J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klupp, B. G.
Right arrow Articles by Mettenleiter, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klupp, B. G.
Right arrow Articles by Mettenleiter, T. C.
Agricola
Right arrow Articles by Klupp, B. G.
Right arrow Articles by Mettenleiter, T. C.
Journal of General Virology (2001), 82, 2363-2371.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Effect of the pseudorabies virus US3 protein on nuclear membrane localization of the UL34 protein and virus egress from the nucleus

Barbara G. Klupp1, Harald Granzow2 and Thomas C. Mettenleiter1

Institutes of Molecular Biology1 and Infectology2, Friedrich-Loeffler-Institutes, Federal Research Centre for Virus Diseases of Animals, D-17498 Insel Riems, Germany

Author for correspondence: Thomas Mettenleiter. Fax +49 38351 7151. e-mail mettenleiter{at}rie.bfav.de


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
The alphaherpesvirus UL34 protein is necessary for the primary envelopment of intranuclear capsids at the inner leaflet of the nuclear membrane. In herpes simplex virus type 1, the UL34 protein is exclusively phosphorylated by the protein kinase encoded by the non-essential US3 gene. To investigate the effect of the pseudorabies virus (PrV) US3 product on the intracellular localization of the UL34 protein and on virus morphogenesis, PrV US3 deletion mutants were isolated and characterized. Immunofluorescence analyses demonstrated that in the absence of the US3 protein, the localization of the UL34 polypeptide to the nuclear membrane was not as pronounced as that seen with US3, although immunoelectron microscopy indicated the presence of the UL34 protein in both leaflets of the nuclear membrane. Ultrastructurally, an accumulation of enveloped virions in the perinuclear space in large invaginations of the inner nuclear membrane was observed, which were shown by immunoelectron microscopy to contain the UL34 protein, but not glycoproteins gB or gC. Thus, the US3 protein appears to be involved in the de-envelopment of perinuclear virions by fusion with the outer leaflet of the nuclear membrane. Surprisingly, no difference in the phosphorylation of the PrV UL34 protein was observed in the presence or absence of the US3 kinase. Therefore, the observed effects of the PrV US3 protein on the intracellular localization of the UL34 protein and on virus morphogenesis are probably not due to the phosphorylation of the UL34 protein by the US3 kinase.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Although still not unanimously accepted, there is increasing evidence for a two-step envelopment process during the maturation of herpes virions. In a first budding event at the inner nuclear membrane, intranuclear capsids acquire a primary envelope which is lost by fusion with the outer leaflet of the nuclear membrane. Secondary, final envelopment then occurs by the budding of intracytoplasmic capsids into vesicles in the trans-Golgi area after the acquisition of tegument proteins (Granzow et al., 1997Down , 2001Down ). However, the molecular details of this complicated virion morphogenesis are still largely unclear.

So far, the only viral protein that has been unequivocally assigned a function in primary envelopment is the UL34 gene product of herpes simplex virus type 1 (HSV-1) and pseudorabies virus (PrV) (Klupp et al., 2000Down ; Roller et al., 2000Down ). In the absence of the UL34 protein, budding at the inner leaflet of the nuclear membrane is essentially blocked and capsids are only detectable dispersed in the nucleus. Therefore, the UL34 protein appears to play a crucial role in the primary envelopment process.

The UL34 polypeptide is a phosphoprotein, which has been demonstrated in HSV-1 to be the substrate for the US3 protein kinase (Purves et al., 1991Down ). Moreover, in HSV-1-infected cells, US3 seems to be the only kinase capable of phosphorylating the UL34 protein (Purves et al., 1992Down ). This striking specificity may suggest that phosphorylation of the UL34 protein by the US3 kinase is important for its biological role, possibly influencing intracellular localization and/or function. On the other hand, it seems paradox that, whereas deletion of UL34 results in severe growth defects in PrV and HSV-1 (Klupp et al., 2000Down ; Roller et al., 2000Down ), there is only little impairment of virus replication in the absence of US3 in cultured cells (Purves et al., 1987Down ; Kimman et al., 1994Down ). However, deletion of PrV US3 resulted in a significantly reduced virulence for the natural host of PrV, swine (Kimman et al., 1994Down ). As observed by electron microscopy, enveloped virions appeared to accumulate in the perinuclear space in the absence of US3 and it was suggested that proteins that are phosphorylated by the US3 kinase are involved in fusion of perinuclear virions with the outer nuclear membrane (Wagenaar et al., 1995Down ). There have also been reports of other mutations that result in the accumulation of enveloped virions in the perinuclear space, e.g. by the deletion of PrV gB (Peeters et al., 1992Down ) or HSV-1 gK (Foster & Kousoulas, 1999Down ). However, a similar phenotype could not be reproduced using either gB- (Granzow et al., 2001Down ) or gK-deleted PrV (Dietz et al., 2000Down ; Klupp et al., 1998Down ), which, even in the absence of the respective glycoprotein, still exhibited normal virion maturation. Thus, we wanted to reanalyse the role of US3 in virion morphogenesis.

The PrV US3 gene is located immediately upstream of the gG gene; both the US3 gene and the gG gene are transcribed into 3'-coterminal mRNAs (Zhang & Leader, 1990Down ). Two transcriptional start sites were mapped for the US3 mRNA: a minor transcript starting immediately upstream of the open reading frame (ORF) and a major transcript starting 64 nt upstream of an internal methionine codon. Consequently, two proteins with molecular masses of 41 and 53 kDa have been identified in infected cells (van Zijl et al., 1990Down ). Whereas the majority of the US3 gene product(s) appeared to be localized in infected cells, one protein with a molecular mass of 38 kDa has also been detected in purified virions (Zhang et al., 1990Down ).

To reassess the role of US3 in the virus life cycle and to specifically analyse its influence on the intracellular localization and function of the UL34 protein, we isolated US3 deletion mutants that were isogenic to the various mutant viruses which we had prepared over the last 15 years and analysed it in our standardized cell culture system.


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Viruses and cells.
All virus mutants used in this study were based on the laboratory strain PrV-Ka (Kaplan & Vatter, 1959Down ). Viruses were grown on rabbit kidney cells (RK13) in Eagle's minimum essential medium supplemented with 10% foetal calf serum. For isolation of US3-negative mutants, genomic BamHI fragment 10 was cleaved with either PstI, thereby deleting 114 bp of the US3 protein-coding sequences, or EcoRV/XhoI, resulting in a deletion of 778 bp that included both possible start codons (Fig. 1Down). Concomitantly, a green fluorescent protein (GFP) marker cassette was inserted (Jöns & Mettenleiter, 1997Down ). The resulting plasmid was cotransfected using calcium–phosphate coprecipitation (Graham & van der Eb, 1973Down ) with wild-type PrV DNA into RK13 cells. Green fluorescent plaques were picked and purified until homogeneity. The correct deletion of US3-specific sequences and the insertion of the GFP marker sequence were verified by Southern blotting (data not shown). In all analyses, both mutants behaved identically. Therefore, representative results using either of the two mutant viruses, designated PrV-{Delta}US3, are shown. PrV-{Delta}UL34B, in which the UL34 gene was substituted by the gB gene of bovine herpesvirus type 1 in a gB-negative PrV background, has been described previously (Klupp et al., 2000Down ). A GFP-expressing UL34-negative PrV mutant was also constructed for better comparison with the GFP-expressing US3 mutants (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. (A) A BamHI restriction fragment map is shown below the PrV genome, which is divided into unique long (UL) and unique short (US) regions by internal repeat (IR) and terminal repeat (TR) regions. (B) An enlarged view of the relevant portion of the genome. The locations of the ORFs are shown. Arrows indicate transcriptional orientation. The stippled extension of the US3 ORF marks the start at an upstream ATG codon. Relevant cleavage sites are indicated: B, BamHI; E, EcoRV; P, PstI; and X, XhoI. (C) Genomic arrangement of the US3 deletion mutants that contain either a PstI deletion ({Delta}I) or an EcoRV/XhoI deletion ({Delta}II) and a concomitant insertion of a GFP expression cassette. (D) Construct expressing US3 as a GST–US3 fusion protein used for the immunization of a rabbit.

 
{blacksquare} Preparation of monospecific US3 antiserum.
To obtain an antiserum specific for the US3 protein, the predicted US3 ORF was amplified by PCR using platinum Pfx DNA polymerase (Life Technologies) and the primers US3FOR, 5' CACAGAATTCCAATGGCCGACGCCGGAATC 3' (nt 2921–2940, accession no. D00676), and US3REV, 5' CACAGAATTCCTACCGCTCGGAGCCGGCCC 3' (nt 3950–3931, accession no. D00676). Both primers contained an EcoRI site (italics) for convenient cloning. The resulting 1 kb fragment was cloned into the mammalian expression vector pcDNA3 (Invitrogen) and, for expression in Escherichia coli, in-frame into the bacterial expression vector pGEX-4T-2 (Amersham Pharmacia). A 63 kDa glutathione S-transferase (GST) fusion protein was purified after SDS–PAGE by electroelution and used for the immunization of a rabbit.

{blacksquare} Metabolic labelling and immunoprecipitation.
RK13 cells were infected at an m.o.i. of 5 with the respective viruses, in medium containing either [35S]methionine/cysteine (ICN) or [32P]orthophosphate (ICN). At 16 h after infection, cells were lysed and radioactively labelled proteins were precipitated, as described previously (Lukács et al., 1985Down ).

{blacksquare} Immunofluorescence and electron microscopy.
These techniques were performed as described previously (Granzow et al., 2001Down ; Klupp et al., 2000Down ).


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Purified virions of wild-type PrV-Ka (Fig. 2Down, lanes 1) or PrV-{Delta}US3 (Fig. 2Down, lanes 2), as well as RK13 cells infected with PrV-Ka (Fig. 2Down, lanes 3) or PrV-{Delta}US3 (Fig. 2Down, lanes 4), were analysed by immunoblotting using the monospecific anti-US3 serum (Fig. 2ADown), an anti-UL34 serum (Fig. 2BDown; Klupp et al., 2000Down ), an anti-UL49 serum (Fig. 2CDown; Brack et al., 1999Down ) or an anti-gB monoclonal antibody (MAb) (Fig. 2DDown). The anti-US3 serum detected 41 and 53 kDa proteins in lysates of PrV-Ka-infected cells and a 41 kDa protein in purified wild-type virions, which parallels earlier studies (van Zijl et al., 1990Down ; Zhang et al., 1990Down ). No reactivity was detected in PrV-{Delta}US3 virions or infected cells. For control, the UL34 protein was detected similarly in cells infected by either virus, but was absent from purified virions (Klupp et al., 2000Down ). In contrast, the UL49 protein was present in all preparations, as was gB. These data demonstrate that our antiserum specifically recognizes the PrV US3 protein and that deletion of US3 has no effect on the intracellular steady-state level of UL34. Also, it did not lead to the incorporation of UL34 into mature extracellular virions.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Western blot of infected RK13 cells and purified virions. Purified virions of PrV-Ka (lanes 1) or PrV-{Delta}US3 (lanes 2), as well as lysates of PrV-Ka-infected cells (lanes 3) and PrV-{Delta}US3-infected cells (lanes 4) were separated by SDS–PAGE, blotted and incubated with antisera specific for US3 (A), UL34 (B), UL49 (C) or gB (D). The positions of the molecular mass marker for (A–C) are indicated on the left, whereas the positions of the molecular mass marker for (D) are indicated on the right.

 
To analyse whether deletion of US3 has an effect on the intracellular localization of UL34, RK13 cells were infected with wild-type PrV or UL34- or US3-deleted PrV mutants and analysed by confocal laser scan microscopy using monospecific sera directed against either the UL34 gene product or the US3 gene product. As shown in Fig. 3Down, in wild-type PrV-infected cells, UL34 was primarily detected in a perinuclear rim, whereas US3 showed diffuse staining that totally covered the infected cells. In the absence of UL34, US3 was still detected in the cytoplasm and nuclei of infected cells. In contrast, the absence of US3 altered the intracellular localization of UL34, resulting in diffuse staining with strongly reduced perinuclear accumulation. Thus, deletion of US3 from the viral genome influences the intracellular localization of UL34, whereas deletion of UL34 apparently did not affect the localization of US3. To assess whether the observed effect can be reproduced by transient expression, expression plasmids for UL34 and US3 were transfected into RK13 cells either singly or in combination. Unfortunately, the expression of US3 proved to be detrimental to the cells and we were unable to reproducibly differentiate specific effects from the drastically altered morphological appearance of dying cells (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3. Immunofluorescence of infected RK13 cells. Cells were infected with wild-type PrV-Ka or the UL34- ({Delta}UL34) or US3-deletion ({Delta}US3) mutants under plaque assay conditions (Klupp et al., 2000Down ). Cells were fixed 1 day after infection with ethanol. Immunofluorescence was performed using polyclonal rabbit antisera specific for UL34 ({alpha}-UL34) or US3 ({alpha}-US3). Assay results were recorded by laser scanning microscopy.

 
Previously, the absence of several proteins, including PrV gB (Peeters et al., 1992Down ), HSV-1 gK (Foster & Kousoulas, 1999Down ) and PrV US3 (Wagenaar et al., 1995Down ), has been suggested to result in the accumulation of enveloped virions in the perinuclear space. In exhaustive studies, we were not able to see a similar defect in our gB- or gK-deleted PrV mutants (Dietz et al., 2000Down ; Granzow et al., 2001Down ; Klupp et al., 1998Down ). Thus, up to now, the relevance of these previous findings is unclear. To ascertain whether the results on US3 could be reproduced, cells infected with wild-type PrV-Ka (Fig. 4Down) or PrV-{Delta}US3 (Fig. 5Down) were analysed by electron microscopy. As shown in Fig. 5(ADown–CDown), we observed an accumulation of enveloped virions within large invaginations of the inner leaflet of the nuclear membrane; this was not detected after wild-type PrV-Ka infection (Fig. 4ADown–CDown). Therefore, the US3 deletion mutant is, so far, the only PrV mutant that reproducibly exhibited a defect at this stage of virion morphogenesis.



View larger version (160K):
[in this window]
[in a new window]
 
Fig. 4. Electron microscopy of RK13 cells infected with PrV-Ka. Cells were infected at an m.o.i. of 0·5 and analysed 14 h after infection, as described previously (Klupp et al., 2000Down ). Cells show all stages of virus morphogenesis (A), including budding at the inner nuclear membrane (B), as well as intracytoplasmic and extracellular virions (C). Immunogold labelling using an anti-UL34 serum demonstrates the presence of UL34 in both leaflets of the perinuclear membrane (D), as well as in perinuclear primary enveloped virions (E). (A, C) Bars, 1 µm. (B, D and E) Bars, 150 nm.

 


View larger version (177K):
[in this window]
[in a new window]
 
Fig. 5. Electron microscopy of RK13 cells infected with PrV-{Delta}US3. Cells were infected at an m.o.i. of 0·5 and analysed 14 h after infection, as described previously (Klupp et al., 2000Down ). Infected cells show an accumulation of enveloped virions in invaginations of the inner leaflet of the nuclear membrane (A–C). Immunolabelling with the UL34 antiserum demonstrates the presence of UL34 in both leaflets of the nuclear membrane (D, inset). (A) Bar, 1·0 µm. (B–D) Bar, 250 nm. (D, inset) Bar, 100 nm.

 
Despite its effect on intracellular localization of UL34 and on the accumulation in the perinuclear space of enveloped virions, the absence of US3 only moderately impairs virus replication, resulting in an approximately 10-fold decrease in final titres (Kimman et al., 1994Down ; unpublished observations). Therefore, if the presence of UL34 in the nuclear membrane is required for primary envelopment and subsequent de-envelopment, it must localize to this subcellular compartment, even in the absence of US3. To analyse this in detail, we used our monospecific anti-UL34 serum in immunoelectron microscopy. UL34 was indeed detectable by immunogold labelling in the nuclear membrane in wild-type PrV-Ka (Fig. 4DUp) as well as in PrV-{Delta}US3-infected cells (Fig. 5DUp). This parallels earlier findings of nuclear membrane localization of UL34 in transfected cells that only express the UL34 protein (Klupp et al., 2000Down ). The UL34 protein could also be demonstrated in enveloped virus particles of PrV-Ka (Fig. 4EUp) and PrV-{Delta}US3 (Fig. 6ADown) in the perinuclear space. As observed before, intracytoplasmic and extracellular enveloped virions were not labelled by the UL34 serum (Fig. 6BDown; Klupp et al., 2000Down ). The particular phenotype seen in the US3 deletion mutants, i.e. accumulation of virions in the perinuclear space, provides the opportunity to analyse more easily the composition of these virions by immunoelectron microscopy. As shown in Fig. 6(CDown–EDown), a polyclonal antiserum against gB labelled intracytoplasmic (Fig. 6DDown) and extracellular virions (Fig. 6EDown), but failed to react with perinuclear virions (Fig. 6CDown). Similar results were obtained using a MAb against gC (Fig. 6FDown–HDown). Both, the antiserum and the MAb recognize mature and immature forms of the glycoproteins (data not shown). This is the first direct evidence to indicate that the glycoprotein composition in the primary envelope is different from that of mature virions, which is most easily explained by the de-/re-envelopment model. In correlation with these results, we have demonstrated previously that virion morphogenesis proceeds undisturbed in the absence of gH or gB (Granzow et al., 2001Down ).



View larger version (154K):
[in this window]
[in a new window]
 
Fig. 6. Cells were infected with PrV-{Delta}US3 at an m.o.i. of 0·5 and analysed by immunoelectron microscopy 14 h after infection, as described previously (Klupp et al., 2000Down ). Virions in the perinuclear space (A, C, F), the trans-Golgi area (B, D, G) and the extracellular space (B, E, H) are shown labelled with anti-UL34 serum (A, B), anti-gB serum (C–E) or anti-gC MAb (F–H). Bars, 250 nm.

 
In the absence of the US3 protein kinase, the intracellular localization of the UL34 protein is altered, which correlates with an accumulation of enveloped virions in the perinuclear space. Thus, any effect of US3 on the UL34 protein does not preclude the primary envelopment of intranuclear capsids. However, the loss of the primary envelope by fusion with the outer leaflet of the nuclear membrane appears to be less efficient in the absence of US3. This may be due to a difference in the phosphorylation of UL34, which, in HSV-1, has been shown to be the substrate for the US3 kinase (Purves et al., 1991Down ). To confirm that the PrV UL34 protein is also a substrate for the PrV US3 kinase, cells infected with PrV-Ka (Fig. 7Down, lanes 1, 4 and 7), PrV-{Delta}US3 (Fig. 7Down, lanes 2, 5 and 8) or PrV-{Delta}UL34 (Fig. 7Down, lanes 3, 6 and 9) were metabolically labelled with either [35S]methionine/cysteine (Fig. 7ADown) or [32P]orthophosphate (Fig. 7BDown) and immunoprecipitated using antibodies against gB (Fig. 7Down, lanes 1–3), UL34 (Fig. 7Down, lanes 4–6) or US3 (Fig. 7Down, lanes 7–9). Comparison of the resulting autoradiographs after SDS–PAGE demonstrates phosphorylation of the uncleaved precursor and large proteolytic cleavage product of gB, irrespective of the absence or presence of US3. The smaller cleavage product did not appear to be phosphorylated. In PrV-Ka- and PrV-{Delta}UL34-infected cells, the US3 protein is also phosphorylated, whereas it is completely absent in PrV-{Delta}US3-infected cells, as expected. Surprisingly, the UL34 protein was also phosphorylated to a similar extent irrespective of the absence or presence of US3 (Fig. 7Down, lanes 4 and 5). The identity of the precipitated protein could be confirmed by its absence in PrV-{Delta}UL34-infected cells (Fig. 7Down, lane 6). We conclude that PrV UL34 represents a phosphoprotein similar to its homologue in HSV-1, but, unlike the situation in HSV-1, it is not or not exclusively phosphorylated by the US3 kinase. Comparing the amino acid sequences of the HSV-1 and the PrV UL34 proteins, this lack of US3-mediated phosphorylation correlates with the absence of the identified consensus sequence for US3 phosphorylation (Purves et al., 1986Down ), which is localized in a region of the HSV-1 UL34 protein that is not conserved in alphaherpesvirus UL34 homologues, including PrV UL34.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 7. RK13 cells infected with PrV-Ka (lanes 1, 4 and 7), PrV-{Delta}US3 (lanes 2, 5 and 8) or PrV-{Delta}UL34 (lanes 3, 6 and 9) were labelled with [35S]methionine/cysteine (A) or [32P]orthophosphate (B) from 1 to 16 h after infection. Lysates were precipitated with antibodies against gB (lanes 1–3), UL34 protein (lanes 4–6) or US3 protein (lanes 7–9). The positions of the US3 and UL34 proteins are indicated on the right and the positions of the molecular mass marker are indicated on the left.

 
In conclusion, the observed effects are not due to differential phosphorylation of UL34 in the presence or absence of US3, but may correlate with a reduction in the amount of UL34 present in the nuclear membrane, as indicated by our immunofluorescence studies. In either case, virion morphogenesis proceeds quite efficiently, even in the absence of US3, whereas the absence of UL34 drastically impairs virus replication (Klupp et al., 2000Down ).


   Acknowledgments
 
This study was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG Me 854/5-1). We thank U. Hartwig, N. Müller and P. Meyer for expert technical assistance, E. Mundt for help with preparation of the antiserum and U. Fischer and N. Osterrieder for help with the confocal laser scan microscope.


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Brack, A., Dijkstra, J., Granzow, H., Klupp, B. G. & Mettenleiter, T. C. (1999). Inhibition of virion maturation by simultaneous deletion of glycoproteins E, I, and M of pseudorabies virus. Journal of Virology 73, 5364-5372.[Abstract/Free Full Text]

Dietz, P., Klupp, B. G., Fuchs, W., Köllner, B., Weiland, E. & Mettenleiter, T. C. (2000). Pseudorabies virus glycoprotein K requires the UL20 gene product for processing. Journal of Virology 74, 5083-5090.[Abstract/Free Full Text]

Foster, T. P. & Kousoulas, K. G. (1999). Genetic analysis of the role of herpes simplex virus type 1 glycoprotein K in infectious virus production and egress. Journal of Virology 73, 8457-8468.[Abstract/Free Full Text]

Graham, F. L. & van der Eb, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456-467.[Medline]

Granzow, H., Weiland, F., Jöns, A., Klupp, B. G., Karger, A. & Mettenleiter, T. C. (1997). Ultrastructural analysis of the replication cycle of pseudorabies virus in cell culture: a reassessment. Journal of Virology 71, 2072-2082.[Abstract]

Granzow, H., Klupp, B. G., Fuchs, W., Veits, J., Osterrieder, N. & Mettenleiter, T. C. (2001). Egress of alphaherpesviruses: comparative ultrastructural study. Journal of Virology 75, 3675-3684.[Abstract/Free Full Text]

Jöns, A. & Mettenleiter, T. C. (1997). Green fluorescent protein expressed by recombinant pseudorabies virus as an in vivo marker for viral replication. Journal of Virological Methods 66, 283-292.[Medline]

Kaplan, A. S. & Vatter, A. E. (1959). A comparison of herpes simplex and pseudorabies viruses. Virology 13, 78-92.

Kimman, T. G., de Wind, N., de Bruin, T., de Visser, Y. & Voermans, J. (1994). Inactivation of glycoprotein gE and thymidine kinase or the US3-encoded protein kinase synergistically decreases in vivo replication of pseudorabies virus and the induction of protective immunity. Virology 205, 511-518.[Medline]

Klupp, B. G., Baumeister, J., Dietz, P., Granzow, H. & Mettenleiter, T. C. (1998). Pseudorabies virus glycoprotein gK is a virion structural component involved in virus release but is not required for entry. Journal of Virology 72, 1949-1958.[Abstract/Free Full Text]

Klupp, B. G., Granzow, H. & Mettenleiter, T. C. (2000). Primary envelopment of pseudorabies virus at the nuclear membrane requires the UL34 gene product. Journal of Virology 74, 10063-10073.[Abstract/Free Full Text]

Lukács, N., Thiel, H.-J., Mettenleiter, T. C. & Rziha, H.-J. (1985). Demonstration of three major species of pseudorabies virus glycoproteins and identification of a disulfide-linked glycoprotein complex. Journal of Virology 53, 166-173.[Abstract/Free Full Text]

Peeters, B., de Wind, N., Hooisma, M., Wagenaar, F., Gielkens, A. & Moormann, R. (1992). Pseudorabies virus envelope glycoproteins gp50 and gII are essential for virus penetration, but only gII is involved in membrane fusion. Journal of Virology 66, 894-905.[Abstract/Free Full Text]

Purves, F. C., Deana, A. D., Marchiori, F., Leader, D. P. & Pinna, L. A. (1986). The substrate specificity of the protein kinase induced in cells infected with herpesviruses: studies with synthetic substrates indicate structural requirements distinct from other protein kinases. Biochimica et Biophysica Acta 889, 208-215.[Medline]

Purves, F. C., Longnecker, R. M., Leader, D. P. & Roizman, B. (1987). Herpes simplex virus 1 protein kinase is encoded by open reading frame US3 which is not essential for virus growth in cell culture. Journal of Virology 61, 2896-2901.[Abstract/Free Full Text]

Purves, F. C., Spector, D. & Roizman, B. (1991). The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene. Journal of Virology 65, 5757-5764.[Abstract/Free Full Text]

Purves, F. C., Spector, D. & Roizman, B. (1992). UL34, the target of the herpes simplex US3 protein kinase, is a membrane protein which in its unphosphorylated state associates with novel phosphoproteins. Journal of Virology 66, 4295-4303.[Abstract/Free Full Text]

Roller, R., Zhou, Y., Schnetzer, R., Ferguson, J. & DeSalvo, D. (2000). Herpes simplex virus type 1 UL34 gene product is required for viral envelopment. Journal of Virology 74, 117-129.[Abstract/Free Full Text]

van Zijl, M., van der Gulden, H., de Wind, N., Gielkens, A. & Berns, A. (1990). Identification of two genes in the unique short region of pseudorabies virus; comparison with herpes simplex virus and varicella-zoster virus. Journal of General Virology 71, 1747-1755.[Abstract/Free Full Text]

Wagenaar, F., Pol, J. M. A., Peeters, B., Gielkens, A. L. J., de Wind, N. & Kimman, T. G. (1995). The US3-encoded protein kinase from pseudorabies virus affects egress of virions from the nucleus. Journal of General Virology 76, 1851-1859.[Abstract/Free Full Text]

Zhang, G. & Leader, D. P. (1990). The structure of the pseudorabies virus genome at the end of the inverted repeat sequences proximal to the junction with the short unique region. Journal of General Virology 71, 2433-2441.[Abstract/Free Full Text]

Zhang, G., Stevens, R. & Leader, D. P. (1990). The protein kinase encoded in the short unique region of pseudorabies virus: description of the gene and identification of its product in virions and in infected cells. Journal of General Virology 71, 1757-1765.[Abstract/Free Full Text]

Received 9 May 2001; accepted 6 July 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
T. Morimoto, J. Arii, M. Tanaka, T. Sata, H. Akashi, M. Yamada, Y. Nishiyama, M. Uema, and Y. Kawaguchi
Differences in the Regulatory and Functional Effects of the Us3 Protein Kinase Activities of Herpes Simplex Virus 1 and 2
J. Virol., November 15, 2009; 83(22): 11624 - 11634.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Wills, F. Mou, and J. D. Baines
The UL31 and UL34 Gene Products of Herpes Simplex Virus 1 Are Required for Optimal Localization of Viral Glycoproteins D and M to the Inner Nuclear Membranes of Infected Cells
J. Virol., May 15, 2009; 83(10): 4800 - 4809.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. E. Padula, M. L. Sydnor, and D. W. Wilson
Isolation and Preliminary Characterization of Herpes Simplex Virus 1 Primary Enveloped Virions from the Perinuclear Space
J. Virol., May 15, 2009; 83(10): 4757 - 4765.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Mou, E. Wills, and J. D. Baines
Phosphorylation of the UL31 Protein of Herpes Simplex Virus 1 by the US3-Encoded Kinase Regulates Localization of the Nuclear Envelopment Complex and Egress of Nucleocapsids
J. Virol., May 15, 2009; 83(10): 5181 - 5191.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. Milbradt, S. Auerochs, H. Sticht, and M. Marschall
Cytomegaloviral proteins that associate with the nuclear lamina: components of a postulated nuclear egress complex
J. Gen. Virol., March 1, 2009; 90(3): 579 - 590.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Hofemeister and P. O'Hare
Nuclear Pore Composition and Gating in Herpes Simplex Virus-Infected Cells
J. Virol., September 1, 2008; 82(17): 8392 - 8399.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Loret, G. Guay, and R. Lippe
Comprehensive Characterization of Extracellular Herpes Simplex Virus Type 1 Virions
J. Virol., September 1, 2008; 82(17): 8605 - 8618.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Mou, E. G. Wills, R. Park, and J. D. Baines
Effects of Lamin A/C, Lamin B1, and Viral US3 Kinase Activity on Viral Infectivity, Virion Egress, and the Targeting of Herpes Simplex Virus UL34-Encoded Protein to the Inner Nuclear Membrane
J. Virol., August 15, 2008; 82(16): 8094 - 8104.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Erazo, M. B. Yee, N. Osterrieder, and P. R. Kinchington
Varicella-Zoster Virus Open Reading Frame 66 Protein Kinase Is Required for Efficient Viral Growth in Primary Human Corneal Stromal Fibroblast Cells
J. Virol., August 1, 2008; 82(15): 7653 - 7665.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Klupp, J. Altenschmidt, H. Granzow, W. Fuchs, and T. C. Mettenleiter
Glycoproteins Required for Entry Are Not Necessary for Egress of Pseudorabies Virus
J. Virol., July 1, 2008; 82(13): 6299 - 6309.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Santarelli, A. Farina, M. Granato, R. Gonnella, S. Raffa, L. Leone, R. Bei, A. Modesti, L. Frati, M. R. Torrisi, et al.
Identification and Characterization of the Product Encoded by ORF69 of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol., May 1, 2008; 82(9): 4562 - 4572.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. Camozzi, S. Pignatelli, C. Valvo, G. Lattanzi, C. Capanni, P. Dal Monte, and M. P. Landini
Remodelling of the nuclear lamina during human cytomegalovirus infection: role of the viral proteins pUL50 and pUL53
J. Gen. Virol., March 1, 2008; 89(3): 731 - 740.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. E. Coller, J. I-H. Lee, A. Ueda, and G. A. Smith
The Capsid and Tegument of the Alphaherpesviruses Are Linked by an Interaction between the UL25 and VP1/2 Proteins
J. Virol., November 1, 2007; 81(21): 11790 - 11797.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Leach, S. L. Bjerke, D. K. Christensen, J. M. Bouchard, F. Mou, R. Park, J. Baines, T. Haraguchi, and R. J. Roller
Emerin Is Hyperphosphorylated and Redistributed in Herpes Simplex Virus Type 1-Infected Cells in a Manner Dependent on both UL34 and US3
J. Virol., October 1, 2007; 81(19): 10792 - 10803.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Fang, X. Dai, and D. A. Theilmann
Autographa californica Multiple Nucleopolyhedrovirus EXON0 (ORF141) Is Required for Efficient Egress of Nucleocapsids from the Nucleus
J. Virol., September 15, 2007; 81(18): 9859 - 9869.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Mou, T. Forest, and J. D. Baines
US3 of Herpes Simplex Virus Type 1 Encodes a Promiscuous Protein Kinase That Phosphorylates and Alters Localization of Lamin A/C in Infected Cells
J. Virol., June 15, 2007; 81(12): 6459 - 6470.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Gershburg, S. Raffa, M. R. Torrisi, and J. S. Pagano
Epstein-Barr Virus-Encoded Protein Kinase (BGLF4) Is Involved in Production of Infectious Virus
J. Virol., May 15, 2007; 81(10): 5407 - 5412.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. G. Klupp, H. Granzow, W. Fuchs, G. M. Keil, S. Finke, and T. C. Mettenleiter
Vesicle formation from the nuclear membrane is induced by coexpression of two conserved herpesvirus proteins
PNAS, April 24, 2007; 104(17): 7241 - 7246.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Buser, P. Walther, T. Mertens, and D. Michel
Cytomegalovirus Primary Envelopment Occurs at Large Infoldings of the Inner Nuclear Membrane
J. Virol., March 15, 2007; 81(6): 3042 - 3048.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. D. Baines, E. Wills, R. J. Jacob, J. Pennington, and B. Roizman
Glycoprotein M of Herpes Simplex Virus 1 Is Incorporated into Virions during Budding at the Inner Nuclear Membrane
J. Virol., January 15, 2007; 81(2): 800 - 812.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. X. Zhu, X. Li, F. Zhou, S.-J. Gao, and Y. Yuan
Functional Characterization of Kaposi's Sarcoma-Associated Herpesvirus ORF45 by Bacterial Artificial Chromosome-Based Mutagenesis
J. Virol., December 15, 2006; 80(24): 12187 - 12196.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Michael, S. Bottcher, B. G. Klupp, A. Karger, and T. C. Mettenleiter
Pseudorabies virus particles lacking tegument proteins pUL11 or pUL16 incorporate less full-length pUL36 than wild-type virus, but specifically accumulate a pUL36 N-terminal fragment
J. Gen. Virol., December 1, 2006; 87(12): 3503 - 3507.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Remillard-Labrosse, G. Guay, and R. Lippe
Reconstitution of Herpes Simplex Virus Type 1 Nuclear Capsid Egress In Vitro
J. Virol., October 1, 2006; 80(19): 9741 - 9753.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. G. Klupp, H. Granzow, G. M. Keil, and T. C. Mettenleiter
The Capsid-Associated UL25 Protein of the Alphaherpesvirus Pseudorabies Virus Is Nonessential for Cleavage and Encapsidation of Genomic DNA but Is Required for Nuclear Egress of Capsids.
J. Virol., July 1, 2006; 80(13): 6235 - 6246.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Campadelli-Fiume, B. Roizman, P. Wild, T. C. Mettenleiter, and T. Minson
The egress of herpesviruses from cells: the unanswered questions.
J. Virol., July 1, 2006; 80(13): 6716 - 6719.
[Full Text] [PDF]


Home page
J. Virol.Home page
R. Klopfleisch, B. G. Klupp, W. Fuchs, M. Kopp, J. P. Teifke, and T. C. Mettenleiter
Influence of pseudorabies virus proteins on neuroinvasion and neurovirulence in mice.
J. Virol., June 1, 2006; 80(11): 5571 - 5576.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Michael, B. G. Klupp, T. C. Mettenleiter, and A. Karger
Composition of Pseudorabies Virus Particles Lacking Tegument Protein US3, UL47, or UL49 or Envelope Glycoprotein E
J. Virol., February 1, 2006; 80(3): 1332 - 1339.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Kato, M. Yamamoto, T. Ohno, M. Tanaka, T. Sata, Y. Nishiyama, and Y. Kawaguchi
Herpes Simplex Virus 1-Encoded Protein Kinase UL13 Phosphorylates Viral Us3 Protein Kinase and Regulates Nuclear Localization of Viral Envelopment Factors UL34 and UL31
J. Virol., February 1, 2006; 80(3): 1476 - 1486.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. W. G. Luxton, J. I-H. Lee, S. Haverlock-Moyns, J. M. Schober, and G. A. Smith
The Pseudorabies Virus VP1/2 Tegument Protein Is Required for Intracellular Capsid Transport
J. Virol., January 1, 2006; 80(1): 201 - 209.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Schaap, J.-F. Fortin, M. Sommer, L. Zerboni, S. Stamatis, C.-C. Ku, G. P. Nolan, and A. M. Arvin
T-Cell Tropism and the Role of ORF66 Protein in Pathogenesis of Varicella-Zoster Virus Infection
J. Virol., October 15, 2005; 79(20): 12921 - 12933.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Leuzinger, U. Ziegler, E. M. Schraner, C. Fraefel, D. L. Glauser, I. Heid, M. Ackermann, M. Mueller, and P. Wild
Herpes Simplex Virus 1 Envelopment Follows Two Diverse Pathways
J. Virol., October 15, 2005; 79(20): 13047 - 13059.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Marschall, A. Marzi, P. a. d. Siepen, R. Jochmann, M. Kalmer, S. Auerochs, P. Lischka, M. Leis, and T. Stamminger
Cellular p32 Recruits Cytomegalovirus Kinase pUL97 to Redistribute the Nuclear Lamina
J. Biol. Chem., September 30, 2005; 280(39): 33357 - 33367.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
L. E. Pomeranz, A. E. Reynolds, and C. J. Hengartner
Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine
Microbiol. Mol. Biol. Rev., September 1, 2005; 69(3): 462 - 500.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. W. Favoreel, G. Van Minnebruggen, D. Adriaensen, and H. J. Nauwynck
Cytoskeletal rearrangements and cell extensions induced by the US3 kinase of an alphaherpesvirus are associated with enhanced spread
PNAS, June 21, 2005; 102(25): 8990 - 8995.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Schumacher, B. K. Tischer, S. Trapp, and N. Osterrieder
The Protein Encoded by the US3 Orthologue of Marek's Disease Virus Is Required for Efficient De-Envelopment of Perinuclear Virions and Involved in Actin Stress Fiber Breakdown
J. Virol., April 1, 2005; 79(7): 3987 - 3997.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Granzow, B. G. Klupp, and T. C. Mettenleiter
Entry of Pseudorabies Virus: an Immunogold-Labeling Study
J. Virol., March 1, 2005; 79(5): 3200 - 3205.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. G. Klupp, S. Bottcher, H. Granzow, M. Kopp, and T. C. Mettenleiter
Complex Formation between the UL16 and UL21 Tegument Proteins of Pseudorabies Virus
J. Virol., February 1, 2005; 79(3): 1510 - 1522.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Kopp, H. Granzow, W. Fuchs, B. Klupp, and T. C. Mettenleiter
Simultaneous Deletion of Pseudorabies Virus Tegument Protein UL11 and Glycoprotein M Severely Impairs Secondary Envelopment
J. Virol., March 15, 2004; 78(6): 3024 - 3034.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Granzow, B. G. Klupp, and T. C. Mettenleiter
The Pseudorabies Virus US3 Protein Is a Component of Primary and of Mature Virions
J. Virol., February 1, 2004; 78(3): 1314 - 1323.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. J. Ryckman and R. J. Roller
Herpes Simplex Virus Type 1 Primary Envelopment: UL34 Protein Modification and the US3-UL34 Catalytic Relationship
J. Virol., January 1, 2004; 78(1): 399 - 412.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. G. Klupp, H. Granzow, W. Fuchs, E. Mundt, and T. C. Mettenleiter
Pseudorabies Virus UL3 Gene Codes for a Nuclear Protein Which Is Dispensable for Viral Replication
J. Virol., January 1, 2004; 78(1): 464 - 472.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. V. Minnebruggen, H. W. Favoreel, L. Jacobs, and H. J. Nauwynck
Pseudorabies Virus US3 Protein Kinase Mediates Actin Stress Fiber Breakdown
J. Virol., August 15, 2003; 77(16): 9074 - 9080.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Kopp, H. Granzow, W. Fuchs, B. G. Klupp, E. Mundt, A. Karger, and T. C. Mettenleiter
The Pseudorabies Virus UL11 Protein Is a Virion Component Involved in Secondary Envelopment in the Cytoplasm
J. Virol., May 1, 2003; 77(9): 5339 - 5351.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. G. Lyman, G. L. Demmin, and B. W. Banfield
The Attenuated Pseudorabies Virus Strain Bartha Fails To Package the Tegument Proteins Us3 and VP22
J. Virol., December 20, 2002; 77(2): 1403 - 1414.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. E. Reynolds, E. G. Wills, R. J. Roller, B. J. Ryckman, and J. D. Baines
Ultrastructural Localization of the Herpes Simplex Virus Type 1 UL31, UL34, and US3 Proteins Suggests Specific Roles in Primary Envelopment and Egress of Nucleocapsids
J. Virol., July 29, 2002; 76(17): 8939 - 8952.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Fuchs, H. Granzow, B. G. Klupp, M. Kopp, and T. C. Mettenleiter
The UL48 Tegument Protein of Pseudorabies Virus Is Critical for Intracytoplasmic Assembly of Infectious Virions
J. Virol., June 5, 2002; 76(13): 6729 - 6742.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. G. Klupp, W. Fuchs, H. Granzow, R. Nixdorf, and T. C. Mettenleiter
Pseudorabies Virus UL36 Tegument Protein Physically Interacts with the UL37 Protein
J. Virol., February 22, 2002; 76(6): 3065 - 3071.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. C. Mettenleiter
Herpesvirus Assembly and Egress
J. Virol., February 15, 2002; 76(4): 1537 - 1547.
[Full Text] [PDF]


Home page
J. Virol.Home page
W. Fuchs, B. G. Klupp, H. Granzow, N. Osterrieder, and T. C. Mettenleiter
The Interacting UL31 and UL34 Gene Products of Pseudorabies Virus Are Involved in Egress from the Host-Cell Nucleus and Represent Components of Primary Enveloped but Not Mature Virions
J. Virol., January 1, 2002; 76(1): 364 - 378.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klupp, B. G.
Right arrow Articles by Mettenleiter, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klupp, B. G.
Right arrow Articles by Mettenleiter, T. C.
Agricola
Right arrow Articles by Klupp, B. G.
Right arrow Articles by Mettenleiter, T. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS