|
|
||||||||
Animal: DNA Viruses |
Institute of Virology, University of Cologne, Fürst-Pückler-Str. 56, D-50935 Cologne, Germany1
Author for correspondence: Sigrun Smola-Hess. Fax +49 221 478 3902. e-mail s.hess{at}uni-koeln.de
| Abstract |
|---|
|
|
|---|
) was induced only as a late event. While C/EBP
significantly repressed the human papillomavirus type 18 long control region (HPV18-LCR), IL-6 signalling unexpectedly activated the HPV18-LCR in these cells. This IL-6 receptor-mediated induction could be completely reverted by transfection of a dominant-negative STAT3 but not STAT1 expression construct, indicating that STAT3 might play an important role in HPV18 oncogene promoter activation. | Main text |
|---|
|
|
|---|
(Akira et al., 1990
induction. In that study, STAT3 activated the C/EBP
promoter despite the lack of a sequence-specific STAT DNA-binding site (Niehof et al., 2000
Similar to multiple myeloma, IL-6 was postulated to be an autocrine growth factor for cervical carcinoma (Eustace et al., 1993
). However, as shown previously, cervical carcinoma cells producing IL-6 in large quantities do not respond to it due to the loss of gp80 expression (Bauknecht et al., 1999
; Hess et al., 2000
). Detailed analysis revealed that other components of the signalling cascade are intact, as responsiveness to IL-6 could be completely restored by the addition of gp80 in a soluble form (Hess et al., 2000
). Cervical carcinoma cell lines like SW756, which produces nanogram amounts of IL-6, even responded to their own IL-6 in the presence of sgp80, leading to strong activation of STAT3 and production of the chemokine MCP-1 (monocyte chemoattractant protein-1). As MCP-1 may enhance an anti-tumour response by attracting mononuclear cells into the tumour tissue, loss of gp80 expression might be a helpful immune escape mechanism for the carcinoma cells (Hess et al., 2000
).
The effects of IL-6 signalling on human papillomavirus (HPV) regulation in cervical carcinoma cells are less well understood. Whereas IL-6 activated the HPV18 promoter in the hepatoma cell line HepG2, it was postulated that IL-6 might repress the HPV18 long control region (HPV18-LCR) in cervical carcinoma cells through the activation of c/EBP
. However, this hypothesis could not be tested in the latter cells due to the fact that they have lost gp80 expression.
To further analyse this question we restored responsiveness to IL-6 by adding sgp80 to the IL-6-producing cervical carcinoma cell line SW756. Cells were kept in DMEM supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 0·1 mg/ml streptomycin, 1 mM sodium pyruvate and 2 mM L-alanyl-L-glutamine (all from Gibco BRL). They were seeded at a density of 1·5x105 cells per well in 6-well plates, grown overnight and co-transfected with 1 µg of the vector p4321-luc expressing the luciferase gene under the control of the HPV18-LCR and 1 µg of CMV
-galactosidase (CMV
-gal) plasmid as an internal control using the FuGene reagent (Boehringer Mannheim). The p4321-luc construct, kindly provided by Dr G. Steger, Cologne, Germany (Steger & Corbach, 1997
), is based on a HPV18-LCR construct, positions 6929 to 120, obtained from Dr Francoise Thierry, Paris, France. At 24 h post-transfection the cellular supernatants were replaced by medium with 100 ng/ml of IL-6, 500 ng/ml of sgp80 or a combination of both. As shown in Fig. 1
(lane 2), IL-6 did not alter HPV18-LCR activity. This was expected, as the cells do not express gp80. To our surprise, addition of sgp80 (Fig. 1
, lane 3), which restores IL-6 responsiveness, did not suppress, but instead activated the HPV18-LCR, similar to HepG2 cells (Bauknecht et al., 1999
). Apparently, the IL-6 produced by the SW756 cells themselves was sufficient for about 2·3-fold activation. Data shown are normalized to CMV
-gal stimulation. Due to the fact that this construct is also stimulated by IL-6, the presented data are weaker than non-normalized data. A similar result was obtained when IL-6 and sgp80 were combined for stimulation (Fig. 1
, lane 4).
|
by IL-6 in the presence of sgp80. SW756 were seeded in 6 cm dishes and were stimulated with 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80 for different time intervals. Nuclear extracts were prepared according to Schreiber et al. (1989)
-binding activity in an electrophoretic mobility shift assay (EMSA) using the 32P-labelled double-stranded oligonucleotide 5' GGACGTCACATTGCACAATCTTAATAA 3' (Akira et al., 1990
-binding activity. IL-6/sgp80 was able to induce C/EBP
-binding activity; however, this was a late event, as it was not observed within the first 4 h. The identity of the shifted band was proven to be C/EBP
in supershift analysis, where the extracts were pre-incubated with a polyclonal rabbit anti-C/EBP
antibody (Santa Cruz Biotechnology) (Fig. 2A
|
for its activity on the HPV18-LCR, the C/EBP
cDNA was PCR-amplified and cloned into BamHI and EcoRI sites of the pcDNA3.1+ vector (Invitrogen), resulting in pcD-C/EBP
. SW756 cells were seeded at equal densities (9·2x105 cells per well) in 6 cm dishes and co-transfected with various doses of pcD-C/EBP
together with 3 µg of p4321-luc and 3 µg of CMV
-gal reporter vectors, 2 µg pBluescript SK+II (Stratagene) and the indicated amounts of pcD-C/EBP
using FuGene. The amount of pcDNA vector was adjusted with empty pcDNA3.1+ vector in all transfections. In accordance with the findings of Bauknecht et al. (1999)
strongly suppressed HPV18-LCR activity even at very low doses (Fig. 2B
could not be responsible for the observed stimulatory effect of IL-6 in the presence of sgp80.
Earlier studies had revealed rapid and strong activation of STAT3 by sgp80 in SW756 cells (Hess et al., 2000
). Computer analysis of the HPV18-LCR using the MatInspector program did not reveal a consensus STAT-binding site, which does not exclude the existence of an atypical yet functional STAT-binding site. Seven potential sites showing at least similarity with a STAT-binding site were investigated by EMSA and turned out not to bind STAT3 (data not shown). However, as STAT factors may undergo interactions with other transcription factors, e.g. STAT3 with c-jun (Schaefer et al., 1995
), and may regulate transcription without direct DNA binding (Niehof et al., 2000
), we were interested to investigate whether STAT factors are functionally involved in HPV-LCR activation. In order to block either STAT1 or STAT3 activation specifically, dominant-negative forms specific for the respective transcription factors were used. These STAT mutants (STAT1F and STAT3F) cloned into the vector pCAGGS-Neo (pCAGGS-Neo-HA-STAT1F and pCAGGS-Neo-HA-STAT3F) were kindly provided by Dr T. Hirano, Osaka, Japan (Hirano et al., 1997
; Nakajima et al., 1996
). In transient transfection analysis, dominant-negative STAT1 and STAT3 were tested for their ability to inhibit LCR activation by IL-6/sgp80. SW756 cells were seeded in 6 cm dishes. After co-transfection with 1 µg of the vector p4321-luc, 1 µg of CMV
-gal and 1 µg of pCAGGS-Neo-HA-STAT1F or pCAGGS-Neo-HA-STAT3F, respectively, SW756 cells were stimulated with 100 ng/ml IL-6 in the presence of 500 ng/ml sgp80 as described above. In contrast to STAT1F, STAT3F displayed a strong inhibitory effect (Fig. 3
). These results strongly indicated the involvement of the transcription factor STAT3 in IL-6/sgp80-mediated HPV18-LCR activation. Alternatively, overexpressed dominant-negative STAT3 might have titrated a different factor associated with STAT3.
|
, a potential downstream effector of IL-6 signalling, suppresses transcription by the HPV18-LCR (Bauknecht et al., 1996
have been controversially discussed, as this factor has been reported to activate (Struyk et al., 2000
, which was induced upon reconstitution of IL-6 signalling in SW756, also strongly repressed the HPV18-LCR in our experiments when overexpressed by transfection in the same cells. How can these on first glance contradictory effects of IL-6 and C/EBP
be explained? We had previously shown that IL-6 signalling does not only result in C/EBP
induction but also activates other transcription factors of the STAT family, STAT3 and STAT1. Recent data suggests that both signalling events are interrelated as IL-6 appears to induce STAT3 tethering to the C/EBP
promoter and thereby regulating its transcriptional activation (Niehof et al., 2000
took far more than 4 h. It is plausible to assume that STAT3 might exhibit its stimulatory effects on the HPV18 promoter long before C/EBP
can start repressing it. Thus, the net outcome of an IL-6 signal might be the sum of both counteracting effects. As a second possibility, C/EBP
might serve as a terminator of the positive STAT3-dependent IL-6 signal. However, from luciferase assays these possibilities are difficult to dissect, as the half-life of the luciferase reporter enzyme and of the corresponding mRNA might not permit the detection of an up- and down-response. It is still unclear how STAT3, which probably does not directly bind to the HPV18-LCR, might nevertheless alter its activity. It will be interesting to investigate whether there are atypical STAT3-binding sites or whether STAT3 is tethered to a complex bound to the HPV18-LCR as has recently been suggested for the C/EBP
promoter. Finally, STAT3 involvement might be indirect via induction of a different transcription factor that binds to the LCR. We are well aware of the fact that reporter construct analyses might not completely reflect the response of the integrated genes in carcinomas, as their regulation is undoubtedly much more complex and might also additionally depend on cellular factors acting at the viral integration sites. However, our study provides evidence that IL-6, produced by SW756 carcinoma cells, can clearly provide positive regulatory signals which induce the HPV18-LCR.
In conclusion, in cervical carcinoma cells a major role of shutting off the autocrine IL-6 stimulation might not be the repression of the viral oncogene promoter, but possibly an immunological role, e.g. to prevent chemokine production, which might help the malignant cells to escape the immune surveillance.
| Acknowledgments |
|---|
This work was supported by a grant from the Deutsche Forschungsgemeinschaft (Az FOR 265/2-1). S.S.-H. is supported by the Innovationsprogramm Forschung of the MSWWF Nordrhein-Westfalen.
| References |
|---|
|
|
|---|
Altenburg, A., Baldus, S. E., Smola, H., Pfister, H. & Hess, S. (1999). CD40 ligandCD40 interaction induces chemokines in cervical carcinoma cells in synergism with IFN-gamma. Journal of Immunology 162, 4140-4147.
Bauknecht, T., See, R. H. & Shi, Y. (1996). A novel C/EBP betaYY1 complex controls the cell-type-specific activity of the human papillomavirus type 18 upstream regulatory region. Journal of Virology 70, 7695-7705.[Abstract]
Bauknecht, T., Randelzhofer, B., Schmitt, B., Ban, Z., Hernando, J. J. & Bauknecht, T. (1999). Response to IL-6 of HPV-18 cervical carcinoma cell lines. Virology 258, 344-354.[Medline]
Baumann, H., Morella, K. K., Campos, S. P., Cao, Z. & Jahreis, G. P. (1992). Role of CAAT-enhancer binding protein isoforms in the cytokine regulation of acute-phase plasma protein genes. Journal of Biological Chemistry 267, 19744-19751.
Boulton, T. G., Stahl, N. & Yancopoulos, G. D. (1994). Ciliary neurotrophic factor/leukemia inhibitory factor/interleukin 6/oncostatin M family of cytokines induces tyrosine phosphorylation of a common set of proteins overlapping those induced by other cytokines and growth factors. Journal of Biological Chemistry 269, 11648-11655.
Chen, L., Mory, Y., Zilberstein, A. & Revel, M. (1988). Growth inhibition of human breast carcinoma and leukemia/lymphoma cell lines by recombinant interferon-beta 2. Proceedings of the National Academy of Sciences, USA 85, 8037-8041.
Daeipour, M., Kumar, G., Amaral, M. C. & Nel, A. E. (1993). Recombinant IL-6 activates p42 and p44 mitogen-activated protein kinases in the IL-6 responsive B cell line, AF-10. Journal of Immunology 150, 4743-4753.[Abstract]
Eustace, D., Han, X., Gooding, R., Rowbottom, A., Riches, P. & Heyderman, E. (1993). Interleukin-6 (IL-6) functions as an autocrine growth factor in cervical carcinomas in vitro. Gynecologic Oncology 50, 15-19.[Medline]
Heinrich, P. C., Behrmann, I., Muller-Newen, G., Schaper, F. & Graeve, L. (1998). Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochemistry Journal 334, 297-314.
Hess, S., Smola, H., Sandaradura De Silva, U., Hadaschik, D., Kube, D., Baldus, S. E., Flucke, U. & Pfister, H. (2000). Loss of IL-6 receptor expression in cervical carcinoma cells inhibits autocrine IL-6 stimulation: abrogation of constitutive monocyte chemoattractant protein-1 production. Journal of Immunology 165, 1939-1948.
Hibi, M., Murakami, M., Saito, M., Hirano, T., Taga, T. & Kishimoto, T. (1990). Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell 63, 1149-1157.[Medline]
Hirano, T., Nakajima, K. & Hibi, M. (1997). Signaling mechanisms through gp130: a model of the cytokine system. Cytokine & Growth Factor Reviews 8, 241-252.[Medline]
Hirano, T., Ishihara, K. & Hibi, M. (2000). Roles of STAT3 in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors. Oncogene 19, 2548-2556.[Medline]
Kawano, M., Hirano, T., Matsuda, T., Taga, T., Horii, Y., Iwato, K., Asaoku, H., Tang, B., Tanabe, O., Tanaka, H. and others (1988). Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature 332, 8385.[Medline]
Klein, B., Zhang, X. G., Lu, Z. Y. & Bataille, R. (1995). Interleukin-6 in human multiple myeloma. Blood 85, 863-872.
Kyo, S., Inoue, M., Nishio, Y., Nakanishi, K., Akira, S., Inoue, H., Yutsudo, M., Tanizawa, O. & Hakura, A. (1993). NF-IL6 represses early gene expression of human papillomavirus type 16 through binding to the noncoding region. Journal of Virology 67, 1058-1066.
Lutticken, C., Wegenka, U. M., Yuan, J., Buschmann, J., Schindler, C., Ziemiecki, A., Harpur, A. G., Wilks, A. F., Yasukawa, K., Taga, T. and others (1994). Association of transcription factor APRF and protein kinase Jak1 with the interleukin-6 signal transducer gp130. Science 263, 8992.
Malejczyk, J., Malejczyk, M., Urbanski, A., Kock, A., Jablonska, S., Orth, G. & Luger, T. A. (1991). Constitutive release of IL6 by human papillomavirus type 16 (HPV16)-harboring keratinocytes: a mechanism augmenting the NK-cell-mediated lysis of HPV-bearing neoplastic cells. Cellular Immunology 136, 155-164.[Medline]
Morinaga, Y., Suzuki, H., Takatsuki, F., Akiyama, Y., Taniyama, T., Matsushima, K. & Onozaki, K. (1989). Contribution of IL-6 to the antiproliferative effect of IL-1 and tumor necrosis factor on tumor cell lines. Journal of Immunology 143, 3538-3542.[Abstract]
Murakami, M., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukawa, K., Yamanishi, K., Taga, T. & Kishimoto, T. (1993). IL-6-induced homodimerization of gp130 and associated activation of a tyrosine kinase. Science 260, 1808-1810.
Nakajima, K., Yamanaka, Y., Nakae, K., Kojima, H., Ichiba, M., Kiuchi, N., Kitaoka, T., Fukada, T., Hibi, M. & Hirano, T. (1996). A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO Journal 15, 3651-3658.[Medline]
Niehof, M., Streetz, K., Rakemann, T., Bischoff, S. C., Manns, M. P., Horn, F. & Trautwein, C. (2000). Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPbeta promoter suggests a new mechanism of transcriptional regulation by STAT3. Journal of Biological Chemistry 276, 9016-9027.
Rakemann, T., Niehof, M., Kubicka, S., Fischer, M., Manns, M. P., Rose-John, S. & Trautwein, C. (1999). The designer cytokine hyper-interleukin-6 is a potent activator of STAT3-dependent gene transcription in vivo and in vitro. Journal of Biological Chemistry 274, 1257-1266.
Romano, M., Sironi, M., Toniatti, C., Polentarutti, N., Fruscella, P., Ghezzi, P., Faggioni, R., Luini, W., van Hinsbergh, V., Sozzani, S., Bussolino, F., Poli, V., Ciliberto, G. & Mantovani, A. (1997). Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6, 315-325.[Medline]
Schaefer, T. S., Sanders, L. K. & Nathans, D. (1995). Cooperative transcriptional activity of Jun and Stat3 beta, a short form of Stat3. Proceedings of the National Academy of Sciences, USA 92, 9097-9101.
Schreiber, E., Matthias, P., Muller, M. M. & Schaffner, W. (1989). Rapid detection of octamer binding proteins with mini-extracts, prepared from a small number of cells. Nucleic Acids Research 17, 6419.
Stahl, N., Boulton, T. G., Farruggella, T., Ip, N. Y., Davis, S., Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Barbieri, G., Pellegrini, S. and others (1994). Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 beta receptor components. Science 263, 9295.
Steger, G. & Corbach, S. (1997). Dose-dependent regulation of the early promoter of human papillomavirus type 18 by the viral E2 protein. Journal of Virology 71, 50-58.[Abstract]
Struyk, L., van der Meijden, E., Minnaar, R., Fontaine, V., Meijer, I. & ter Schegget, J. (2000). Transcriptional regulation of human papillomavirus type 16 LCR by different C/EBPbeta isoforms. Molecular Carcinogenesis 28, 42-50.[Medline]
Taga, T. & Kishimoto, T. (1997). Gp130 and the interleukin-6 family of cytokines. Annual Review of Immunology 15, 797-819.[Medline]
Taga, T., Hibi, M., Hirata, Y., Yamasaki, K., Yasukawa, K., Matsuda, T., Hirano, T. & Kishimoto, T. (1989). Interleukin-6 triggers the association of its receptor with a possible signal transducer, gp130. Cell 58, 573-581.[Medline]
Tamura, T., Udagawa, N., Takahashi, N., Miyaura, C., Tanaka, S., Yamada, Y., Koishihara, Y., Ohsugi, Y., Kumaki, K., Taga, T. and others (1993). Soluble interleukin-6 receptor triggers osteoclast formation by interleukin 6. Proceedings of the National Academy of Sciences, USA 90, 1192411928.
Zhong, Z., Wen, Z. & Darnell, J. E.Jr. (1994). Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 95-98.
Received 4 April 2001;
accepted 8 June 2001.
This article has been cited by other articles:
![]() |
V. Dell'Oste, B. Azzimonti, M. Mondini, M. De Andrea, C. Borgogna, R. Mesturini, R. Accardi, M. Tommasino, S. Landolfo, U. Dianzani, et al. Altered expression of UVB-induced cytokines in human papillomavirus-immortalized epithelial cells J. Gen. Virol., October 1, 2008; 89(10): 2461 - 2466. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Lee, S. M. P. Yi, M. E. Anderson, K. L. Berger, M. J. Welsh, A. J. Klingelhutz, and M. A. Ozbun Propagation of infectious human papillomavirus type 16 by using an adenovirus and Cre/LoxP mechanism PNAS, February 17, 2004; 101(7): 2094 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hadaschik, K. Hinterkeuser, M. Oldak, H. J. Pfister, and S. Smola-Hess The Papillomavirus E2 Protein Binds to and Synergizes with C/EBP Factors Involved in Keratinocyte Differentiation J. Virol., May 1, 2003; 77(9): 5253 - 5265. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |