|
|
||||||||
Animal: RNA Viruses |
Centro de Investigación en Sanidad Animal, INIA, 28130 Valdeolmos, Madrid, Spain1
Centro de Biología Molecular Severo Ochoa (CSIC-UAM), Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain2
Author for correspondence: Encarnación Martínez-Salas. Fax +34 91 3974799. e-mail emartinez{at}cbm.uam.es
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The FMDV genome consists of a single molecule of messenger-sense RNA of about 8500 nt containing a single ORF encoding the viral polyprotein, which is subsequently processed into the viral products (Ryan et al., 1989
). The 5' end of the RNA is covalently linked to a small viral protein (VPg) (Sangar et al., 1977
). The 5' noncoding region (NCR), about 1200 nt in length, is highly structured (Clarke et al., 1987
) and contains several genetic elements necessary to control essential functions in the replication cycle. This region harbours an internal ribosome entry site (IRES) element that promotes the cap-independent translation initiation of the viral genome (Kühn et al., 1990
; López de Quinto & Martínez-Salas, 1997
). Immediately downstream of the stop codon at the end of the polyprotein ORF is a 3' NCR of about 90 nt followed by a genetically encoded poly(A) tract (Chatterjee et al., 1976
).
The picornavirus 3' NCR has been predicted to contain stable secondary and tertiary structures by computer algorithms and biochemical structure probing (Pilipenko et al., 1992
; Todd & Semler, 1996
). A cis-acting determinant for replication is believed to reside in the 3' NCR where primary sequence and/or higher order motifs are presumably recognized by the replication complex in order to initiate the synthesis of the negative-strand RNA (Richards & Ehrenfeld, 1990
; Rohll et al., 1995
). Engineered disruption of the relevant structures predicted in this region results in an impairment of the replicative capacity of the viral genome (Rohll et al., 1995
; Pierangeli et al., 1995
).
Binding of viral proteins, or their precursors, to the 3' NCR has been reported for encephalomyocarditis virus (Cui et al., 1993
) and poliovirus (PV) (Harris et al., 1994
). In addition, picornavirus 3' NCR interacts with host proteins. A complex of proteins binds to human rhinovirus type 14 (HRV14) and PV1 3' NCRs and a deletion mutant in this region exhibited reduced binding capacity and a defective replication phenotype (Todd et al., 1995
). Likewise, cellular factors interact with the 3' NCR of PV3, HRV14 and coxsackievirus B4 (CB4) and mutations reducing binding affinity had a deleterious effect on virus replication (Mellits et al., 1998
). A nucleolar protein, nucleolin, has been shown to bind poliovirus 3' NCR. Relocalization of nucleolin induced by virus infection seems to play a role in the early stages of the virus replication cycle (Waggoner & Sarnow, 1998
). The functional significance of those interactions remains to be determined, although some of them may play an important role in regulating the initiation of the negative-strand once the cis-elements have mediated the first recognition event or in modulating the specificity of this process.
Moreover, internal cis-acting replication elements (CREs) located in the picornavirus genome coding region are now being identified. This is the case with a hairpin structure in the HRV14 capsid protein precursor (McKnight & Lemon, 1998
), in the VP2 coding sequence of two cardioviruses (Lobert et al., 1999
) or a similar element located in the PV 2C coding region (Goodfellow et al., 2000
). These findings contribute to highlight the complexity of a process in which different viral and cellular factors contribute to promote efficient initiation of negative-strand RNA synthesis (Agol et al., 1999
).
Little is known about the role of the 3' NCR in aphthoviruses although some experimental evidence supports its relevance in the FMDV replication cycle. RNA transcripts spanning the 3'-terminal region of the FMDV genome, in both sense and antisense orientations, have been reported to inhibit infective particle formation following co-microinjection or co-transfection with viral RNA in BHK-21 cells (Gutiérrez et al., 1994
). Inhibition of virus yield was also observed in FMDV-infected cells transiently expressing the interfering RNAs (Bigeriego et al., 1999
).
In this report, we have examined the role of the 3' NCR of FMDV in the virus replication cycle by the deletion of this element and by its substitution with its counterpart of another swine picornavirus, SVDV, in a full-length infectious cDNA clone of FMDV. The effects of those alterations on replication and translation have been followed by infectivity and RNA analysis.
| Methods |
|---|
|
|
|---|
Construction of plasmids.
|
74, pDM was digested with StuI and EcoRV and the large fragment released was religated using T4 DNA ligase. The resulting clone has a deletion of most of the 3' NCR element (74 nt). Thus, only 15 virus residues remain between the stop codon and the poly(A) tract.
Prior to the construction of plasmid pCHIM, construct pTAG was made by recombinant PCR (Kunkel, 1985
) using pDM as a template and primer pairs OL-1 (5' CGGACCGCAAATTGGCTCAGCGG 3') with ILAV (5' CCTCTGAGGGCCTAGGCGTCA 3') and IRAV (5' TGACGCCTAGGCCCTCAGAGG 3') with ILE-1 (5' TTTTTGGATATCAAGGAAGCGGGAAAAACCC 3'), respectively. The bold letters indicate nucleotides that were substituted in order to create the underlined AvrII site at nt -2 from the stop codon. A unique CelII site at position 635, relative to the first nucleotide of the 3D gene sequence (Fig. 1
), was used for the 5' insertion of the PCR products. The final PCR product was digested with CelII and EcoRV (sites underlined in external primers OL-1 and ILE-1, respectively) and ligated into the pDM clone in which the fragment CelIIEcoRV had been previously excised. Thus, plasmid pTAG contains a unique AvrII site spanning the stop codon, which changes TAA in the original construct to TAG.
cDNA containing the 3' NCR of SVDV was amplified by RTPCR from viral RNA of strain UK (Seechurn et al., 1990
) using primers SVDCHIM-R (5' TTTTTTTTTTTTTTTGATATCCGCACCGAATACGG 3') and SVDCHIM-L (5' GGACTCCTTTTAACCTAGGAATTAGAGCACAATTAG 3'), which introduce the underlined EcoRV and AvrII sites, respectively. The RTPCR product was then digested with AvrII and EcoRV and cloned into pTAG in which the fragment AvrIIEcoRV had been excised. The resulting plasmid, pCHIM, has the 3' NCR of SVDV inserted into the FMDV infectious clone and only a G residue remains between the stop codon and the aphthoviral sequence. In the 3' end, 6 nt corresponding to the FMDV 3' NCR remain preceding the poly(A) tract.
All plasmids were transformed into E. coli strain DH5
cells and sequenced along the 3' modified region using the fmol DNA cycle sequencing system (Promega). Prediction of secondary structures in the 3' NCR of the different constructs was performed using the M-Fold program of the GCG package. The average length of the poly(A) tract in all the constructs was 58 nt.
In vitro RNA transcription.
Synthetic RNAs were obtained by transcribing HpaI-linearized plasmids with SP6 RNA polymerase (Promega), according to the manufacturers instructions. After transcription, the reaction mixture was incubated with RQ1 DNase (1 U/µg RNA) (Promega). RNAs were then phenolchloroform-extracted and ethanol-precipitated. RNA integrity and concentration were determined by native agarose gel electrophoresis.
Cells and transfections.
Cells were cultured in Dulbeccos modified Eagles medium supplemented with 2 to 5% foetal bovine serum and 1 mM HEPES pH 7·4. Semiconfluent (80%) BHK-21 or IBRS-2 (a swine-derived cell line) cell monolayers, split 1 day prior to transfection, were transfected with 3 to 5 µg of transcripts. Liposome-mediated transfection (Rose et al., 1991
) was performed as described (López de Quinto & Martínez-Salas, 1997
) and transfected cells were incubated at 37 °C or 34 °C until cytopathic effect (CPE) was observed. For those mutants that did not induce a visible CPE, new rounds of amplification were performed collecting separately the transfection medium and the monolayers lysed by three cycles of freezethawing. The lysate and the transfection medium were transferred independently onto fresh cell monolayers.
Infection of suckling mice.
Virus used as the inoculum was produced by transfection of RNA onto BHK-21 cells followed by two rounds of amplification. Groups of 12 mice, 7-day-old, were inoculated intraperitoneally with 100 µl of a virus dilution in PBS. Dead animals were scored from 2 to 7 days after inoculation. LD50 corresponds to virus titre required to kill 50% of the inoculated animals.
In vitro translation.
About 200 and 400 ng of each transcript was translated in 10 µl of rabbit reticulocyte lysate (Promega) in the presence of 10 µCi of [35S]methionine (10 mCi/ml). Reaction mixtures were incubated at 30 °C for 1 h. Aliquots of the translation products were loaded onto a 12% SDSpolyacrylamide gel. The gels were then dried and exposed to X-ray films (Agfa Curix RP2).
Northern blot.
Extracts from transfected cells (about 1x106), frozen at different times post-transfection, were prepared in 260 µl of 0·5% NP-40, 120 mM NaCl and 50 mM TrisHCl, pH 7·8. The lysate was then centrifuged at 12000 r.p.m. for 5 min and total cytoplasmic RNA was purified from the supernatant with TRI Reagent (Sigma).
Aliquots of RNAs (12·5% of each sample) were resolved through a formaldehyde gel and blotted onto a nylon Zeta probe membrane (Bio-Rad) using the vacublot XL system (Pharmacia). The probe was prepared by PCR using the 932 bp CelIIHpaI fragment from pSP65FMDVpolyC as a template (about 200 ng) and the antisense primer I-18 (5' GCCACCACGATGTCGTCTCC 3') in the presence of 50 µCi of [
-32P]dCTP (6000 Ci/mmol; Amersham). The probe was subsequently purified using a Nick column (Pharmacia). The resulting probe is a single-stranded DNA fragment of 392 nt complementary to nt 8171207 of the 3Dpol gene. About 5x106 c.p.m. of the probe was added to the hybridization solution (50% formamide in 0·12 M Na2HPO4, pH 7·2, 0·25 M NaCl, 7% SDS) and incubated overnight at 42 °C. The membrane was then washed three times for 5 min at room temperature with 2x SSC/0·1% SDS; 0·5x SSC/0·1% SDS; 0·1x SSC/0·1% SDS, respectively, and exposed to X-ray film.
RTPCR analysis of viral RNA.
Serial dilutions of the total cytoplasmic RNA extracted as above were analysed by RTPCR to determine the best signal to background ratio (data not shown). Basically, RNAs (1 µl of a 1/10 dilution) were heated at 93 °C for 2 min with 10 pmol of the antisense primer I-18 in a final volume of 10 µl, then cooled down at room temperature for 10 min prior to RT for 1 h in a 20 µl reaction containing 50 mM TrisHCl, pH 8·3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM each dNTP, 40 U of RNasin RNase inhibitor (Promega) and 20 U of SuperScript II RNase H- reverse transcriptase (Gibco BRL).
For PCR amplification, 1/5 to 1/10 of the RT reaction was used in the 50 µl PCR mixture containing 10 mM TrisHCl, pH 8·3, 50 mM KCl, 1·5 mM MgCl2, 0·2 mM each dNTP, 20 pmol each of the respective primers and 5 U of AmpliTaq DNA polymerase (Perkin Elmer). Samples were amplified in a UNO-thermoblock (Biometra) using a program that included an initial incubation at 94 °C for 10 min and 72 °C for 2 min (the enzyme was added at this point), followed by 30 cycles of denaturation at 94 °C for 1·5 min, annealing at 50 °C for 1 min and extension at 72 °C for 1·5 min. All the RTPCR products were dependent on the presence of reverse transcriptase in the reaction mixture (data not shown), proving the specificity for RNA templates.
The primers used for the PCR analysis of viral RNA were D3-I(-) (5' GTACTGTGTGTAGTACTG 3'), complementary to nt 286303 of the VP3 gene, and D3-V(+) (5' GACCCGAAGACGGCTGACC 3'), corresponding to nt 6180 of the VP3 gene. The expected amplification product is a DNA fragment of 252 bp.
For positive-strand RNA amplification experiments D3-I was used as the antisense primer in the RT reaction at 42 °C.
Negative-strand RNA amplification was carried out using an external primer in the RT reaction, VP3NEST(+) (5' CCAACGTGCACGTCGCGGGT 3'), corresponding to the sequence identical to nt 617637 of the VP2 gene, and cDNA synthesis was performed at 50 °C. Prior to PCR amplification with primers D3-I and D3-V, primer VP3NEST was removed by filtering the RT reaction through a Centricon YM-30 column (Millipore). Under these conditions, specific amplification dependent on the negative-strand was achieved for up to 1 ng of input RNA.
As a control for RNA extraction, an RTPCR reaction using primers designed for amplification of cellular mRNA was performed using oligonucleotides g3pdh 3'(-) (5' AAGTTGTCATGGATGACCTTGGCCA 3') and g3pdh 5'(+) (5' CCATCACCATCTTCCAGGAGCGAG 3'), which amplify a 287 bp DNA fragment corresponding to nt 387673 of human glyceraldehyde-3-phosphate dehydrogenase gene (accession no. X01111).
| Results |
|---|
|
|
|---|
|
To study the biological relevance of FMDV 3' NCR, we constructed the p
74 derivative (Fig. 1
), harbouring a deletion of most of the 3' NCR. p
74 retains 15 virus residues between the stop codon and the poly(A) tract, which remains intact in all constructs. In vitro-transcribed RNAs harbouring the
74 mutation were transfected onto BHK-21 and IBRS-2 monolayers and cells were kept at 37 °C and monitored for CPE development. No CPE could be observed in these monolayers after 3 to 4 days while the positive control, DM RNA, consistently induced CPE about 19 h post-transfection.
In order to preserve cell viability for extended times following transfection and to give a better chance to slow-growing viruses to complete their life-cycle, transfected cells were incubated at 34 °C for up to 9 to 11 days. As BHK-21 cells exhibited an impaired ability to grow at 34 °C, these experiments were performed using IBRS-2 cells. During this time no CPE could be observed in cells transfected with
74 RNAs whereas transcripts derived from the positive control, pDM, induced CPE about 48 h post-transfection (Table 1
).
No infectious virus could be recovered from cells transfected with
74 RNA, as indicated by the negative results of two additional rounds of amplification performed by transferring the transfection medium and the cell lysate onto fresh monolayers. Therefore, we conclude that deletion of the 3' NCR was deleterious for virus multiplication.
Exchange of the FMDV 3' NCR for its homologue from SVDV fails to produce infectious RNA
The use of chimeric viruses provides a useful tool to study the conservation of functional signals to initiate replication between related viruses. In order to study the possibility of a functional substitution of the 3' NCR of FMDV for that element of another picornavirus, we chose SVDV, a distantly related swine picornavirus, which has a similar growth capacity on IBRS-2 cells as FMDV and shares a 45% primary sequence homology in the 3' NCR. Prior to the construction of the FMDVSVDV chimera, a new plasmid, pTAG, containing a unique AvrII site spanning the stop codon of the polyprotein which changes the codon from TAA to TAG was made (Fig. 1
). Secondary structure prediction of the 3' NCR region in pTAG is identical to that of pDM, consisting of two main stemloops that are highly conserved among all aphthovirus strains (data not shown). The intermediate construct pTAG allows the precise excision of the 3' NCR as an AvrIIEcoRV cassette and its replacement with a heterologous sequence bearing those restriction sites while keeping the 3Dpol sequence and the poly(A) tract intact. The infectivity on BHK-21 and IBRS-2 cells shown by transcripts produced from pTAG was similar to that obtained with pDM transcripts (Table 1
), but the RNAs derived from the pTAG mutant caused smaller plaques. To construct pCHIM, the 3' NCR of SVDV RNA was amplified by RTPCR and then ligated into pTAG (Fig. 1
). Thus, pCHIM is a chimera of the FMDV full-length infectious clone in which the 3' NCR has been exchanged for that of SVDV. pCHIM contains a synonymous nucleotide substitution in the last codon of the 3D protein (Fig. 1
). The predicted secondary structure for pCHIM shows no disruption of the secondary structure predicted for the SVDV RNA in that region (data not shown).
RNAs transcribed from pCHIM failed to induce visible CPE when transfected onto BHK-21 or IBRS-2 monolayers incubated at 37 °C (Table 1
). Nevertheless, when cells transfected with CHIM RNA were incubated at 34 °C a diffuse cellular damage as detected by cell detachment was observed in IBRS-2 cells at extended times post-transfection (about 4 days). This effect was not visible in cells transfected with
74 RNA or in mock-transfected cells (data not shown). In no case were we able to recover infectious particles from cells transfected with CHIM RNAs, incubated at either 34 °C or 37 °C, after two additional passages on IBRS-2 cells using both the supernatant and the lysate from transfected cells harvested at different times post-transfection (from 3 to 9 days). These results indicate that the 3' NCRs of FMDV and SVDV are not functionally interchangeable.
Mutations in the 3' NCR have no effect on the in vitro translation efficiency of the FMDV RNA
To assess that the phenotype observed for mutant RNAs bearing extensive deletion or heterologous sequences in the 3' NCR was due to a major replication defect, we assayed the in vitro translation efficiency of the transcripts to rule out the possibility of significant translation dysfunction in these mutants (Fig. 2
). Equal amounts of RNAs derived from constructs p
74, pCHIM and pTAG (Fig. 2b
) were used to program in vitro translation reactions in a rabbit reticulocyte lysate system. The translation products are shown in Fig. 2(a)
. No significant differences in the viral protein patterns could be detected, suggesting that the multiplication defect associated with mutant RNAs was independent of the efficiency of translation.
|
74 and CHIM RNAs could be due to a replication defect. In order to explore this possibility, the accumulation of positive-strand viral RNA in cells transfected with transcripts prepared from p
74, pCHIM and pTAG was assessed (Fig. 3
74 and CHIM RNAs. Our failure to detect viral RNA in cells transfected with 3' mutant RNAs by Northern blot suggested major dysfunction defects for those mutants at the replication level.
|
74 nor CHIM RNAs were able to reach replication levels comparable to the levels of infectious RNAs derived from pTAG, even at late times post-transfection (119 h). In contrast, a significant difference was observed between
74 and CHIM RNAs after 42 h post-transfection. In cells transfected with chimeric RNAs harbouring the 3' NCR of SVDV negative-strand RNA was detected at the 42 h time-point. However, at early times post-transfection (0·5 h), positive RTPCR amplification was detected in both
74 and CHIM RNA lanes, presumably arising from remnants of transfection input RNA. The differences observed in synthesis of negative-strand RNA at 42 h post-transfection are unlikely to be due to incomplete elongation by aberrant initiation events of the negative-strand RNA as the primers used in the assay amplify an internal fragment of the genome (VP3).
|
74 RNA, particularly at 42 h post-transfection. This is consistent with the detection of small amounts of negative-sense viral RNA in cells transfected with pCHIM transcripts (Fig. 4a)
Fig. 4(c)
shows the results of the RTPCR reactions with g3pdh primers as a control of sample RNA loading. The intensity of the bands with these primers did not correlate with the intensities of bands shown in Fig. 4(a)
and (b)
, indicating that the differences observed in those reactions were not due to significant differences in RNA load.
Sequencing of the PCR products corresponding to positive-strand RNA amplification confirmed the presence of the
74-, SVDV 3' NCR- and TAG-specific sequences in viral RNAs from the respective transfections at 42, 90 and 119 h post-transfection.
The results obtained from cells transfected with mutant RNAs by RTPCR analysis suggest that a certain advantage was conferred by the presence of the heterologous element from a distant picornavirus over the deletion of this region, even though none of the FMDV RNAs bearing the
74 deletion or the SVDV sequence in the 3' NCR were replication-competent at levels sufficient to make them viable and produce infectious viruses. However, we failed to detect the presence of viral proteins in cells transfected with
74 and CHIM transcripts in Western blot experiments (data not shown). Thus, CHIM RNA might replicate to a small extent but this is still below the threshold required for further rounds of virus multiplication.
| Discussion |
|---|
|
|
|---|
Previous work on picornaviruses has shown that PV and HRV14 RNAs harbouring complete deletions of the 3' NCR are infectious. The recovered viruses demonstrated a defective growth phenotype and an RNA replication defect, suggesting that the presence of the 3' NCR may not be an absolute requirement for genome replication in these viruses (Todd et al., 1997
). In contrast, individual excision of the two stemloops of PV3 3' NCR had been previously reported to abolish replication (Rohll et al., 1995
).
We have examined the role of the 3' NCR in FMDV, an aphthovirus for which there is no available information regarding replication signals. Our results with the 3' NCR mutants show that
74 RNAs were not infectious when transfected into susceptible cells as no CPE could be observed and we were unable to recover infectious virus after two rounds of amplification.
The functional inter-exchange of PV 3' NCR for that of CB4 or HRV14 has been reported (Rohll et al., 1995
). When the donor sequences came from hepatitis A virus (HAV) or bovine enterovirus, the replication levels were significantly lower than those for the PV3, CB4 or HRV14 recombinants exhibiting the wt replication phenotype. In contrast, Pierangeli et al. (1995)
reported the deleterious effect on replication of the substitution of PV 3' NCR with the equivalent sequences of HAV RNA.
Since the
74 deletion, spanning most of the FMDV 3' NCR and including the two predicted stemloops, resulted in an impairment of infectivity, we studied the functional substitution of the element with that of the distantly related enterovirus SVDV. A chimeric construct, pCHIM (Fig. 1
), did not induce visible CPE in BHK-21 or IBRS-2 cells at 3 to 4 days post-transfection, as compared to DM RNAs, which induced CPE about 19 h post-transfection. We were not able to recover infectious virus in this case, similar to the situation seen with the
74 mutant.
In order to hypothesize replication defects in
74 and CHIM RNAs, it was necessary to rule out the possibility of major translation defects. In recent reports the highly conserved 98 nt X region of the 3' NCR of hepatitis C virus has been shown to enhance translation (Ito et al., 1998
; Ito & Lai, 1999
). When the in vitro translation efficiency of the different FMDV transcripts in a rabbit reticulocyte lysate system was compared, no relevant differences could be detected between infectious and uninfectious RNAs (Fig. 2
). This result suggests that the inability of
74 and CHIM RNAs to direct RNA replication efficiently was unrelated to their translation initiation efficiency.
In further experiments we used IBRS-2 cells that were able to grow at lower temperatures (34 °C) and may have provided trans-acting factors specifically required for the replication competence of the FMDVSVDV chimera.
The accumulation of positive-sense FMDV RNA, monitored by Northern blot, indicated that only TAG transcripts were able to replicate successfully, while RNAs derived from p
74 and pCHIM did not accumulate at levels detectable by Northern blot.
In our search for RNA synthesized de novo in cells transfected with
74 and CHIM RNAs, we carried out an RTPCR analysis to detect lower amounts of RNA. In the negative-strand amplification experiments we detected viral RNA at 42 h post-transfection in cells transfected with CHIM RNA, but not in monolayers transfected with
74 RNA (Fig. 4a
). Positive-strand amplification revealed slight differences in the intensity of the bands corresponding to
74 and CHIM RNA-transfected cells respectively, at different times post-transfection.
Therefore, we conclude that the deletion of the 3' NCR had a deleterious effect on FMDV replication. Its presence seems to be a strict requirement for the initial rounds of replication as no viable viruses, including revertants or pseudorevertants containing additional mutations, were recovered. The SVDV 3' NCR, replacing the FMDV homologue, was unable to provide the same function in cis. The extent of identity of both elements at the primary sequence level is 45% and the secondary structure predicted for SVDV 3' NCR does not resemble that of FMDV 3' NCR. The secondary structure was maintained intact in the pCHIM construct (data not shown). FMDV and SVDV cause indistinguishable symptomatic diseases in pigs and productively infect IBRS-2 cultured cells. However, their replicative signals, at least at the 3' NCR level, seem to be different. The lack of infectivity of CHIM transcripts on IBRS-2 cells is unlikely to be due to the absence of specific host factors for SVDV replication. Interestingly though, the presence of the SVDV 3' NCR conferred to the RNA a slight advantage in early replication events as compared to RNAs harbouring complete 3' NCR deletions.
Our results for FMDV may be in apparent contradiction to data obtained using entero- and rhinoviruses. Although the main replication mechanisms have been assumed to be common for all picornaviruses, some group-dependent strategies cannot be ruled out.
Novel internal domains essential for replication are being discovered in the coding regions of the picornaviral genome. All these CREs resemble each other functionally but differ in sequence, structure and location. The CREs in rhino- and cardioviruses are not functionally exchangeable while the CRE of Mengo virus can replace that of Theilers virus (Lobert et al., 1999
). Interestingly, a lethal 3' NCR mutation could be partly rescued by a compensating mutation within the CRE of HRV14 (McKnight & Lemon, 1998
).
The ability of an FMDV replicon lacking the Lb and most of the P1 (capsid protein precursor) coding sequences to replicate suggests that no CRE is contained in that region of the genome (McInerney et al., 2000
). An additional distinguishing feature among enteroviruses, rhinoviruses and aphthoviruses is the different type of IRES contained within their 5' end regions differing in sequence and structure.
The possible interaction of the 5' and 3' NCRs during translation and replication of picornavirus RNA is currently being investigated. Inter-regulation of both processes seems to be mediated by the formation of specific RNAprotein complexes in the 5' end clover leaf structure (Gamarnik & Andino, 1998
). Additionally, recent data favour a model where binding of cellular proteins may establish a physical link between the 5' and 3' NCRs (Herold & Andino, 2000a
). Several IRESs, including those of different virus families, have been exchanged without drastic consequences for virus replication (Alexander et al., 1994
; Rohll et al., 1994
; Lu & Wimmer, 1996
). However, some requirements in terms of functional compatibility of sequences present in the 5' end, 3' end and CREs may exist and therefore make it difficult to predict the viability of modified RNAs bearing engineered mutations and replacements in those regions. Thus, disruption of signals strictly required for efficient replication, present in the 3' NCR, may cause major growing defects leading to non-viable phenotypes as well as revertants and pseudorevertants carrying compensatory mutations in the 3' NCR or other regions involved in the regulation of the process.
The essential role played by internal sequences of the 3' NCR has been recently highlighted in a model of initiation of negative-strand synthesis (Paul et al., 2000
), in which uridylylated VPg was transferred to the 3' NCR and then transferred back to the poly(A) tract. The fact that replicative forms of PV RNA can be isolated by poly(A) tract selection (Herold & Andino, 2000 b
) strongly supports this model. Consistent with the biological relevance of signals within the 3' NCR, the data shown here for FMDV indicate that specific sequences within this region are absolutely required to initiate replication, since neither deletion nor SVDV-substituted 3' NCR mutants could replicate efficiently in transfected cells. What is noteworthy is that all the mutants shared the same poly(A) tails and the last four residues, irrespective of their replication competence, indicating that either a structural element essential for FMDV RNA synthesis is missing or disrupted in p
74 and pCHIM or that more than four residues in the FMDV 3' NCR are required to initiate replication.
Our data on FMDV 3' NCR add new information to the poorly characterized regulation of aphthoviruses replication. The experimental approach using derivatives from an infectious FMDV cDNA clone allows the study of infectivity both in vitro on cultured cell lines and in vivo in suckling mice. We are currently focussed on the study of the minimal requirements needed at the level of primary and secondary structures for replication competence in FMDV RNA.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alexander, L., Lu, H. H. & Wimmer, E.(1994). Polioviruses containing picornavirus type 1 and/or type 2 internal ribosomal entry site elements: genetic hybrids and the expression of a foreign gene. Proceedings of the National Academy of Sciences, USA 91, 1406-1410.
Bigeriego, P., Rosas, M. F., Zamora, E., Martínez-Salas, E. & Sobrino, F.(1999). Heterotypic inhibition of foot-and-mouth disease virus infection by combinations of RNA transcripts corresponding to the 5' and 3' regions. Antiviral Research 44, 133-141.[Medline]
Chatterjee, N. K., Polatnick, J. & Bachrach, H. L.(1976). Cell-free translation of foot-and-mouth disease virus RNA into identifiable non-capsid and capsid proteins. Journal of General Virology 32, 383-394.
Clarke, B. E., Brown, A. L., Currey, K. M., Newton, S. E., Rowlands, D. J. & Carroll, A. R.(1987). Potential secondary and tertiary structure in the genomic RNA of foot-and-mouth disease virus. Nucleic Acids Research 15, 7067-7079.
Cui, T., Sankar, S. & Porter, A. G.(1993). Binding of encephalomyocarditis virus RNA polymerase to the 3'-noncoding region of the viral RNA is specific and requires the 3'-poly(A) tail. Journal of Biological Chemistry 268, 26093-26098.
Falk, M. M., Sobrino, F. & Beck, E.(1992). VPg gene amplification correlates with infective particle formation in foot-and-mouth disease virus. Journal of Virology 66, 2251-2260.
Gamarnik, A. V. & Andino, R.(1998). Switch from translation to RNA replication in a positive-stranded RNA virus. Genes & Development 12, 2293-2304.
Goodfellow, I., Chaudhry, Y., Richardson, A., Meredith, J., Almond, J. W., Barclay, W. & Evans, D. J.(2000). Identification of a cis-acting replication element within the poliovirus coding region. Journal of Virology 74, 4590-4600.
Gutiérrez, A., Martínez-Salas, E., Pintado, B. & Sobrino, F.(1994). Specific inhibition of aphthovirus infection by RNAs transcribed from both 5' and 3' noncoding region. Journal of Virology 68, 7426-7432.
Harris, K. S., Xiang, W., Alexander, L., Lane, W. S., Paul, A. V. & Wimmer, E.(1994). Interaction of poliovirus polypeptide 3CDpro with the 5' and 3' termini of the poliovirus genome. Identification of viral and cellular co-factors needed for efficient binding. Journal of Biological Chemistry 269, 27004-27014.
Herold, J. & Andino, R. (2000a). Functional circularization of a positive-stranded RNA virus: a new model for the initiation of negative strand RNA synthesis in poliovirus replication. Europic 2000 (Zagare Bay, Gargano, Italy, 2531 May 2000). Abstract G09.
Herold, J. & Andino, R.(2000b). Poliovirus requires a precise 5' end for efficient positive-strand RNA synthesis. Journal of Virology 74, 6394-6400.
Ito, T. & Lai, M. M. C.(1999). An internal polypyrimidine-tract-binding protein-binding site in the hepatitis C virus RNA attenuates translation, which is relieved by the 3'-untranslated sequence. Virology 254, 288-296.[Medline]
Ito, T., Tahara, S. M. & Lai, M. M. C.(1998). The 3'-untranslated region of hepatitis C virus RNA enhances translation from an internal ribosomal entry site. Journal of Virology 72, 8789-8796.
Kitching, R. P.(1999). Foot-and-mouth disease: current world situation. Vaccine 26, 1772-1774.
Kühn, R., Luz, N. & Beck, E.(1990). Functional analysis of the internal translation initiation site of foot-and-mouth disease virus. Journal of Virology 64, 4625-4631.
Kunkel, T.(1985). Rapid and efficient site specific mutagenesis without phenotypic selection. Proceedings of the National Academy of Sciences, USA 82, 488-492.
Lobert, P. E., Escriou, N., Ruelle, J. & Michiels, T.(1999). A coding RNA sequence acts as a replication signal in cardioviruses. Proceedings of the National Academy of Sciences, USA 96, 11560-11565.
López de Quinto, S. & Martínez-Salas, E.(1997). Conserved structural motifs located in distal loops of aphthovirus internal ribosome entry site domain 3 are required for internal initiation of translation. Journal of Virology 71, 4174-4175.
Lu, H. H. & Wimmer, E.(1996). Poliovirus chimeras replicating under the translational control of genetic elements of hepatitis C virus reveal unusual properties of the internal ribosomal entry site of hepatitis C virus. Proceedings of the National Academy of Sciences, USA 93, 1412-1417.
McInerney, G. M., King, A. M., Ross-Smith, N. & Belsham, G. J.(2000). Replication-competent foot-and-mouth disease virus RNAs lacking capsid coding sequences. Journal of General Virology 81, 1699-1702.
McKnight, K. L. & Lemon, S. M.(1998). The rhinovirus type 14 genome contains an internally located RNA structure that is required for viral replication. RNA 4, 1569-1584.[Abstract]
Mellits, K. H., Meredith, J. M., Rohll, J. B., Evans, D. J. & Almond, J. W.(1998). Binding of a cellular factor to the 3' untranslated region of the RNA genomes of entero- and rhinoviruses plays a role in virus replication. Journal of General Virology 79, 1715-1723.[Abstract]
Paul, A. V., Rieder, E., Kim, D. W. & Wimmer, E. (2000). Identification of an RNA hairpin in poliovirus RNA that serves as a specific template for the uridylylation of VPg in vitro. Europic 2000 (Zagare Bay, Gargano, Italy, 2531 May 2000). Abstract E04.
Pierangeli, A., Bucci, M., Pagnotti, P., Degener, A. M. & Perez Bercoff, R.(1995). Mutational analysis of the 3-terminal extra-cistronic region of poliovirus RNA: secondary structure is not the only requirement for minus-strand RNA replication. FEBS Letters 374, 327-332.[Medline]
Pilipenko, E. V., Maslova, S. V., Sinyakov, A. N. & Agol, V. I.(1992). Towards identification of cis-acting elements involved in the replication of enterovirus and rhinovirus RNAs: a proposal for the existence of tRNA-like terminal structures. Nucleic Acids Research 20, 1739-1745.
Richards, O. C. & Ehrenfeld, E.(1990). Poliovirus RNA replication. Current Topics in Microbiology and Immunology 161, 89-119.[Medline]
Rohll, J. B., Percy, N., Ley, R., Evans, D. J., Almond, J. W. & Barclay, W. S.(1994). The 5'-untranslated regions of picornavirus RNAs contain independent functional domains essential for RNA replication and translation. Journal of Virology 68, 4384-4391.
Rohll, J. B., Moon, D. H., Evans, D. J. & Almond, J. W.(1995). The 3' untranslated region of picornavirus RNA: features required for efficient genome replication. Journal of Virology 69, 7835-7844.[Abstract]
Rose, J. K., Buonocore, L. & Whitt, M. A.(1991). A new cationic liposome reagent mediating nearly quantitative transfection of animal cells. Biotechniques 10, 520-525.[Medline]
Rueckert, R. R.(1990). Picornaviridae and their replication. In Fields Virology , pp. 507-548. Edited by B. N. Fields& D. M. Knipe. New York:Raven Press.
Ryan, M. D., Belsham, G. J. & King, A. M.(1989). Specificity of enzyme-substrate interactions in foot-and-mouth disease virus polyprotein processing. Virology 173, 35-45.[Medline]
Sangar, D. V., Rowlands, D. J., Harris, T. J. R. & Brown, F.(1977). A protein covalently linked to foot-and-mouth disease virus RNA. Nature 268, 648-650.[Medline]
Seechurn, P., Knowles, N. J. & McCauley, J. W.(1990). The nucleotide sequence of a pathogenic swine vesicular disease virus. Virus Research 16, 255-274.[Medline]
Sutmoller, P. (1992). Vesicular diseases, foreign animal diseases. In Committee Report on Foreign Animal Diseases of the United States Animal Health Association, pp. 368382. Richmond, VA, USA.
Todd, S. & Semler, B. L.(1996). Structure-infectivity analysis of the human rhinovirus genomic RNA 3' noncoding region. Nucleic Acids Research 24, 2133-2142.
Todd, S., Nguyen, J. H. & Semler, B. L.(1995). RNA-protein interactions directed by the 3' end of human rhinovirus genomic RNA. Journal of Virology 69, 3605-3614.[Abstract]
Todd, S., Towner, J. S., Brown, D. M. & Semler, B. L.(1997). Replication-competent picornavirus with complete genomic RNA 3' noncoding region deletions. Journal of Virology 71, 8868-8874.[Abstract]
Waggoner, S. & Sarnow, P.(1998). Viral ribonucleoprotein complex formation and nucleolar-cytoplasmic relocalization of nucleolin in poliovirus-infected cells. Journal of Virology 72, 6699-6709.
Zibert, A., Maas, G., Strebe, l. K., Falk, M. M. & Beck, E.(1990). Infectious foot-and-mouth disease virus derived from a cloned full-length cDNA. Journal of Virology 64, 2467-2473.
Received 27 July 2000;
accepted 11 September 2000.
This article has been cited by other articles:
![]() |
Y. Chang, H. Zheng, Y. Shang, Y. Jin, G. Wang, X. Shen, and X. Liu Recovery of infectious foot-and-mouth disease virus from full-length genomic cDNA clones using an RNA polymerase I system Acta Biochim Biophys Sin, November 12, 2009; (2009) gmp093v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rodriguez Pulido, F. Sobrino, B. Borrego, and M. Saiz Attenuated Foot-and-Mouth Disease Virus RNA Carrying a Deletion in the 3' Noncoding Region Can Elicit Immunity in Swine J. Virol., April 15, 2009; 83(8): 3475 - 3485. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gutierrez-Rivas, M. R. Pulido, E. Baranowski, F. Sobrino, and M. Saiz Tolerance to mutations in the foot-and-mouth disease virus integrin-binding RGD region is different in cultured cells and in vivo and depends on the capsid sequence context J. Gen. Virol., October 1, 2008; 89(10): 2531 - 2539. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Martinez-Salas, A. Pacheco, P. Serrano, and N. Fernandez New insights into internal ribosome entry site elements relevant for viral gene expression J. Gen. Virol., March 1, 2008; 89(3): 611 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Serrano, M. R. Pulido, M. Saiz, and E. Martinez-Salas The 3' end of the foot-and-mouth disease virus genome establishes two distinct long-range RNA-RNA interactions with the 5' end region. J. Gen. Virol., October 1, 2006; 87(Pt 10): 3013 - 3022. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Carrillo, E. R. Tulman, G. Delhon, Z. Lu, A. Carreno, A. Vagnozzi, G. F. Kutish, and D. L. Rock Comparative Genomics of Foot-and-Mouth Disease Virus J. Virol., May 15, 2005; 79(10): 6487 - 6504. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Grubman and B. Baxt Foot-and-Mouth Disease Clin. Microbiol. Rev., April 1, 2004; 17(2): 465 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Baranowski, N. Molina, J. I. Nunez, F. Sobrino, and M. Saiz Recovery of Infectious Foot-and-Mouth Disease Virus from Suckling Mice after Direct Inoculation with In Vitro-Transcribed RNA J. Virol., October 15, 2003; 77(20): 11290 - 11295. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Rosas, E. Martinez-Salas, and F. Sobrino Stable expression of antisense RNAs targeted to the 5' non-coding region confers heterotypic inhibition to foot-and-mouth disease virus infection J. Gen. Virol., January 1, 2003; 84(2): 393 - 402. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lopez de Quinto, M. Saiz, D. de la Morena, F. Sobrino, and E. Martinez-Salas IRES-driven translation is stimulated separately by the FMDV 3'-NCR and poly(A) sequences Nucleic Acids Res., October 15, 2002; 30(20): 4398 - 4405. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |