J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruo, S.
Right arrow Articles by Takada, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruo, S.
Right arrow Articles by Takada, K.
Agricola
Right arrow Articles by Maruo, S.
Right arrow Articles by Takada, K.
Journal of General Virology (2001), 82, 2373-2383.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Roles of Epstein–Barr virus glycoproteins gp350 and gp25 in the infection of human epithelial cells

Seiji Maruo1, Lixin Yang1 and Kenzo Takada1

Department of Tumor Virology, Institute for Genetic Medicine, Hokkaido University, Sapporo 060-8638, Japan1

Author for correspondence: Kenzo Takada. Fax +81 11 717 1128. e-mail kentaka{at}med.hokudai.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr virus (EBV) is associated with various epithelial malignancies such as nasopharyngeal carcinoma and gastric carcinoma, and causes oral hairy leukoplakia, a productive EBV infection of the differentiated epithelium of the tongue. However, it is not clear by what mechanism EBV infects epithelial cells. We generated a recombinant EBV that expresses enhanced green fluorescent protein in order to monitor EBV entrance into epithelial cells quickly and quantitatively. Using this monitoring system, we examined the roles of gp350 and gp25 in EBV infection of epithelial cells by utilizing soluble forms of the gp350 and gp25 proteins. EBV infection of three of four examined epithelial cell lines, 293, NU-GC-3 and Lovo, was almost completely blocked by pretreatment of cells with a soluble form of gp350 (designated gp350Ig), and this blockage was dependent on the CD21-binding region of gp350. On the other hand, infection of the other epithelial cell line, AGS, was not inhibited at all by pretreatment with gp350Ig. Moreover, we found that a soluble form of gp25 (designated gp25Ig) preferentially bound to epithelial cells rather than B cells, and pretreatment of cells with gp25Ig substantially blocked EBV infection of some epithelial cells. These results indicate the existence of two distinct pathways in EBV infection of epithelial cells, a gp350-dependent pathway and a gp350-independent pathway, and that gp25 can play a role in the infection of some epithelial cells.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr virus (EBV) is a human herpesvirus that causes infectious mononucleosis and associates with various lymphoid and epithelial malignancies (Rickinson & Kieff, 1996Down ). It is clear that at some frequency EBV infects epithelial cell types in vivo, as the viral genome has been identified in a number of human carcinomas, ranging from nasopharyngeal carcinoma to gastric carcinoma (Shibata & Weiss, 1992Down ; Imai et al., 1994Down ; Fukayama et al., 1994Down ; Rickinson & Kieff, 1996Down ). Moreover, in patients with AIDS, EBV can cause oral hairy leukoplakia, a productive EBV infection of the differentiated epithelium of the tongue (Greenspan et al., 1985Down ; Young et al., 1991Down ). In vitro, EBV readily infects human B cells and transforms them efficiently into proliferating lymphoblasts (Kieff, 1996Down ; Rickinson & Kieff, 1996Down ). Attachment of EBV to B cells is mediated by binding of viral glycoprotein gp350 to its receptor CD21 (Fingeroth et al., 1984Down ; Frade et al., 1985Down ; Nemerow et al., 1987Down ). It has also been shown that additional interaction of the ternary EBV glycoprotein gp85–gp25–gp42 complex with its cellular ligand is required for efficient infection of B cells (Li et al., 1995Down , 1997Down ; Haan et al., 2000Down ). Gp42 can interact with the HLA class II molecules on B cells (Spriggs et al., 1996Down ). In contrast to B cells, however, the precise mechanism by which EBV infects epithelial cells is not well known.

Studies on EBV infection of epithelial cells have been limited by the lack of infection systems in vitro. To overcome this problem, we previously generated an EBV recombinant with a selectable marker, which made it possible to select EBV-infected cells, even when the efficiency of infection was low (Yoshiyama et al., 1995Down ; Shimizu et al., 1996Down ; Nishikawa et al., 1999Down ). In our previous studies using this virus, many human epithelial cell lines could be infected by EBV, and infection was not inhibited by pretreatment of cells with anti-CD21 monoclonal antibody, suggesting that infection was mediated by a receptor other than CD21 (Yoshiyama et al., 1997Down ; Imai et al., 1998Down ). Janz et al. (2000)Down generated an EBV recombinant lacking the gp350 gene and demonstrated that a human embryonic kidney cell line, 293, could be infected with this gp350-deleted EBV. On the other hand, Fingeroth et al. (1999)Down reported that 293 cells express a low level of CD21 and are susceptible to EBV infection, with infection being blocked with antibodies specific for CD21. Therefore, whether gp350–CD21 interaction is required for infection of epithelial cells is still controversial.

In contrast to the finding that the gp85–gp25–gp42 complex is required for efficient infection of B cells, it has been suggested that the gp85–gp25 complex is involved in the infection of epithelial cells. Gp85 and gp25 are the EBV homologues of herpes simplex virus gH and gL, respectively, and the complex as a whole has been reported to be important for the ability of the virus to penetrate cells (Miller & Hutt-Fletcher, 1988Down ; Haddad & Hutt-Fletcher, 1989Down ). L. M. Hutt-Fletcher and colleagues showed that two complexes, the gp85–gp25–gp42 complex and the gp85–gp25 complex, exist in EBV virions, and that a monoclonal antibody that reacts with the gp85–gp25 complex but not the gp85–gp25–gp42 complex neutralized infection of epithelial cells but not B cells (Li et al., 1995Down ; Wang et al., 1998Down ). Conversely, a recombinant EBV lacking gp42 that expressed the gp85–gp25 complex but not the gp85–gp25–gp42 complex could infect epithelial cells but not B cells (Wang & Hutt-Fletcher, 1998Down ). Furthermore, they and our group recently showed that attachment of a recombinant EBV lacking gp85 to CD21-negative epithelial cells was impaired (Molesworth et al., 2000Down ; Oda et al., 2000Down ). These findings indicate the critical role of the gp85–gp25 complex in the infection of epithelial cells, and further suggest the existence of a receptor for this complex on epithelial cells. But whether gp25 in this complex has an active role in this type of infection is not yet known.

In this study, we generated a recombinant EBV that expressed enhanced green fluorescent protein (EGFP) for brief monitoring of infection. Using this monitoring system, we examined the roles of gp350 and gp25 in EBV infection of epithelial cells by utilizing soluble forms of gp350 and gp25 proteins. Here we demonstrate that there are two distinct pathways in the infection of epithelial cells, i.e. a gp350-dependent pathway and a gp350-independent pathway. We also show that a soluble form of gp25 protein can bind to epithelial cells, and that EBV infection of some epithelial cells is inhibited by pretreatment of cells with soluble gp25, suggesting an active role for gp25 in the infection of epithelial cells.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells.
Akata, a human Burkitt’s lymphoma (BL)-derived cell line that carries and can be induced to make EBV (Takada, 1984Down ; Takada et al., 1991Down ), an EBV-negative Akata cell line (Shimizu et al., 1994Down ), Raji (a human EBV-positive BL cell line) (Pulvertaft, 1964Down ), BJAB (a human EBV-negative B lymphoma cell line) (Imai et al., 1998Down ) and NU-GC-3 (a human gastric adenocarcinoma cell line) (Akiyama et al., 1988Down ) were grown in RPMI 1640 medium (Sigma) supplemented with 10% foetal bovine serum (FBS) (Gibco). 293, a human embryonic epithelial kidney cell line that has been transformed by the introduction of the E1a and E1b genes of adenovirus type 5 (Graham et al., 1977Down ), Lovo (a human colon adenocarcinoma cell line) (Drewinko et al., 1976Down ) and COS-7 (an SV40-transformed African green monkey kidney cell line) (Gluzman, 1981Down ) were grown in Dulbecco’s modified Eagle’s medium (Sigma) supplemented with 10% FBS. AGS (a human gastric signet ring cell carcinoma cell line) (Barranco et al., 1983Down ) was grown in Ham’s F-12 medium (Gibco) supplemented with 10% FBS.

{blacksquare} Virus production.
EBV was obtained from the culture medium of Akata cells in which EBV production had been induced by surface immunoglobulin G (sIgG) cross-linking (Takada & Ono, 1989Down ). Briefly, rabbit anti-human IgG (Dako) was added to a cell suspension (5x106/ml) to give a final concentration of 0·5% (v/v). The cells were then incubated for 3 h at 37 °C, washed three times, and resuspended (2x106/ml) in RPMI 1640 medium containing 10% FBS. After 3 days incubation, the culture was clarified by centrifugation (1200 g) for 15 min at 4 °C. The supernatant was filtered through a 0·45 µm pore-size membrane and stored at -84 °C until use.

{blacksquare} Generation of a recombinant EBV expressing enhanced green fluorescent protein (EGFP).
The 6 kbp Akata EBV HindIII F fragment, corresponding to bp 140893 to 146916 of the B95-8 sequence (Baer et al., 1984Down ), was cloned into pUC119 (Takara). The EGFP gene derived from pEGFP-C1 (Clontech) was cloned into pSG5 (Stratagene). The resulting plasmid was named pSG5-EGFP. A 2051 bp SalI fragment containing the SV40 early promoter-driven EGFP cassette was excised from pSG5-EGFP, and a 2310 bp EcoRV–SalI fragment containing the neomycin resistance cassette was excised from pcDNA3 (Invitrogen). These fragments were inserted into a SmaI site at bp 143576 of the Akata EBV HindIII F fragment (see Fig. 1Down). This insertion disrupted the BXLF1 ORF, encoding the EBV thymidine kinase, which is nonessential for infection and replication (Shimizu et al., 1996Down ). The HindIII F fragment, now 10·4 kbp as a result of the insertions, was excised from pUC119 and introduced into Akata cells by an electroporation method as described previously (Yoshiyama et al., 1995Down ). Cells were then plated at 104 cells per well in 96-well tissue culture plates in medium containing 700 µg/ml of G418 (Gibco) and fed weekly with fresh drug-containing medium. Resistant clones began to emerge after approximately 3 weeks. Drug-resistant Akata cells were screened by Southern blotting for the presence of homologous recombination with viral DNA. To eliminate wild-type episomes in cells that screened positive for homologous recombination, the virus from drug-resistant cell clones was infected at a low multiplicity into EBV-negative Akata cells, which were reselected with G418 as described previously (Shimizu et al., 1996Down ).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1. (A) Map of the EBV genome surrounding the 6 kbp HindIII F fragment (bp 140893 to 146916). The EGFP cassette and the Neor cassette were inserted into the SmaI site of the BXLF1 ORF. The resulting 10·4 kbp HindIII F fragment containing EGFP and Neor cassettes was used to target for homologous recombination. The arrowheads show restriction endonuclease sites used for Southern blot analysis. The dotted line shows the fragment used as a probe. The numbering of base pairs corresponds to the B95-8 sequence except for the XbaI site at position 152912. The B95-8 virus has an 11801 bp deletion that begins at bp 152012 (Baer et al., 1984Down ). The XbaI site at position 152912 was therefore predicted from the sequence of this deletion in the Raji strain of the virus (Parker et al., 1990Down ). (B) Southern blot analysis of DNA from cells harbouring the wild-type virus (Wt), a mixture of wild-type and recombinant viruses (Wt+Rc) or pure recombinant virus (Rc). DNA was digested with HindIII or XbaI, blotted, and hybridized with the BamHI X probe. The sizes of the fragments expected from DNA from cells harbouring Wt or Rc after digestion with HindIII were 6·0 kbp and 10·4 kbp, respectively. Sizes of fragments expected from DNA from cells harbouring Wt or Rc after digestion with XbaI were 12·2 kbp or 11·3 kbp and 5·2 kbp, respectively. Mr, molecular size markers. (C) Infection of BJAB, Lovo and AGS cells by EGFP-EBV. Cells were incubated with virus solution containing EGFP-EBV, and successful infection was followed 3 days later by EGFP expression observed using fluorescence microscopy (top panel, magnificationx400) and FACS analysis (bottom panel). In the bottom panel, the solid and dotted lines indicate the histograms of cells incubated with EGFP-EBV and those of cells incubated with wild-type EBV, respectively.

 
{blacksquare} Southern blot analysis.
DNA was extracted by the standard proteinase K–SDS method, followed by phenol–chloroform extraction and ethanol precipitation. Purified DNA was digested with an appropriate restriction enzyme, separated by agarose gel electrophoresis in 0·8% agarose (Takara), transferred to a nylon membrane (Amersham), and cross-linked. The membrane was hybridized with the BamHI X fragment of Akata EBV, which had been labelled with alkaline phosphatase by using an Alkphos direct labelling kit (Amersham Pharmacia),and then developed with CDP-Star detection reagent (Amersham).

{blacksquare} EBV infection.
Epithelial cells were plated in 24-well tissue culture plates grown to 80 to 90% confluence. Then, 120 µl of virus solution was added to the cells for 2 h at 37 °C. The virus solution was then removed, and the cells were rinsed three times with medium and returned to culture. The next day, the cells were trypsinized and replated into 6-well tissue culture plates. At 3 days after infection, EGFP expression was evaluated by fluorescence microscopy and FACS analysis.

{blacksquare} Construction of gp350Ig, gp25Ig and their deletion mutants.
A fusion gene encoding the Fc portion of human IgG1 (hIgG1 Fc) fused to the extracellular domain of murine CTLA4, designated CTLA4Ig, was kindly supplied by Masaaki Murakami, Hokkaido University, Sapporo, Japan (Yamada et al., 1996Down ). The CTLA4Ig fusion gene was subcloned into pSG5. The resulting plasmid (pSG5-CTLA4Ig) contained a unique XhoI site upstream of the CTLA4 gene, and a unique BamHI site at the junction between the CTLA4 and the hIgG1 Fc gene. The extracellular domain of gp350 protein from amino acids 1 to 810 was fused to the signal peptide of murine interleukin-6 (IL-6) by two PCR steps using overlapping oligonucleotides. For the first step, the oligonucleotide CATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGGCCTTCCCTATGGAGGCAGCCTTGCTTGT was used as the forward primer, and CTGCAGTGGATCCATGGAGAGGTTTGAGAA as the reverse primer. The template for this step was Akata EBV genomic DNA. For the second step, a portion of the PCR product from the first step was reamplified using an overlapping forward primer, corresponding to the amino-terminal portion of the murine IL-6 signal sequence and containing a SalI site, CTAGCCACTGGTCGACCACCAATGAAGT TCCTCTCTGCAAGAGACT TCCATCCAGT TGCCTTCTTGGGACTG, and the same reverse primer. The product of the PCR reaction was cleaved with restriction endonucleases (SalI and BamHI) at sites introduced in the PCR primers and gel purified. The purified fragment was ligated to the XhoI/BamHI-cleaved pSG5-CTLA4 fragment, which contained the pSG5 backbone and the hIgG1 Fc gene. The ligation product was transformed into E. coli DH5{alpha} cells and colonies were screened for the appropriate plasmid. The sequence of the resulting plasmid (pSG5-gp350Ig) was confirmed by DNA sequencing. The region from amino acids 23 to 137 of the gp25 protein was fused to the signal peptide of murine IL-6 in a manner identical to that described above with the exception of the PCR primers to be used. For the first step, the oligonucleotide CATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGGCCTTCCCTAATTGGGCATACCCATGTTG was used as the forward primer, and CCAGAGGGATCCCCCCCGCGATGCCATGCGTA as the reverse primer. For the second step, the oligonucleotide CTAGCCACTGGTCGACCACCAATGAAGTTCCTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTG was used as the forward primer, and the same reverse primer was used. The PCR product was restriction endonuclease-digested and ligated with the pSG5 vector containing the hIgG1 Fc gene as described for pSG5-gp350Ig construction. The resulting construct (pSG5-gp25Ig) was sequenced to ensure that no coding mutations were present. The deletion mutant gp350{Delta}30, corresponding to amino acids 31 to 810 of the gp350 sequence, and the deletion mutants gp25(51–137), gp25(51–100), gp25(51–70), gp25(71–100) and gp25(23–70), corresponding to amino acids 51 to 137, 51 to 100, 51 to 70, 71 to 100 and 23 to 70 of the gp25 sequence, respectively, were generated by two steps of PCR as described above with specific oligonucleotide primers. Forward primers were designed to contain the signal sequence of murine IL-6. PCR products were digested with appropriate restriction enzymes and ligated with the pSG5 vector containing the hIgG1 Fc gene. All deletion mutants were sequenced after cloning.

{blacksquare} Production of Ig fusion proteins.
COS-7 cells were transfected with expression plasmids using LipofectAmine Plus (Gibco). At 24 h after transfection, culture medium was removed and replaced with serum-free DMEM. Incubation was continued for 6 days at 37 °C, at which time the spent medium was collected. After removal of cellular debris by low-speed centrifugation, the supernatant was filtered through a 0·2 µm pore-size membrane. The supernatants contained Ig fusion proteins at concentrations of 0·5 to 4 µg/ml. Protein concentrations were estimated by Coomassie blue staining of bands after SDS–PAGE using BSA as a standard. Supernatants, which were adjusted to contain the similar amounts of fusion proteins and to which BSA was added to give a final concentration of 0·1% (w/v) for blocking of non-specific binding, were used for the binding experiments. For blocking experiments, Ig fusion proteins were purified using protein A–Sepharose adsorption and low-pH elution, followed by dialysis against medium (Linsley et al., 1991aDown ).

{blacksquare} Antibodies.
Rabbit anti-human IgG, biotinylated rabbit anti-human IgG and R-phycoerythrin-conjugated streptavidin were purchased from Dako. Horseradish peroxidase-conjugated sheep anti-human Ig was purchased from Amersham.

{blacksquare} Blocking infection with Ig fusion proteins and antibodies.
To block infection with Ig fusion proteins, 120 µl of purified Ig fusion proteins in medium was added to epithelial cells grown in 24-well tissue culture plates, and incubated for 1 h at 37 °C; 30 µl of 5% rabbit anti-human IgG (cross-linking antibody) was added and incubated for 1 h at 37 °C, and 50 µl of virus solution was added and incubated for 2 h at 37 °C. The medium with the virus was then removed, and the cells were rinsed three times with medium and returned to culture. At day 3, cells were harvested and analysed for EGFP expression.

{blacksquare} Immunostaining and FACS analysis.
Binding of Ig fusion proteins to B and epithelial cell lines was detected by indirect immunostaining. Before staining, adherent cells were removed from their culture vessels by incubation in PBS containing 2 mM EDTA. Cells were first incubated with supernatants containing Ig fusion proteins for 1 h at 4 °C. They were then washed, and incubated with biotinylated rabbit anti-human IgG (Dako) for 30 min at 4 °C. After washing, cells were allowed to react with R-phycoerythrin-conjugated streptavidin (Dako) for 30 min at 4 °C. Stained cells were analysed with a FACSCalibur (Becton Dickinson). For detection of cells infected with EGFP-EBV, cells were harvested 3 days after infection, and a total of 50000 cells was analysed for EGFP fluorescence with a FACSCalibur.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Generation of a recombinant EBV that expresses EGFP
To monitor the infection of cells by EBV, we generated a recombinant EBV carrying the EGFP gene. An Akata HindIII F fragment into which the SV40 early promoter-driven EGFP gene cassette and the neomycin resistance (Neor) cassette had been inserted at a SmaI site of the BXLF1 ORF (Fig. 1AUp) was transfected into Akata cells carrying EBV episomes. The BXLF1 ORF had been proved to be nonessential for infection and replication (Shimizu et al., 1996Down ). Cells in which recombination had occurred were obtained by selection in the presence of G418. Clones in which homologous recombination had occurred were identified by Southern blotting (Fig. 1BUp). Cells which contained a mixture of wild-type and recombinant episomes as a result of homologous recombination were induced with anti-human IgG for virus production. To derive cells that contained only recombinant viruses, diluted supernatant from induced cells containing a mixture of wild-type and recombinant viruses was used to infect EBV-negative Akata cells, which were reselected with G418. Drug-resistant clones that grew after infection were examined and proved to contain only the recombinant virus. Restriction patterns typical of cells harbouring only the wild-type virus, a mixture of both wild-type and recombinant viruses, or only the recombinant virus are shown in Fig. 1(B)Up. This recombinant virus was termed EGFP-EBV. Supernatant from the induced cell clone that contained pure recombinant EGFP-EBV was used as the virus solution for all following experiments.

Various human cell lines were incubated with the virus solution containing EGFP-EBV, and 3 days later infected cells were evident as EGFP-positive cells by fluorescence microscopy and FACS analysis (Fig. 1CUp). Infectivities of various human cell lines were examined by FACS analysis, and are listed in Table 1Down. Approximately 40 to 60% of Raji cells and 20 to 30% of BJAB cells were positive for EGFP fluorescence after infection with EGFP-EBV. Epithelial cell lines Lovo, NU-GC-3, 293 and AGS could also be successfully infected with EGFP-EBV, but the percentages of EGFP-positive cells in these cell lines were lower than with Raji and BJAB cells.


View this table:
[in this window]
[in a new window]
 
Table 1. Susceptibilities of human cell lines to infection with EGFP-EBV

 
Construction and expression of gp350Ig and gp25Ig fusion proteins
To examine the roles of gp350 and gp25 in the infection of epithelial cells by EBV, soluble fusion molecules in which the extracellular domain of gp350 protein or gp25 protein was fused to the Fc portion of human IgG1 were constructed (Fig. 2ADown). The extracellular domain of gp350 was linked to the signal peptide of murine IL-6 at the N terminus, and the putative signal peptide of gp25 was replaced with the signal peptide of murine IL-6, which mediates efficient release of secreted proteins in transient expression assays (data not shown). Gp350Ig and gp25Ig expression vectors were transfected to COS-7 cells, and spent culture media were immunoprecipitated with protein A–Sepharose. Yields of fusion proteins were typically 0·5 to 4 µg/ml of spent culture medium. As shown in Fig. 2(B)Down, the gp350Ig fusion protein had a molecular mass of over 185 kDa, and the gp25Ig fusion protein had a molecular mass of 45 to 50 kDa under reducing conditions, as was expected. CTLA4Ig, a soluble fusion protein in which the extracellular domain of murine CTLA4 protein was fused to the Fc portion of human IgG1, showed a molecular mass of approximately 50 kDa under reducing conditions as reported previously (Linsley et al., 1991bDown ). CTLA4Ig was used as the control fusion protein (Cont.Ig).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. (A) Schematic representation of the gp350Ig and gp25Ig fusion proteins. The extracellular domain of gp350 protein from amino acids 1 to 810, and the region from amino acids 23 to 137 of the gp25 protein, are indicated by open boxes, the Fc portions of human IgG1 (Fc) are indicated by striped boxes, and the signal peptides of murine IL-6 (SP) are indicated by black boxes. The CD21 binding region of gp350, which corresponds to amino acids 21 to 29 of gp350, is also indicated by a shaded box (Nemerow et al., 1989Down ). (B) Protein A–Sepharose precipitation of recombinant gp350Ig and gp25Ig fusion proteins. COS-7 cells were transfected with gp350Ig, gp25Ig or CTLA4Ig expression plasmids, and the same amounts of cell supernatants were precipitated with protein A–Sepharose. Samples were subjected to SDS–PAGE under reducing conditions. Proteins were directly visualized by silver staining of the gel (left panel), or detected by Western blot analysis using horseradish peroxidase-conjugated sheep anti-human immunoglobulin (right panel). Molecular mass markers are indicated on the left.

 
Binding of gp350Ig and gp25Ig to B cell and epithelial cell lines
We first tested binding activities of gp350Ig and gp25Ig on B cell lines and epithelial cell lines. Supernatants from transfected COS-7 cells were adjusted to contain similar amounts of fusion proteins, and were used as a source of fusion protein. Binding was detected by incubation with biotinyl ated rabbit anti-human IgG and subsequent incubation with R-phycoerythrin-conjugated streptavidin. Gp350Ig bound strongly to the B cell lines Raji and BJAB (Fig. 3Down), both of which were strongly positive for CD21 (data not shown). But the binding of gp350Ig to epithelial cell lines was marginal or could not be detected. On the other hand, gp25Ig bound strongly or moderately to all epithelial cell lines examined, but weakly to B cell lines (Fig. 3Down). That is to say, B cell lines and epithelial cell lines exhibited a contrasting pattern of binding for gp350Ig and gp25Ig. B cell lines were bound preferentially by gp350Ig, and epithelial cell lines were bound preferentially by gp25Ig. CTLA4Ig, which is known to bind to the B cell activation antigen B7 family (Linsley et al., 1991bDown ), bound strongly to B cell lines but not to epithelial cell lines, as was expected.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 3. Binding of gp350Ig and gp25Ig to B and epithelial cell lines. The various cell lines indicated on the left were tested for binding of CTLA4Ig, gp350Ig or gp25Ig by indirect immunostaining as described in Methods. Dotted lines indicate histograms of cells stained with secondary biotinylated anti-human IgG and R-phycoerythrin-conjugated streptavidin alone in the absence of fusion protein.

 
Blocking EBV infection of epithelial cells using gp350Ig fusion protein
Next, we examined the role of gp350 in EBV infection of epithelial cells by using gp350Ig fusion protein. Four epithelial cell lines susceptible to EBV infection were incubated with gp350Ig or control fusion protein before infection with EBV. Then the cells were incubated with virus solution containing EGFP-EBV for 2 h, washed, and returned to culture. Infected cells were detected as EGFP-positive cells by FACS analysis 3 days after infection. As shown in Fig. 4(A)Down, EBV infection of 293 cells, NU-GC-3 cells and Lovo cells was blocked by pretreatment with gp350Ig. Pretreatment with irrelevant CTLA4Ig did not block the infection. Furthermore, pretreatment with gp350{Delta}30Ig, which lacked the CD21-binding region of gp350 (Fig. 2AUp), had no blocking effect, indicating that the CD21-binding region was critical for this blocking of infection by gp350Ig. Among the four epithelial cell lines examined, one cell line, AGS, gave a different result. EBV infection of AGS cells was not blocked at all by treatment with gp350Ig (Fig. 4ADown). Although gp350Ig blocked EBV infection of Lovo cells in a dose-dependent manner, it could not block EBV infection of AGS cells at any dose tested (Fig. 4BDown). Fluorescence micrographs of Lovo cells and AGS cells are shown in Fig. 4(C)Down. The frequency of EGFP-positive cells after infection of Lovo cells pretreated with gp350Ig was significantly lower than that for Lovo cells pretreated with Cont.Ig. In contrast, there was no distinct difference in the frequency of EGFP-positive cells between AGS pretreated with gp350Ig and AGS pretreated with Cont.Ig. These results indicated that EBV infected epithelial cells via two different mechanisms, namely a gp350-dependent mechanism and a gp350-independent mechanism.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 4. Effect of gp350Ig on EBV infection of epithelial cells. (A) Epithelial cell lines were pretreated with 50 µg/ml of CTLA4Ig (Cont.Ig), gp350Ig or gp350{Delta}30Ig, infected with EGFP-EBV for 2 h, and washed and returned to culture. After 3 days, the percentage of EGFP-positive cells was determined by FACS analysis. A total of 50000 cells was analysed. The bars show the means±SE of triplicate cultures. The data are representative of three independent experiments with similar results. (B) Gp350Ig dose-dependent blocking of EBV infection of Lovo cells but not AGS cells. Lovo cells and AGS cells were pretreated with various concentrations of Cont.Ig or gp350Ig, followed by infection with EGFP-EBV. The percentage of EGFP-positive cells was determined by FACS analysis and is expressed as a percentage of the control value obtained with virus alone. The plots show the means±SE of triplicate cultures. (C) EGFP expression of EGFP-EBV infected Lovo cells and AGS cells pretreated with Cont.Ig or gp350Ig. Lovo cells pretreated with Cont.Ig or gp350Ig, AGS cells pretreated with Cont.Ig or gp350Ig were infected with EGFP-EBV. Cells were trypsinized and washed 3 days after infection and directly observed using a fluorescence microscope as shown in the upper panels. The lower panels show the corresponding cells via phase-contrast light microscopy (magnification x200).

 
The region from amino acids 71 to 100 of gp25 is important for binding to epithelial cells
Preferential binding of gp25Ig to epithelial cells rather than B cells raises the possibility that gp25 plays a role in the infection of epithelial cells by EBV. As shown in Fig. 5(A)Down, gp25 could bind to epithelial cells detached from their culture vessels with PBS containing EDTA, but it could not bind to epithelial cells detached by trypsinization, indicating that gp25 binds to trypsin-sensitive proteins on the surface of the epithelial cell. To determine the region of gp25 required for binding to epithelial cells, a series of deletion mutants was made. The mutant constructs were also expressed as Ig fusion proteins, and the supernatant from transfected COS-7 cells was used as a source of mutant protein. Fig. 5(B)Down shows Western blot analysis of deletion mutants derived from the same amounts of supernatants. Supernatants adjusted to contain similar amounts of fusion proteins were tested for binding of these proteins to epithelial cells. As shown in Fig. 5(C)Down, N-terminal and C-terminal deletion mutant gp25(51–100)Ig, which contained amino acids 51–100 of gp25, bound to epithelial cells at a level equivalent to that of untruncated gp25Ig. Gp25(71–100)Ig, which had a bigger N-terminal deletion, could also bind to epithelial cells, but gp25(51–70)Ig and gp25(23–70)Ig showed little or no binding. These results indicated that the critical region required for binding to epithelial cells was amino acids 71 to 100 of gp25.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5. (A) Binding of gp25Ig to trypsin-treated and -untreated epithelial cells. NU-GC-3 cells were detached from the culture vessel with PBS containing 2 mM EDTA (trypsin treatment of cells: -), or PBS containing 2 mM EDTA and 0·25% trypsin (trypsin treatment of cells: +), and washed three times with PBS containing 10% FBS. Binding of gp25Ig to these cells was examined by indirect immunostaining. (B) Western blot analysis of gp25Ig deletion mutants. COS-7 cells were transfected with gp25Ig deletion mutant expression plasmids, and the same amounts of cell supernatants were precipitated with protein A–Sepharose. Samples were subjected to SDS–PAGE under reducing conditions, and proteins were detected by Western blot analysis using horseradish peroxidase-conjugated sheep anti-human immunoglobulin. (C) Binding of gp25Ig deletion mutants to epithelial cells. Supernatants from transfected COS-7 cells were adjusted to contain similar amounts of fusion protein, and their binding to NU-GC-3 cells was examined by indirect immunostaining.

 
Blocking EBV infection using soluble gp25Ig fusion protein
Finally, we examined whether gp25Ig could block EBV infection of epithelial cells. As shown in Fig. 6(A)Down and Table 2Down, EBV infection of AGS cells and Lovo cells was substantially inhibited by pretreatment with gp25(71–100)Ig, but not by gp25(51–70)Ig, which had no binding activity. But infection of NU-GC-3 cells was not inhibited by gp25(71–100)Ig, nor was infection of B cell line BJAB inhibited. Fig. 6(B)Down shows that pretreatment with gp25(71–100)Ig inhibited EBV infection of Lovo cells in a dose-dependent manner, but did not inhibit infection of BJAB cells at any dose tested. Fluorescence micrographs of Lovo cells and AGS cells are shown in Fig. 6(C)Down. These results indicated that gp25(71–100)Ig, which could bind to epithelial cells, also had the ability to inhibit EBV infection of some epithelial cells.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6. (A) Effect of gp25Ig on EBV infection of epithelial cells. Various cell lines were pretreated with 100 µg/ml of CTLA4Ig (Cont.Ig), gp25(71–100)Ig or 25(51–70)Ig, infected with EGFP-EBV for 2 h, washed and returned to culture. After 3 days, the percentage of EGFP-positive cells was determined by FACS analysis. A total of 50000 cells was analysed. The bars show the means±SE of triplicate cultures. The data are representative of three independent experiments with similar results. (B) Gp25(71–100)Ig dose-dependent blocking of EBV infection of Lovo cells but not BJAB cells. BJAB cells and Lovo cells were pretreated with various concentrations of Cont.Ig or gp25(71–100)Ig, followed by infection with EGFP-EBV. The percentage of EGFP-positive cells was determined by FACS analysis and is expressed as a percentage of the control value obtained with virus alone. The plots show the means±SE of triplicate cultures. (C) EGFP expression of EGFP-EBV-infected Lovo cells and AGS cells pretreated with Cont.Ig or gp25Ig. Lovo cells pretreated with Cont.Ig or gp25Ig and AGS cells pretreated with Cont.Ig or gp25Ig were infected with EGFP-EBV. Cells were trypsinized and washed 3 days after infection and observed directly using a fluorescence microscope (upper panels). The lower panels show the corresponding cells via phase-contrast light microscopy (magnificationx200).

 

View this table:
[in this window]
[in a new window]
 
Table 2. Effect of gp25Ig on EBV infection of epithelial cells

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Studies of EBV infection of epithelial cells have been limited by its low efficiency of infection and by the lack of rapid monitoring systems. For the purpose of rapid monitoring of EBV entry into cells, we generated a recombinant EBV expressing EGFP under control of the SV40 early promoter (EGFP-EBV). Some epithelial cell lines were clearly shown to be EGFP-EBV infectable by the appearance of EGFP-positive cells, and the percentages of EGFP-positive cells in these infectable epithelial cell lines ranged from 1 to 7% as determined by FACS analysis. This virus enabled us to monitor EBV infection of epithelial cells rapidly and quantitatively.

Using this virus as a reporter, we examined the role of gp350 in EBV infection of epithelial cells utilizing a soluble gp350Ig fusion protein. Although the binding of gp350Ig to epithelial cell lines was marginal in our detection system, EBV infection was almost completely inhibited by treatment of cells with gp350Ig fusion protein in three of the four EBV-infectable epithelial cell lines examined, i.e. 293, NU-GC-3 and Lovo. But in one cell line, AGS, no inhibition was observed after gp350Ig pretreatment. This result clearly showed that EBV infection of 293, NU-GC-3 and Lovo cells was gp350-dependent, and infection of AGS cells was gp350-independent. This is consistent with previous reports (Yoshiyama et al., 1997Down ; Imai et al., 1998Down ; Fingeroth et al., 1999Down ; Janz et al., 2000Down ).

We also found that another soluble fusion protein, gp25Ig, preferentially bound to epithelial cell lines rather than B cell lines. We identified amino acids 71 to 100 of gp25 as the critical region for binding to epithelial cells. Our finding of gp25Ig binding to epithelial cells presents the possibility that gp25 directly participates in attachment of virions to epithelial cells. Previously, it has been shown that the gp85–gp25 complex mediates the infection of epithelial cells (Li et al., 1995Down ; Wang & Hutt-Fletcher, 1998Down ; Wang et al., 1998Down ). Molesworth et al. (2000)Down and our group (Oda et al., 2000Down ) recently showed that a recombinant EBV lacking gp85 had impaired attachment to CD21-negative epithelial cells, and they further showed that monoclonal antibodies to gp85 blocked the attachment of virions to epithelial cells, suggesting that gp85 rather than gp25 is important for this attachment. However, EBV lacking gp85 also failed to express detectable amounts of gp25 due to its rapid turnover (Molesworth et al., 2000Down ). It is also possible that monoclonal antibodies to gp85 might indirectly interfere with the interaction between gp25 in the complex and epithelial cells, as these antibodies can also bind to the gp85–gp25 complex. Thus, these previous observations cannot exclude the possibility that gp25 in the complex directly participates in attachment of virions to epithelial cells.

Finally, we examined the ability of gp25Ig to inhibit EBV infection of epithelial cells. We observed that infection of AGS cells and Lovo cells was substantially inhibited by pretreatment of cells with gp25(71–100)Ig, but infection of NU-GC-3 cells was not inhibited. This inhibition was considered to be specific because other control fusion proteins showed no inhibition. These results suggested that gp25 played a role in the infection of at least some epithelial cell lines. But the inhibition by gp25Ig pretreatment seemed to be inefficient even in effective cell lines. One possible explanation for this is that the binding affinity between gp25Ig and epithelial cells may be low compared to that between the gp25 complex on virions and epithelial cells, making the inhibition by gp25Ig inefficient.

Whether gp25 on virions actually contributes to their attachment to epithelial cells cannot be concluded from this study, and needs to be elucidated by further work.


   Acknowledgments
 
We thank Yoshiko Oshima for technical assistance. This work was supported by grants-in-aid from the Ministry of Education, Science, Sports and Culture, Japan.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Akiyama, S., Amo, H., Watanabe, T., Matsuyama, M., Sakamoto, J., Imaizumi, M., Ichihashi, H., Kondo, T. & Takagi, H. (1988). Characteristics of three human gastric cancer cell lines, NU-GC-2, NU-GC-3 and NU-GC-4. Japanese Journal of Surgery 18, 438-446.

Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein–Barr virus genome. Nature 310, 207-211.[Medline]

Barranco, S. C., Townsend, C. M.Jr, Casartelli, C., Macik, B. G., Burger, N. L., Boerwinkle, W. R. & Gourley, W. K. (1983). Establishment and characterization of an in vitro model system for human adenocarcinoma of the stomach. Cancer Research 43, 1703-1709.[Abstract/Free Full Text]

Drewinko, B., Romsdahl, M. M., Yang, L. Y., Ahearn, M. J. & Trujillo, J. M. (1976). Establishment of a human carcinoembryonic antigen-producing colon adenocarcinoma cell line. Cancer Research 36, 467-475.[Abstract/Free Full Text]

Fingeroth, J. D., Weis, J. J., Tedder, T. F., Strominger, J. L., Biro, P. A. & Fearon, D. T. (1984). Epstein–Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proceedings of the National Academy of Sciences, USA 81, 4510-4514.[Abstract/Free Full Text]

Fingeroth, J. D., Diamond, M. E., Sage, D. R., Hayman, J. & Yates, J. L. (1999). CD21-dependent infection of an epithelial cell line, 293, by Epstein–Barr virus. Journal of Virology 73, 2115-2125.[Abstract/Free Full Text]

Frade, R., Barel, M., Ehlin-Henriksson, B. & Klein, G. (1985). gp140, the C3d receptor of human B lymphocytes, is also the Epstein–Barr virus receptor. Proceedings of the National Academy of Sciences, USA 82, 1490-1493.[Abstract/Free Full Text]

Fukayama, M., Hayashi, Y., Iwasaki, Y., Chong, J., Ooba, T., Takizawa, T., Koike, M., Mizutani, S., Miyaki, M. & Hirai, K. (1994). Epstein–Barr virus-associated gastric carcinoma and Epstein–Barr virus infection of the stomach. Laboratory Investigation 71, 73-81.[Medline]

Gluzman, Y. (1981). SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23, 175-182.[Medline]

Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology 36, 59-74.[Abstract/Free Full Text]

Greenspan, J. S., Greenspan, D., Lennette, E. T., Abrams, D. I., Conant, M. A., Petersen, V. & Freese, U. K. (1985). Replication of Epstein–Barr virus within the epithelial cells of oral ‘hairy’ leukoplakia, an AIDS-associated lesion. New England Journal of Medicine 313, 1564-1571.[Abstract]

Haan, K. M., Kwok, W. W., Longnecker, R. & Speck, P. (2000). Epstein–Barr virus entry utilizing HLA-DP or HLA-DQ as a coreceptor. Journal of Virology 74, 2451-2454.[Abstract/Free Full Text]

Haddad, R. S. & Hutt-Fletcher, L. M. (1989). Depletion of glycoprotein gp85 from virosomes made with Epstein–Barr virus proteins abolishes their ability to fuse with virus receptor-bearing cells. Journal of Virology 63, 4998-5005.[Abstract/Free Full Text]

Imai, S., Koizumi, S., Sugiura, M., Tokunaga, M., Uemura, Y., Yamamoto, N., Tanaka, S., Sato, E. & Osato, T. (1994). Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein–Barr virus latent infection protein. Proceedings of the National Academy of Sciences, USA 91, 9131-9135.[Abstract/Free Full Text]

Imai, S., Nishikawa, J. & Takada, K. (1998). Cell-to-cell contact as an efficient mode of Epstein–Barr virus infection of diverse human epithelial cells. Journal of Virology 72, 4371-4378.[Abstract/Free Full Text]

Janz, A., Oezel, M., Kurzeder, C., Mautner, J., Pich, D., Kost, M., Hammerschmidt, W. & Delecluse, H.-J. (2000). Infection of Epstein–Barr virus lacking major glycoprotein BLLF1 (gp350/220) demonstrates the existence of additional viral ligands. Journal of Virology 74, 10142-10152.[Abstract/Free Full Text]

Kieff, E. (1996). Epstein–Barr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Li, Q., Turk, S. M. & Hutt-Fletcher, L. M. (1995). The Epstein–Barr virus (EBV) BZLF2 gene product associates with the gH and gL homologs of EBV and carries an epitope critical to infection of B cells but not of epithelial cells. Journal of Virology 69, 3987-3994.[Abstract]

Li, Q., Spriggs, M. K., Kovats, S., Turk, S. M., Comeau, M. R., Nepom, B. & Hutt-Fletcher, L. M. (1997). Epstein–Barr virus uses HLA class II as a cofactor for infection of B lymphocytes. Journal of Virology 71, 4657-4662.[Abstract]

Linsley, P. S., Brady, W., Grosmaire, L., Aruffo, A., Damle, N. K. & Ledbetter, J. A. (1991a). Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation. Journal of Experimental Medicine 173, 721-730.[Abstract/Free Full Text]

Linsley, P. S., Brady, W., Urnes, M., Grosmaire, L. S., Damle, N. K. & Ledbetter, J. A. (1991b). CTLA-4 is a second receptor for the B cell activation antigen B7. Journal of Experimental Medicine 174, 561-569.[Abstract/Free Full Text]

Miller, N. & Hutt-Fletcher, L. M. (1988). A monoclonal antibody to glycoprotein gp85 inhibits fusion but not attachment of Epstein–Barr virus. Journal of Virology 62, 2366-2372.[Abstract/Free Full Text]

Molesworth, S. J., Lake, C. M., Borza, C. M., Turk, S. M. & Hutt-Fletcher, L. M. (2000). Epstein–Barr virus gH is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. Journal of Virology 74, 6324-6332.[Abstract/Free Full Text]

Nemerow, G. R., Mold, C., Schwend, V. K., Tollefson, V. & Cooper, N. R. (1987). Identification of gp350 as the viral glycoprotein mediating attachment of Epstein–Barr virus (EBV) to the EBV/C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment C3d. Journal of Virology 61, 1416-1420.[Abstract/Free Full Text]

Nemerow, G. R., Houghten, R. A., Moore, M. D. & Cooper, N. R. (1989). Identification of an epitope in the major envelope protein of Epstein–Barr virus that mediates viral binding to the B lymphocyte EBV receptor (CR2). Cell 56, 369-377.[Medline]

Nishikawa, J., Imai, S., Oda, T., Kojima, T., Okita, K. & Takada, K. (1999). Epstein–Barr virus promotes epithelial cell growth in the absence of EBNA2 and LMP1 expression. Journal of Virology 73, 1286-1292.[Abstract/Free Full Text]

Oda, T., Imai, S., Chiba, S. & Takada, K. (2000). Epstein–Barr virus lacking glycoprotein gp85 cannot infect B cells and epithelial cells. Virology 276, 52-58.[Medline]

Parker, B. D., Bankier, A. T., Satchwell, S. C., Barrell, B. G. & Farrell, P. J. (1990). Sequence and transcription of Raji Epstein–Barr virus DNA spanning the B95-8 deletion region. Virology 179, 339-346.[Medline]

Pulvertaft, R. J. V. (1964). Cytology of Burkitt’s tumor (African lymphoma). Lancet i, 238-240.

Rickinson, A. B. & Kieff, E. (1996). Epstein–Barr virus. In Fields Virology , pp. 2397-2446. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Shibata, D. & Weiss, L. M. (1992). Epstein–Barr virus-associated gastric adenocarcinoma. American Journal of Pathology 140, 769-774.[Abstract]

Shimizu, N., Tanabe-Tochikura, A., Kuroiwa, Y. & Takada, K. (1994). Isolation of Epstein–Barr virus (EBV)-negative cell clones from the EBV-positive Burkitt’s lymphoma (BL) line Akata: malignant phenotypes of BL cells are dependent on EBV. Journal of Virology 68, 6069-6073.[Abstract/Free Full Text]

Shimizu, N., Yoshiyama, H. & Takada, K. (1996). Clonal propagation of Epstein–Barr virus (EBV) recombinants in EBV-negative Akata cells. Journal of Virology 70, 7260-7263.[Abstract/Free Full Text]

Spriggs, M. K., Armitage, R. J., Comeau, M. R., Strockbine, L., Farrah, T., Macduff, B., Ulrich, D., Alderson, M. R., Müllberg, J. & Cohen, J. I. (1996). The extracellular domain of the Epstein-Barr virus BZLF2 protein binds the HLA- DR {beta} chain and inhibits antigen presentation. Journal of Virology 70, 5557-5563.[Abstract/Free Full Text]

Takada, K. (1984). Cross-linking of cell surface immunoglobulins induces Epstein–Barr virus in Burkitt lymphoma lines. International Journal of Cancer 33, 27-32.

Takada, K. & Ono, Y. (1989). Synchronous and sequential activation of latently infected Epstein–Barr virus genomes. Journal of Virology 63, 445-449.[Abstract/Free Full Text]

Takada, K., Horinouchi, K., Ono, Y., Aya, T., Osato, T., Takahashi, M. & Hayasaka, S. (1991). An Epstein–Barr virus-producer line Akata: establishment of the cell line and analysis of viral DNA. Virus Genes 5, 147-156.[Medline]

Wang, X. & Hutt-Fletcher, L. M. (1998). Epstein–Barr virus lacking glycoprotein gp42 can bind to B cells but is not able to infect. Journal of Virology 72, 158-163.[Abstract/Free Full Text]

Wang, X., Kenyon, W. J., Li, Q., Müllberg, J. & Hutt-Fletcher, L. M. (1998). Epstein–Barr virus uses different complexes of glycoproteins gH and gL to infect B lymphocytes and epithelial cells. Journal of Virology 72, 5552-5558.[Abstract/Free Full Text]

Yamada, A., Murakami, M., Ijima, K., Yagita, H., Okumura, K., Komatsu, S. & Uede, T. (1996). Long-term acceptance of major histocompatibility complex-mismatched cardiac allograft induced by a low dose of CTLA4IgM plus FK506. Microbiology and Immunology 40, 513-518.[Medline]

Yoshiyama, H., Shimizu, N. & Takada, K. (1995). Persistent Epstein–Barr virus infection in a human T-cell line: unique program of latent virus expression. EMBO Journal 14, 3706-3711.[Medline]

Yoshiyama, H., Imai, S., Shimizu, N. & Takada, K. (1997). Epstein–Barr virus infection of human gastric carcinoma cells: implication of the existence of a new virus receptor different from CD21. Journal of Virology 71, 5688-5691.[Abstract]

Young, L. S., Lau, R., Rowe, M., Niedobitek, G., Packham, G., Shanahan, F., Rowe, D. T., Greenspan, D., Greenspan, J. S., Rickinson, A. B. & Farrell, P. J. (1991). Differentiation-associated expression of the Epstein–Barr virus BZLF1 transactivator protein in oral hairy leukoplakia. Journal of Virology 65, 2868-2874.[Abstract/Free Full Text]

Received 3 April 2001; accepted 1 July 2001.


This article has been cited by other articles:


Home page
Cancer Res.Home page
E. Seto, T. Ooka, J. Middeldorp, and K. Takada
Reconstitution of Nasopharyngeal Carcinoma-Type EBV Infection Induces Tumorigenicity
Cancer Res., February 15, 2008; 68(4): 1030 - 1036.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. Wu and L. M. Hutt-Fletcher
Compatibility of the gH homologues of Epstein-Barr virus and related lymphocryptoviruses
J. Gen. Virol., August 1, 2007; 88(8): 2129 - 2136.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Boccellato, E. Anastasiadou, P. Rosato, B. Kempkes, L. Frati, A. Faggioni, and P. Trivedi
EBNA2 Interferes with the Germinal Center Phenotype by Downregulating BCL6 and TCL1 in Non-Hodgkin's Lymphoma Cells
J. Virol., March 1, 2007; 81(5): 2274 - 2282.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Wen, D. Iwakiri, K. Yamamoto, S. Maruo, T. Kanda, and K. Takada
Epstein-Barr Virus BZLF1 Gene, a Switch from Latency to Lytic Infection, Is Expressed as an Immediate-Early Gene after Primary Infection of B Lymphocytes
J. Virol., January 15, 2007; 81(2): 1037 - 1042.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Urquiza, R. Lopez, H. Patino, J. E. Rosas, and M. E. Patarroyo
Identification of Three gp350/220 Regions Involved in Epstein-Barr Virus Invasion of Host Cells
J. Biol. Chem., October 21, 2005; 280(42): 35598 - 35605.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Ahsan, T. Kanda, K. Nagashima, and K. Takada
Epstein-Barr Virus Transforming Protein LMP1 Plays a Critical Role in Virus Production
J. Virol., April 1, 2005; 79(7): 4415 - 4424.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. P. McShane and R. Longnecker
Cell-surface expression of a mutated Epstein-Barr virus glycoprotein B allows fusion independent of other viral proteins
PNAS, December 14, 2004; 101(50): 17474 - 17479.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Kanda, M. Yajima, N. Ahsan, M. Tanaka, and K. Takada
Production of High-Titer Epstein-Barr Virus Recombinants Derived from Akata Cells by Using a Bacterial Artificial Chromosome System
J. Virol., July 1, 2004; 78(13): 7004 - 7015.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. D. de Lima, J. S. May, and P. G. Stevenson
Murine Gammaherpesvirus 68 Lacking gp150 Shows Defective Virion Release but Establishes Normal Latency In Vivo
J. Virol., May 15, 2004; 78(10): 5103 - 5112.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Isobe, K. Sugimoto, L. Yang, K. Tamayose, M. Egashira, T. Kaneko, K. Takada, and K. Oshimi
Epstein-Barr Virus Infection of Human Natural Killer Cell Lines and Peripheral Blood Natural Killer Cells
Cancer Res., March 15, 2004; 64(6): 2167 - 2174.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruo, S.
Right arrow Articles by Takada, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruo, S.
Right arrow Articles by Takada, K.
Agricola
Right arrow Articles by Maruo, S.
Right arrow Articles by Takada, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS