross the species barrier. This is not the first time that this has been described for herpesviruses: herpesvirus saimiri C, a primate lymphoproliferative herpesvirus, is known to induce tumours in rabbits (Medveczky et al., 1989
) and herpesvirus B, an enzootic virus in monkeys, is able to infect humans causing high mortality (Holmes et al., 1995
). Bovine herpesvirus-5 has recently been demonstrated to be infectious for sheep (Belak et al., 1999
) and a new fatal disease was described following the passage of an endotheliotropic herpesvirus from African to Asian elephants (Richman et al., 1999
). To test the possibility of MDV passing to species other than humans, we are currently testing whether MDV DNA is present in the blood of pigs, cattle and various domestic and wild birds. If animals are found to be MDV-positive, the status of the MDV genome in these hosts should also be determined. It should be noted that in a recent report Leary et al. (1999)
found TT virus in the sera of cows, sheep, pigs and chickens. The discovery of ubiquitous agents, which may be benign for many hosts, will probably intensify with extensive use of the molecular tools.
Alignment of MDV-gD sequences amplified from avian and human sera demonstrated very weak divergence (between 0 and 1·6% divergence at the nucleotide level). This indicates that MDV genomes present in humans are not distinct from those found in chickens. However, it should not be forgotten that herpesviruses have a high degree of conservation of their genes. The gD sequence was chosen as the target sequence because of the large amount of product when amplified, because there is no significant identity between MDV-gD and gD of HHV and because gD is not essential for the oncogenicity and horizontal transmission of MDV (Anderson et al., 1998
). Thus, we hoped to observe a greater genetic diversity in gD sequences than in the sequences of other essential MDV genes. However, the weak divergence observed with MDV-gD sequences was similar in magnitude to that observed in many phylogenetic studies of HHV (Franti et al., 1998
; Lo et al., 1999
). For instance, the HHV-7 gB alleles have been defined on the basis of five nucleotide differences in 2700 bp (Franti et al., 1998
); Zong et al. (1999)
have tested six gene loci in the HHV-8 (Kaposis sarcoma-associated herpesvirus, KSHV) genome, also showing a maximum of only 1 to 2% nucleotide variation. Complete sequences of different strains of MDV have been published recently (Lee et al., 2000
; Tulman et al., 2000
) and will be of use in finding a more variable sequence in the MDV genome.
Despite the weak divergence of MDV-gD sequences, we were able to define four groups on the basis of the same criteria previously used to define HHV-7 alleles (Franti et al., 1998
) and cytomegalovirus subtypes (Lo et al., 1999
). Of particular interest was the observation that two groups contained only human MDV-gD sequences. However, there were far fewer chicken samples than human samples (8 versus 41) so it is impossible to draw conclusions yet as to whether specific human groups exist. We are currently sequencing human and chicken MDV-gD amplicons from subjects differing in geographical origin and from whom samples were taken at different times.
The detection of MDV DNA in human sera revives the question as to whether avian oncogenic herpesviruses are involved in human lymphoproliferative disorders. At least two human herpesviruses (EBV and KSHV) show remarkably strong associations with some human cancers (Griffin & Xue, 1998
; Schulz, 1998
). We intend to determine the prevalence of the MDV genome in the blood of cancer patients versus healthy persons to investigate a potential relationship between the presence of MDV and unexplained human lymphomas.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Belak, K., Kucsera, L., Ros, C., Kulcsar, G., Makranszki, L., Soos, T. & Belak, S.(1999). Studies on the pathogenicity of bovine herpesvirus type 5 in sheep. Comparative Immunology, Microbiology and Infectious Diseases 22, 207-220.[Medline]
Bruce, M. E., Will, R. G., Ironside, J. W., McConnell, I., Drummond, D., Suttie, A., McCardle, L., Chree, A., Hope, J., Birkett, C., Cousens, S., Fraser, H. & Bostock, C. J.(1997). Transmissions to mice indicate that new variant CJD is caused by the BSE agent. Nature 389, 498-501.[Medline]
Brytting, M., Xu, W., Wahren, B. & Sundqvist, V. A.(1992). Cytomegalovirus DNA detection in sera from patients with active cytomegalovirus infections. Journal of Clinical Microbiology 30, 1937-1941.
Calnek, B. W. & Witter, R. L. (1991). Neoplasic disease/Marek disease. In Disease of Poultry, pp. 342385. Ames, IA: Iowa State University Press.
Cebrian, J., Kaschka-Dierich, C., Berthelot, N. & Sheldrick, P.(1982). Inverted repeat nucleotide sequences in the genomes of Marek disease virus and the herpesvirus of the turkey. Proceedings of the National Academy of Sciences, USA 79, 555-558.
Choudat, D., Dambrine, G., Delemotte, B. & Coudert, F.(1996). Occupational exposure to poultry and prevalence of antibodies against Mareks disease virus and avian leukosis retroviruses. Occupational and Environmental Medicine 53, 403-410.[Abstract]
Daibata, M., Taguchi, T., Nemoto, Y., Taguchi, H. & Miyoshi, I.(1999). Inheritance of chromosomally integrated human herpesvirus 6 DNA. Blood 94, 1545-1549.
Davidson, I., Tanaka, A. & Nonoyama, M.(1995). Common antigenic epitopes are present on heat-labile oligomers of MDV glycoprotein B and on HSV glycoprotein B. Virus Research 35, 233-245.[Medline]
Delecluse, H. J. & Hammerschmidt, W.(1993). Status of Mareks disease virus in established lymphoma cell lines: herpesvirus integration is common. Journal of Virology 67, 82-92.
Erker, J. C., Desai, S. M. & Mushahwar, I. K.(1999). Rapid detection of hepatitis E virus RNA by reverse transcription-polymerase chain reaction using universal oligonucleotide primers. Journal of Virological Methods 81, 109-113.[Medline]
Franti, M., Aubin, J. T., Poirel, L., Gautheret-Dejean, A., Candotti, D., Huraux, J. M. & Agut, H.(1998). Definition and distribution analysis of glycoprotein B gene alleles of human herpesvirus 7. Journal of Virology 72, 8725-8730.
Gan, Y. J., Sullivan, J. L. & Sixbey, J. W.(1994). Detection of cell-free Epstein-Barr virus DNA in serum during acute infectious mononucleosis. Journal of Infectious Diseases 170, 436-439.[Medline]
Griffin, B. E. & Xue, S. A.(1998). Epstein-Barr virus infections and their association with human malignancies: some key questions. Annals of Medicine 30, 249-259.[Medline]
Haque, T. & Crawford, D. H.(1997). PCR amplification is more sensitive than tissue culture methods for Epstein-Barr virus detection in clinical material. Journal of General Virology 78, 3357-3360.[Abstract]
Hennig, H., Wessel, K., Sondermeijer, P., Kirchner, H. & Wandinger, K. P.(1998). Lack of evidence for Mareks disease virus genomic sequences in leukocyte DNA from multiple sclerosis patients in Germany. Neuroscience Letters 250, 138-140.[Medline]
Holmes, G. P., Chapman, L. E., Stewart, J. A., Straus, S. E., Hilliard, J. K. & Davenport, D. S.(1995). Guidelines for the prevention and treatment of B-virus infections in exposed persons. The B virus Working Group. Clinical Infectious Diseases 20, 421-439.[Medline]
Khan, A. S., Khabbaz, R. F., Armstrong, L. R., Holman, R. C., Bauer, S. P., Graber, J., Strine, T., Miller, G., Reef, S., Tappero, J., Rollin, P. E., Nichol, S. T., Zaki, S. R., Bryan, R. T., Chapman, L. E., Peters, C. J. & Ksiazek, T. G.(1996). Hantavirus pulmonary syndrome: the first 100 US cases. Journal of Infectious Diseases 173, 1297-1303.[Medline]
Kishi, M., Harada, H., Takahashi, M., Tanaka, A., Hayashi, M., Nonoyama, M., Josephs, S. F., Buchbinder, A., Schachter, F., Ablashi, D. V. and others (1988). A repeat sequence, GGGTTA, is shared by DNA of human herpesvirus 6 and Mareks disease virus. Journal of Virology 62, 48244827.
Leary, T. P., Erker, J. C., Chalmers, M. L., Desai, S. M. & Mushahwar, I. K.(1999). Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals. Journal of General Virology 80, 2115-2120.
Lee, L. F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H. J. & Witter, R. L.(2000). The complete unique long sequence and the overall genomic organization of the GA strain of Mareks disease virus. Proceedings of the National Academy of Sciences, USA 97, 6091-6096.
Lo, S. K., Woo, P. C. & Yuen, K. Y.(1999). Hot spot mutations in morphological transforming region II (ORF 79) of cytomegalovirus strains causing disease from bone marrow transplant recipients. Archives of Virology 144, 601-612.[Medline]
McHatters, G. R. & Scham, R. G.(1995). Bird viruses in multiple sclerosis: combination of viruses or Mareks alone? Neuroscience Letters 188, 75-76.[Medline]
Medveczky, M. M., Szomolanyi, E., Hesselton, R., DeGrand, D., Geck, P. & Medveczky, P. G.(1989). Herpesvirus saimiri strains from three DNA subgroups have different oncogenic potentials in New Zealand White rabbits. Journal of Virology 63, 3601-3611.
Mendez, J. C., Espy, M. J., Smith, T. F., Wilson, J. A. & Paya, C. V.(1998). Evaluation of PCR primers for early diagnosis of cytomegalovirus infection following liver transplantation. Journal of Clinical Microbiology 36, 526-530.
Morris, C., Luppi, M., McDonald, M., Barozzi, P. & Torelli, G.(1999). Fine mapping of an apparently targeted latent human herpesvirus type 6 integration site in chromosome band 17p13.3. Journal of Medical Virology 58, 69-75.[Medline]
Murray, K., Selleck, P., Hooper, P., Hyatt, A., Gould, A., Gleeson, L., Westbury, H., Hiley, L., Selvey, L., Rodwell, B. and others (1995). A morbillivirus that caused fatal disease in horses and humans. Science 268, 9497.
Osiowy, C., Prudhomme, I., Monette, M. & Zou, S.(1998). Detection of human herpesvirus 6 DNA in serum by a microplate PCR-hybridization assay. Journal of Clinical Microbiology 36, 68-72.
Purchase, H. G. & Witter, R. L.(1986). Public health concerns from human exposure to oncogenic avian herpesviruses. Journal of the American Veterinary Medical Association 189, 1430-1436.[Medline]
Richman, L. K., Montali, R. J., Garber, R. L., Kennedy, M. A., Lehnhardt, J., Hildebrandt, T., Schmitt, D., Hardy, D., Alcendor, D. J. & Hayward, G. S.(1999). Novel endotheliotropic herpesviruses fatal for Asian and African elephants. Science 283, 1171-1176.
Ross, L. J., Binns, M. M. & Pastorek, J.(1991). DNA sequence and organization of genes in a 5·5 kbp EcoRI fragment mapping in the short unique segment of Mareks disease virus (strain RB1B). Journal of General Virology 72, 949-954.
Schulz, T. F.(1998). Kaposis sarcoma-associated herpesvirus (human herpesvirus-8). Journal of General Virology 79, 1573-1591.[Medline]
Shih, J. C., Pyrzak, R. & Guy, J. S.(1989). Discovery of noninfectious viral genes complementary to Mareks disease herpes virus in quail susceptible to cholesterol-induced atherosclerosis. Journal of Nutrition 119, 294-298.
Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Rock, D. L. & Kutish, G. F.(2000). The genome of a very virulent Mareks disease virus. Journal of Virology 74, 7980-7988.
Yuen, K. Y., Chan, P. K., Peiris, M., Tsang, D. N., Que, T. L., Shortridge, K. F., Cheung, P. T., To, W. K., Ho, E. T., Sung, R. & Cheng, A. F.(1998). Clinical features and rapid viral diagnosis of human disease associated with avian influenza A H5N1 virus. Lancet 351, 467-471.[Medline]
Zerbini, M., Gallinella, G., Manaresi, E., Musiani, M., Gentilomi, G. & Venturoli, S.(1999). Standardization of a PCR-ELISA in serum samples: diagnosis of active parvovirus B19 infection. Journal of Medical Virology 59, 239-244.[Medline]
Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S.(1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposis sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.
Received 19 July 2000;
accepted 27 September 2000.
This article has been cited by other articles:
![]() |
S. Laurent, E. Esnault, and D. Rasschaert Single-nucleotide polymorphisms in two Marek's disease virus genes (Meq and gD): application to a retrospective molecular epidemiology study (1982-1999) in France J. Gen. Virol., June 1, 2004; 85(6): 1387 - 1392. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Fritschi, S Fenwick, and M Bulsara Mortality and cancer incidence in a cohort of meatworkers Occup. Environ. Med., September 1, 2003; 60(9): e4 - 4. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hennig, N. Osterrieder, M. Muller-Steinhardt, H.-M. Teichert, H. Kirchner, and K.-P. Wandinger Detection of Marek's Disease Virus DNA in Chicken but Not in Human Plasma J. Clin. Microbiol., June 1, 2003; 41(6): 2428 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fragnet, M. A. Blasco, W. Klapper, and D. Rasschaert The RNA Subunit of Telomerase Is Encoded by Marek's Disease Virus J. Virol., May 15, 2003; 77(10): 5985 - 5996. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |