J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smola-Hess, S.
Right arrow Articles by Pfister, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smola-Hess, S.
Right arrow Articles by Pfister, H. J.
Agricola
Right arrow Articles by Smola-Hess, S.
Right arrow Articles by Pfister, H. J.
Journal of General Virology (2001), 82, 2335-2339.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Soluble interleukin-6 receptor activates the human papillomavirus type 18 long control region in SW756 cervical carcinoma cells in a STAT3-dependent manner

Sigrun Smola-Hess1, Ute Sandaradura de Silva1, Dirk Hadaschik1 and Herbert J. Pfister1

Institute of Virology, University of Cologne, Fürst-Pückler-Str. 56, D-50935 Cologne, Germany1

Author for correspondence: Sigrun Smola-Hess. Fax +49 221 478 3902. e-mail s.hess{at}uni-koeln.de


   Abstract
TOP
Abstract
Main text
References
 
Cervical carcinoma cells producing high levels of interleukin-6 (IL-6) were shown to be unresponsive to the cytokine IL-6 due to the loss of their IL-6 receptor. Addition of IL-6 receptor in a soluble form restores IL-6 signalling in SW756 carcinoma cells. This leads to a rapid and strong activation of the transcription factor signal transducer and activator of transcription 3 (STAT3). Nuclear factor IL-6 (NF-IL6, C/EBP{beta}) was induced only as a late event. While C/EBP{beta} significantly repressed the human papillomavirus type 18 long control region (HPV18-LCR), IL-6 signalling unexpectedly activated the HPV18-LCR in these cells. This IL-6 receptor-mediated induction could be completely reverted by transfection of a dominant-negative STAT3 but not STAT1 expression construct, indicating that STAT3 might play an important role in HPV18 oncogene promoter activation.


   Main text
TOP
Abstract
Main text
References
 
Interleukin-6 (IL-6) is expressed in cervical carcinomas in vitro and in vivo (Eustace et al., 1993Down ; Hess et al., 2000Down ; Malejczyk et al., 1991Down ) and may be further induced by activation of the receptor CD40 in these cells (Altenburg et al., 1999Down ). IL-6 is a multifunctional member of the IL-6 family of cytokines, which also includes oncostatin M, leukaemia inhibitory factor, IL-11, ciliary neurotrophic factor and cardiotrophin-1. It regulates cell growth, differentiation and gene expression in a wide range of different cell types (for review see Heinrich et al., 1998Down ; Hirano et al., 2000Down ; Taga & Kishimoto, 1997Down ). While IL-6 is known to be an important autocrine growth stimulator of multiple myeloma cells (Kawano et al., 1988Down ; Klein et al., 1995Down ), it may also inhibit the growth of breast carcinoma cell lines, melanocytes and certain B cell lymphomas (Chen et al., 1988Down ; Morinaga et al., 1989Down ). IL-6 binds to the IL-6 receptor chain, gp80, which is functional either in its membrane or its soluble form, sgp80 (Romano et al., 1997Down ; Tamura et al., 1993Down ), leading to dimerization of the signalling subunit gp130 (Murakami et al., 1993Down ; Taga et al., 1989Down ). Dimerized gp130 in turn activates constitutively associated tyrosine kinases of the Janus (Jak) family, which phosphorylate transcription factors of the STAT (signal transducers and activators of transcription) family, STAT3 and STAT1 (Hibi et al., 1990Down ; Lutticken et al., 1994Down ; Rakemann et al., 1999Down ; Stahl et al., 1994Down ; Zhong et al., 1994Down ). IL-6 may also lead to the activation of the mitogen-activated protein (MAP) kinase pathway and induces the expression of the transcription factor C/EBP{beta} (Akira et al., 1990Down ; Baumann et al., 1992Down ; Boulton et al., 1994Down ; Daeipour et al., 1993Down ). Recently, it has been suggested that STAT3 activation is essential for IL-6-mediated C/EBP{beta} induction. In that study, STAT3 activated the C/EBP{beta} promoter despite the lack of a sequence-specific STAT DNA-binding site (Niehof et al., 2000Down ).

Similar to multiple myeloma, IL-6 was postulated to be an autocrine growth factor for cervical carcinoma (Eustace et al., 1993Down ). However, as shown previously, cervical carcinoma cells producing IL-6 in large quantities do not respond to it due to the loss of gp80 expression (Bauknecht et al., 1999Down ; Hess et al., 2000Down ). Detailed analysis revealed that other components of the signalling cascade are intact, as responsiveness to IL-6 could be completely restored by the addition of gp80 in a soluble form (Hess et al., 2000Down ). Cervical carcinoma cell lines like SW756, which produces nanogram amounts of IL-6, even responded to their own IL-6 in the presence of sgp80, leading to strong activation of STAT3 and production of the chemokine MCP-1 (monocyte chemoattractant protein-1). As MCP-1 may enhance an anti-tumour response by attracting mononuclear cells into the tumour tissue, loss of gp80 expression might be a helpful immune escape mechanism for the carcinoma cells (Hess et al., 2000Down ).

The effects of IL-6 signalling on human papillomavirus (HPV) regulation in cervical carcinoma cells are less well understood. Whereas IL-6 activated the HPV18 promoter in the hepatoma cell line HepG2, it was postulated that IL-6 might repress the HPV18 long control region (HPV18-LCR) in cervical carcinoma cells through the activation of c/EBP{beta}. However, this hypothesis could not be tested in the latter cells due to the fact that they have lost gp80 expression.

To further analyse this question we restored responsiveness to IL-6 by adding sgp80 to the IL-6-producing cervical carcinoma cell line SW756. Cells were kept in DMEM supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 0·1 mg/ml streptomycin, 1 mM sodium pyruvate and 2 mM L-alanyl-L-glutamine (all from Gibco BRL). They were seeded at a density of 1·5x105 cells per well in 6-well plates, grown overnight and co-transfected with 1 µg of the vector p4321-luc expressing the luciferase gene under the control of the HPV18-LCR and 1 µg of CMV–{beta}-galactosidase (CMV–{beta}-gal) plasmid as an internal control using the FuGene reagent (Boehringer Mannheim). The p4321-luc construct, kindly provided by Dr G. Steger, Cologne, Germany (Steger & Corbach, 1997Down ), is based on a HPV18-LCR construct, positions 6929 to 120, obtained from Dr Francoise Thierry, Paris, France. At 24 h post-transfection the cellular supernatants were replaced by medium with 100 ng/ml of IL-6, 500 ng/ml of sgp80 or a combination of both. As shown in Fig. 1Down (lane 2), IL-6 did not alter HPV18-LCR activity. This was expected, as the cells do not express gp80. To our surprise, addition of sgp80 (Fig. 1Down, lane 3), which restores IL-6 responsiveness, did not suppress, but instead activated the HPV18-LCR, similar to HepG2 cells (Bauknecht et al., 1999Down ). Apparently, the IL-6 produced by the SW756 cells themselves was sufficient for about 2·3-fold activation. Data shown are normalized to CMV–{beta}-gal stimulation. Due to the fact that this construct is also stimulated by IL-6, the presented data are weaker than non-normalized data. A similar result was obtained when IL-6 and sgp80 were combined for stimulation (Fig. 1Down, lane 4).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. IL-6 signalling in SW756 cells activates the HPV18-LCR. Cells were seeded at equal densities (1·5x105 cells per well) in 6-well culture plates and cultured for 20 h. Then they were co-transfected with 1 µg of p4321-luc and 1 µg of CMV–{beta}-gal reporter vectors. After 24 h they were stimulated with medium (lane 1), 100 ng/ml IL-6 (lane 2), 500 ng/ml sgp80 (lane 3) or 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80 (lane 4). At 48 h post-transfection cells were harvested and analysed. Shown are the mean values±SD of three experiments with duplicate determinations. All values are normalized on CMV–{beta}-gal values. Medium control was set to the value 1.

 
In order to identify intracellular signals mediating this effect, we analysed the induction of the transcription factor C/EBP{beta} by IL-6 in the presence of sgp80. SW756 were seeded in 6 cm dishes and were stimulated with 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80 for different time intervals. Nuclear extracts were prepared according to Schreiber et al. (1989)Down . Each extract (5 µg) was assayed for C/EBP{beta}-binding activity in an electrophoretic mobility shift assay (EMSA) using the 32P-labelled double-stranded oligonucleotide 5' GGACGTCACATTGCACAATCTTAATAA 3' (Akira et al., 1990Down ). As shown in Fig. 2Down(A, left panel), SW756 cells displayed constitutive C/EBP{beta}-binding activity. IL-6/sgp80 was able to induce C/EBP{beta}-binding activity; however, this was a late event, as it was not observed within the first 4 h. The identity of the shifted band was proven to be C/EBP{beta} in supershift analysis, where the extracts were pre-incubated with a polyclonal rabbit anti-C/EBP{beta} antibody (Santa Cruz Biotechnology) (Fig. 2ADown, right panel).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. IL-6 signalling in SW756 induces C/EBP{beta}-binding activity in SW756 as a late event (a). Cells were cultured in 6 cm dishes overnight. Then they were stimulated with 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80 for the indicated time intervals (left panel). Nuclear extracts were analysed for C/EBP{beta}-binding activity by EMSA. Nuclear extracts of cells stimulated for 24 h were investigated by supershift analysis using an anti-C/EBP{beta} polyclonal antibody (right panel). C/EBP{beta} transfection in SW756 cell represses the HPV18-LCR (b). Cells were seeded at equal densities (9·2x105 cells per well) in 6 cm culture plates and cultured for 20 h. Then they were co-transfected with 3 µg of p4321-luc and 3 µg of CMV–{beta}-gal reporter vectors, 2 µg pBluescript and the indicated amounts of pcD-C/EBP{beta}. At 48 h post-transfection cells were harvested and analysed. Shown are the mean values±SD of three experiments with duplicate to triplicate determinations each. All values are normalized on CMV–{beta}-gal values. Transfection containing no pcD-C/EBP{beta} plasmid was set to the value 1.

 
In order to test C/EBP{beta} for its activity on the HPV18-LCR, the C/EBP{beta} cDNA was PCR-amplified and cloned into BamHI and EcoRI sites of the pcDNA3.1+ vector (Invitrogen), resulting in pcD-C/EBP{beta}. SW756 cells were seeded at equal densities (9·2x105 cells per well) in 6 cm dishes and co-transfected with various doses of pcD-C/EBP{beta} together with 3 µg of p4321-luc and 3 µg of CMV–{beta}-gal reporter vectors, 2 µg pBluescript SK+II (Stratagene) and the indicated amounts of pcD-C/EBP{beta} using FuGene. The amount of pcDNA vector was adjusted with empty pcDNA3.1+ vector in all transfections. In accordance with the findings of Bauknecht et al. (1999)Down , pcD-C/EBP{beta} strongly suppressed HPV18-LCR activity even at very low doses (Fig. 2BUp). Thus, C/EBP{beta} could not be responsible for the observed stimulatory effect of IL-6 in the presence of sgp80.

Earlier studies had revealed rapid and strong activation of STAT3 by sgp80 in SW756 cells (Hess et al., 2000Down ). Computer analysis of the HPV18-LCR using the MatInspector program did not reveal a consensus STAT-binding site, which does not exclude the existence of an atypical yet functional STAT-binding site. Seven potential sites showing at least similarity with a STAT-binding site were investigated by EMSA and turned out not to bind STAT3 (data not shown). However, as STAT factors may undergo interactions with other transcription factors, e.g. STAT3 with c-jun (Schaefer et al., 1995Down ), and may regulate transcription without direct DNA binding (Niehof et al., 2000Down ), we were interested to investigate whether STAT factors are functionally involved in HPV-LCR activation. In order to block either STAT1 or STAT3 activation specifically, dominant-negative forms specific for the respective transcription factors were used. These STAT mutants (STAT1F and STAT3F) cloned into the vector pCAGGS-Neo (pCAGGS-Neo-HA-STAT1F and pCAGGS-Neo-HA-STAT3F) were kindly provided by Dr T. Hirano, Osaka, Japan (Hirano et al., 1997Down ; Nakajima et al., 1996Down ). In transient transfection analysis, dominant-negative STAT1 and STAT3 were tested for their ability to inhibit LCR activation by IL-6/sgp80. SW756 cells were seeded in 6 cm dishes. After co-transfection with 1 µg of the vector p4321-luc, 1 µg of CMV–{beta}-gal and 1 µg of pCAGGS-Neo-HA-STAT1F or pCAGGS-Neo-HA-STAT3F, respectively, SW756 cells were stimulated with 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80 as described above. In contrast to STAT1F, STAT3F displayed a strong inhibitory effect (Fig. 3Down). These results strongly indicated the involvement of the transcription factor STAT3 in IL-6/sgp80-mediated HPV18-LCR activation. Alternatively, overexpressed dominant-negative STAT3 might have titrated a different factor associated with STAT3.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 3. Dominant negative STAT3 blocks IL-6/sgp80-mediated activation of the HPV18-LCR. Cells were seeded at equal densities (1·5x105 cells per well) in 6-well culture plates and cultured for 20 h. Then they were co-transfected with 1 µg of p4321-luc vector, 1 µg of CMV–{beta}-gal reporter vector and 1 µg of the indicated expression vectors: empty vector pCAGGS-Neo (lane 1), pCAGGS-Neo-HA-STAT1F (lane 2) or pCAGGS-Neo-HA-STAT3F (lane 3). After 24 h all cells were stimulated with 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80. At 48 h post-transfection cells were harvested and analysed. Shown are the mean values±SD of three experiments with duplicate determinations. All values are normalized on CMV–{beta}-gal values. The transfection of empty vector pCAGGS-Neo was set to the value 1.

 
Thus, IL-6 cannot be generally regarded as a HPV-suppressive cytokine but may activate the HPV18-LCR even in cervical carcinoma cells. The induction involves the transcription factor STAT3. In SW756 cervical carcinoma cells, IL-6 is produced in large amounts, but the cells do not respond due to a loss of the IL-6R ligand-binding chain (Bauknecht et al., 1999Down ; Hess et al., 2000Down ). It was speculated that autocrine IL-6 signalling may be inhibited because C/EBP{beta}, a potential downstream effector of IL-6 signalling, suppresses transcription by the HPV18-LCR (Bauknecht et al., 1996Down ). For the HPV16-LCR the effects of C/EBP{beta} have been controversially discussed, as this factor has been reported to activate (Struyk et al., 2000Down ) or to repress (Kyo et al., 1993Down ) transcription. In fact, C/EBP{beta}, which was induced upon reconstitution of IL-6 signalling in SW756, also strongly repressed the HPV18-LCR in our experiments when overexpressed by transfection in the same cells. How can these on first glance contradictory effects of IL-6 and C/EBP{beta} be explained? We had previously shown that IL-6 signalling does not only result in C/EBP{beta} induction but also activates other transcription factors of the STAT family, STAT3 and STAT1. Recent data suggests that both signalling events are interrelated as IL-6 appears to induce STAT3 tethering to the C/EBP{beta} promoter and thereby regulating its transcriptional activation (Niehof et al., 2000Down ). Thus, the activation of both transcription factors does not seem to occur simultaneously but sequentially. Such a timely successive activation is also observed in SW756 cells. IL-6/sgp80 mediated STAT3 activation after 15 min (Hess et al., 2000Down ), whereas the induction of C/EBP{beta} took far more than 4 h. It is plausible to assume that STAT3 might exhibit its stimulatory effects on the HPV18 promoter long before C/EBP{beta} can start repressing it. Thus, the net outcome of an IL-6 signal might be the sum of both counteracting effects. As a second possibility, C/EBP{beta} might serve as a terminator of the positive STAT3-dependent IL-6 signal. However, from luciferase assays these possibilities are difficult to dissect, as the half-life of the luciferase reporter enzyme and of the corresponding mRNA might not permit the detection of an up- and down-response. It is still unclear how STAT3, which probably does not directly bind to the HPV18-LCR, might nevertheless alter its activity. It will be interesting to investigate whether there are atypical STAT3-binding sites or whether STAT3 is tethered to a complex bound to the HPV18-LCR as has recently been suggested for the C/EBP{beta} promoter. Finally, STAT3 involvement might be indirect via induction of a different transcription factor that binds to the LCR.

We are well aware of the fact that reporter construct analyses might not completely reflect the response of the integrated genes in carcinomas, as their regulation is undoubtedly much more complex and might also additionally depend on cellular factors acting at the viral integration sites. However, our study provides evidence that IL-6, produced by SW756 carcinoma cells, can clearly provide positive regulatory signals which induce the HPV18-LCR.

In conclusion, in cervical carcinoma cells a major role of shutting off the autocrine IL-6 stimulation might not be the repression of the viral oncogene promoter, but possibly an immunological role, e.g. to prevent chemokine production, which might help the malignant cells to escape the immune surveillance.


   Acknowledgments
 
The authors thank Dr M. von Knebel-Doeberitz for providing cell line SW756. We are also grateful to Dr T. Hirano, Dr G. Steger and Dr F. Thierry for providing plasmids.

This work was supported by a grant from the Deutsche Forschungsgemeinschaft (Az FOR 265/2-1). S.S.-H. is supported by the Innovationsprogramm Forschung of the MSWWF Nordrhein-Westfalen.


   References
TOP
Abstract
Main text
References
 
Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T. & Kishimoto, T. (1990). A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO Journal 9, 1897-1906.[Medline]

Altenburg, A., Baldus, S. E., Smola, H., Pfister, H. & Hess, S. (1999). CD40 ligand–CD40 interaction induces chemokines in cervical carcinoma cells in synergism with IFN-gamma. Journal of Immunology 162, 4140-4147.[Abstract/Free Full Text]

Bauknecht, T., See, R. H. & Shi, Y. (1996). A novel C/EBP beta–YY1 complex controls the cell-type-specific activity of the human papillomavirus type 18 upstream regulatory region. Journal of Virology 70, 7695-7705.[Abstract]

Bauknecht, T., Randelzhofer, B., Schmitt, B., Ban, Z., Hernando, J. J. & Bauknecht, T. (1999). Response to IL-6 of HPV-18 cervical carcinoma cell lines. Virology 258, 344-354.[Medline]

Baumann, H., Morella, K. K., Campos, S. P., Cao, Z. & Jahreis, G. P. (1992). Role of CAAT-enhancer binding protein isoforms in the cytokine regulation of acute-phase plasma protein genes. Journal of Biological Chemistry 267, 19744-19751.[Abstract/Free Full Text]

Boulton, T. G., Stahl, N. & Yancopoulos, G. D. (1994). Ciliary neurotrophic factor/leukemia inhibitory factor/interleukin 6/oncostatin M family of cytokines induces tyrosine phosphorylation of a common set of proteins overlapping those induced by other cytokines and growth factors. Journal of Biological Chemistry 269, 11648-11655.[Abstract/Free Full Text]

Chen, L., Mory, Y., Zilberstein, A. & Revel, M. (1988). Growth inhibition of human breast carcinoma and leukemia/lymphoma cell lines by recombinant interferon-beta 2. Proceedings of the National Academy of Sciences, USA 85, 8037-8041.[Abstract/Free Full Text]

Daeipour, M., Kumar, G., Amaral, M. C. & Nel, A. E. (1993). Recombinant IL-6 activates p42 and p44 mitogen-activated protein kinases in the IL-6 responsive B cell line, AF-10. Journal of Immunology 150, 4743-4753.[Abstract]

Eustace, D., Han, X., Gooding, R., Rowbottom, A., Riches, P. & Heyderman, E. (1993). Interleukin-6 (IL-6) functions as an autocrine growth factor in cervical carcinomas in vitro. Gynecologic Oncology 50, 15-19.[Medline]

Heinrich, P. C., Behrmann, I., Muller-Newen, G., Schaper, F. & Graeve, L. (1998). Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochemistry Journal 334, 297-314.

Hess, S., Smola, H., Sandaradura De Silva, U., Hadaschik, D., Kube, D., Baldus, S. E., Flucke, U. & Pfister, H. (2000). Loss of IL-6 receptor expression in cervical carcinoma cells inhibits autocrine IL-6 stimulation: abrogation of constitutive monocyte chemoattractant protein-1 production. Journal of Immunology 165, 1939-1948.[Abstract/Free Full Text]

Hibi, M., Murakami, M., Saito, M., Hirano, T., Taga, T. & Kishimoto, T. (1990). Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell 63, 1149-1157.[Medline]

Hirano, T., Nakajima, K. & Hibi, M. (1997). Signaling mechanisms through gp130: a model of the cytokine system. Cytokine & Growth Factor Reviews 8, 241-252.[Medline]

Hirano, T., Ishihara, K. & Hibi, M. (2000). Roles of STAT3 in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors. Oncogene 19, 2548-2556.[Medline]

Kawano, M., Hirano, T., Matsuda, T., Taga, T., Horii, Y., Iwato, K., Asaoku, H., Tang, B., Tanabe, O., Tanaka, H. and others (1988). Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature 332, 83–85.[Medline]

Klein, B., Zhang, X. G., Lu, Z. Y. & Bataille, R. (1995). Interleukin-6 in human multiple myeloma. Blood 85, 863-872.[Free Full Text]

Kyo, S., Inoue, M., Nishio, Y., Nakanishi, K., Akira, S., Inoue, H., Yutsudo, M., Tanizawa, O. & Hakura, A. (1993). NF-IL6 represses early gene expression of human papillomavirus type 16 through binding to the noncoding region. Journal of Virology 67, 1058-1066.[Abstract/Free Full Text]

Lutticken, C., Wegenka, U. M., Yuan, J., Buschmann, J., Schindler, C., Ziemiecki, A., Harpur, A. G., Wilks, A. F., Yasukawa, K., Taga, T. and others (1994). Association of transcription factor APRF and protein kinase Jak1 with the interleukin-6 signal transducer gp130. Science 263, 89–92.[Abstract/Free Full Text]

Malejczyk, J., Malejczyk, M., Urbanski, A., Kock, A., Jablonska, S., Orth, G. & Luger, T. A. (1991). Constitutive release of IL6 by human papillomavirus type 16 (HPV16)-harboring keratinocytes: a mechanism augmenting the NK-cell-mediated lysis of HPV-bearing neoplastic cells. Cellular Immunology 136, 155-164.[Medline]

Morinaga, Y., Suzuki, H., Takatsuki, F., Akiyama, Y., Taniyama, T., Matsushima, K. & Onozaki, K. (1989). Contribution of IL-6 to the antiproliferative effect of IL-1 and tumor necrosis factor on tumor cell lines. Journal of Immunology 143, 3538-3542.[Abstract]

Murakami, M., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukawa, K., Yamanishi, K., Taga, T. & Kishimoto, T. (1993). IL-6-induced homodimerization of gp130 and associated activation of a tyrosine kinase. Science 260, 1808-1810.[Abstract/Free Full Text]

Nakajima, K., Yamanaka, Y., Nakae, K., Kojima, H., Ichiba, M., Kiuchi, N., Kitaoka, T., Fukada, T., Hibi, M. & Hirano, T. (1996). A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO Journal 15, 3651-3658.[Medline]

Niehof, M., Streetz, K., Rakemann, T., Bischoff, S. C., Manns, M. P., Horn, F. & Trautwein, C. (2000). Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPbeta promoter suggests a new mechanism of transcriptional regulation by STAT3. Journal of Biological Chemistry 276, 9016-9027.[Abstract/Free Full Text]

Rakemann, T., Niehof, M., Kubicka, S., Fischer, M., Manns, M. P., Rose-John, S. & Trautwein, C. (1999). The designer cytokine hyper-interleukin-6 is a potent activator of STAT3-dependent gene transcription in vivo and in vitro. Journal of Biological Chemistry 274, 1257-1266.[Abstract/Free Full Text]

Romano, M., Sironi, M., Toniatti, C., Polentarutti, N., Fruscella, P., Ghezzi, P., Faggioni, R., Luini, W., van Hinsbergh, V., Sozzani, S., Bussolino, F., Poli, V., Ciliberto, G. & Mantovani, A. (1997). Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6, 315-325.[Medline]

Schaefer, T. S., Sanders, L. K. & Nathans, D. (1995). Cooperative transcriptional activity of Jun and Stat3 beta, a short form of Stat3. Proceedings of the National Academy of Sciences, USA 92, 9097-9101.[Abstract/Free Full Text]

Schreiber, E., Matthias, P., Muller, M. M. & Schaffner, W. (1989). Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Research 17, 6419.[Free Full Text]

Stahl, N., Boulton, T. G., Farruggella, T., Ip, N. Y., Davis, S., Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Barbieri, G., Pellegrini, S. and others (1994). Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 beta receptor components. Science 263, 92–95.[Abstract/Free Full Text]

Steger, G. & Corbach, S. (1997). Dose-dependent regulation of the early promoter of human papillomavirus type 18 by the viral E2 protein. Journal of Virology 71, 50-58.[Abstract]

Struyk, L., van der Meijden, E., Minnaar, R., Fontaine, V., Meijer, I. & ter Schegget, J. (2000). Transcriptional regulation of human papillomavirus type 16 LCR by different C/EBPbeta isoforms. Molecular Carcinogenesis 28, 42-50.[Medline]

Taga, T. & Kishimoto, T. (1997). Gp130 and the interleukin-6 family of cytokines. Annual Review of Immunology 15, 797-819.[Medline]

Taga, T., Hibi, M., Hirata, Y., Yamasaki, K., Yasukawa, K., Matsuda, T., Hirano, T. & Kishimoto, T. (1989). Interleukin-6 triggers the association of its receptor with a possible signal transducer, gp130. Cell 58, 573-581.[Medline]

Tamura, T., Udagawa, N., Takahashi, N., Miyaura, C., Tanaka, S., Yamada, Y., Koishihara, Y., Ohsugi, Y., Kumaki, K., Taga, T. and others (1993). Soluble interleukin-6 receptor triggers osteoclast formation by interleukin 6. Proceedings of the National Academy of Sciences, USA 90, 11924–11928.[Abstract/Free Full Text]

Zhong, Z., Wen, Z. & Darnell, J. E.Jr. (1994). Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 95-98.[Abstract/Free Full Text]

Received 4 April 2001; accepted 8 June 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
V. Dell'Oste, B. Azzimonti, M. Mondini, M. De Andrea, C. Borgogna, R. Mesturini, R. Accardi, M. Tommasino, S. Landolfo, U. Dianzani, et al.
Altered expression of UVB-induced cytokines in human papillomavirus-immortalized epithelial cells
J. Gen. Virol., October 1, 2008; 89(10): 2461 - 2466.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. H. Lee, S. M. P. Yi, M. E. Anderson, K. L. Berger, M. J. Welsh, A. J. Klingelhutz, and M. A. Ozbun
Propagation of infectious human papillomavirus type 16 by using an adenovirus and Cre/LoxP mechanism
PNAS, February 17, 2004; 101(7): 2094 - 2099.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Hadaschik, K. Hinterkeuser, M. Oldak, H. J. Pfister, and S. Smola-Hess
The Papillomavirus E2 Protein Binds to and Synergizes with C/EBP Factors Involved in Keratinocyte Differentiation
J. Virol., May 1, 2003; 77(9): 5253 - 5265.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smola-Hess, S.
Right arrow Articles by Pfister, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smola-Hess, S.
Right arrow Articles by Pfister, H. J.
Agricola
Right arrow Articles by Smola-Hess, S.
Right arrow Articles by Pfister, H. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS