|
|
||||||||
Animal: DNA Viruses |
Department of Tumor Virology, Institute for Genetic Medicine, Hokkaido University, Sapporo 060-8638, Japan1
Author for correspondence: Kenzo Takada. Fax +81 11 717 1128. e-mail kentaka{at}med.hokudai.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Studies on EBV infection of epithelial cells have been limited by the lack of infection systems in vitro. To overcome this problem, we previously generated an EBV recombinant with a selectable marker, which made it possible to select EBV-infected cells, even when the efficiency of infection was low (Yoshiyama et al., 1995
; Shimizu et al., 1996
; Nishikawa et al., 1999
). In our previous studies using this virus, many human epithelial cell lines could be infected by EBV, and infection was not inhibited by pretreatment of cells with anti-CD21 monoclonal antibody, suggesting that infection was mediated by a receptor other than CD21 (Yoshiyama et al., 1997
; Imai et al., 1998
). Janz et al. (2000)
generated an EBV recombinant lacking the gp350 gene and demonstrated that a human embryonic kidney cell line, 293, could be infected with this gp350-deleted EBV. On the other hand, Fingeroth et al. (1999)
reported that 293 cells express a low level of CD21 and are susceptible to EBV infection, with infection being blocked with antibodies specific for CD21. Therefore, whether gp350CD21 interaction is required for infection of epithelial cells is still controversial.
In contrast to the finding that the gp85gp25gp42 complex is required for efficient infection of B cells, it has been suggested that the gp85gp25 complex is involved in the infection of epithelial cells. Gp85 and gp25 are the EBV homologues of herpes simplex virus gH and gL, respectively, and the complex as a whole has been reported to be important for the ability of the virus to penetrate cells (Miller & Hutt-Fletcher, 1988
; Haddad & Hutt-Fletcher, 1989
). L. M. Hutt-Fletcher and colleagues showed that two complexes, the gp85gp25gp42 complex and the gp85gp25 complex, exist in EBV virions, and that a monoclonal antibody that reacts with the gp85gp25 complex but not the gp85gp25gp42 complex neutralized infection of epithelial cells but not B cells (Li et al., 1995
; Wang et al., 1998
). Conversely, a recombinant EBV lacking gp42 that expressed the gp85gp25 complex but not the gp85gp25gp42 complex could infect epithelial cells but not B cells (Wang & Hutt-Fletcher, 1998
). Furthermore, they and our group recently showed that attachment of a recombinant EBV lacking gp85 to CD21-negative epithelial cells was impaired (Molesworth et al., 2000
; Oda et al., 2000
). These findings indicate the critical role of the gp85gp25 complex in the infection of epithelial cells, and further suggest the existence of a receptor for this complex on epithelial cells. But whether gp25 in this complex has an active role in this type of infection is not yet known.
In this study, we generated a recombinant EBV that expressed enhanced green fluorescent protein (EGFP) for brief monitoring of infection. Using this monitoring system, we examined the roles of gp350 and gp25 in EBV infection of epithelial cells by utilizing soluble forms of gp350 and gp25 proteins. Here we demonstrate that there are two distinct pathways in the infection of epithelial cells, i.e. a gp350-dependent pathway and a gp350-independent pathway. We also show that a soluble form of gp25 protein can bind to epithelial cells, and that EBV infection of some epithelial cells is inhibited by pretreatment of cells with soluble gp25, suggesting an active role for gp25 in the infection of epithelial cells.
| Methods |
|---|
|
|
|---|
Cells.
Virus production.
EBV was obtained from the culture medium of Akata cells in which EBV production had been induced by surface immunoglobulin G (sIgG) cross-linking (Takada & Ono, 1989
). Briefly, rabbit anti-human IgG (Dako) was added to a cell suspension (5x106/ml) to give a final concentration of 0·5% (v/v). The cells were then incubated for 3 h at 37 °C, washed three times, and resuspended (2x106/ml) in RPMI 1640 medium containing 10% FBS. After 3 days incubation, the culture was clarified by centrifugation (1200 g) for 15 min at 4 °C. The supernatant was filtered through a 0·45 µm pore-size membrane and stored at -84 °C until use.
Generation of a recombinant EBV expressing enhanced green fluorescent protein (EGFP).
The 6 kbp Akata EBV HindIII F fragment, corresponding to bp 140893 to 146916 of the B95-8 sequence (Baer et al., 1984
), was cloned into pUC119 (Takara). The EGFP gene derived from pEGFP-C1 (Clontech) was cloned into pSG5 (Stratagene). The resulting plasmid was named pSG5-EGFP. A 2051 bp SalI fragment containing the SV40 early promoter-driven EGFP cassette was excised from pSG5-EGFP, and a 2310 bp EcoRVSalI fragment containing the neomycin resistance cassette was excised from pcDNA3 (Invitrogen). These fragments were inserted into a SmaI site at bp 143576 of the Akata EBV HindIII F fragment (see Fig. 1
). This insertion disrupted the BXLF1 ORF, encoding the EBV thymidine kinase, which is nonessential for infection and replication (Shimizu et al., 1996
). The HindIII F fragment, now 10·4 kbp as a result of the insertions, was excised from pUC119 and introduced into Akata cells by an electroporation method as described previously (Yoshiyama et al., 1995
). Cells were then plated at 104 cells per well in 96-well tissue culture plates in medium containing 700 µg/ml of G418 (Gibco) and fed weekly with fresh drug-containing medium. Resistant clones began to emerge after approximately 3 weeks. Drug-resistant Akata cells were screened by Southern blotting for the presence of homologous recombination with viral DNA. To eliminate wild-type episomes in cells that screened positive for homologous recombination, the virus from drug-resistant cell clones was infected at a low multiplicity into EBV-negative Akata cells, which were reselected with G418 as described previously (Shimizu et al., 1996
).
|
Southern blot analysis.
EBV infection.
Epithelial cells were plated in 24-well tissue culture plates grown to 80 to 90% confluence. Then, 120 µl of virus solution was added to the cells for 2 h at 37 °C. The virus solution was then removed, and the cells were rinsed three times with medium and returned to culture. The next day, the cells were trypsinized and replated into 6-well tissue culture plates. At 3 days after infection, EGFP expression was evaluated by fluorescence microscopy and FACS analysis.
Construction of gp350Ig, gp25Ig and their deletion mutants.
A fusion gene encoding the Fc portion of human IgG1 (hIgG1 Fc) fused to the extracellular domain of murine CTLA4, designated CTLA4Ig, was kindly supplied by Masaaki Murakami, Hokkaido University, Sapporo, Japan (Yamada et al., 1996
). The CTLA4Ig fusion gene was subcloned into pSG5. The resulting plasmid (pSG5-CTLA4Ig) contained a unique XhoI site upstream of the CTLA4 gene, and a unique BamHI site at the junction between the CTLA4 and the hIgG1 Fc gene. The extracellular domain of gp350 protein from amino acids 1 to 810 was fused to the signal peptide of murine interleukin-6 (IL-6) by two PCR steps using overlapping oligonucleotides. For the first step, the oligonucleotide CATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGGCCTTCCCTATGGAGGCAGCCTTGCTTGT was used as the forward primer, and CTGCAGTGGATCCATGGAGAGGTTTGAGAA as the reverse primer. The template for this step was Akata EBV genomic DNA. For the second step, a portion of the PCR product from the first step was reamplified using an overlapping forward primer, corresponding to the amino-terminal portion of the murine IL-6 signal sequence and containing a SalI site, CTAGCCACTGGTCGACCACCAATGAAGT TCCTCTCTGCAAGAGACT TCCATCCAGT TGCCTTCTTGGGACTG, and the same reverse primer. The product of the PCR reaction was cleaved with restriction endonucleases (SalI and BamHI) at sites introduced in the PCR primers and gel purified. The purified fragment was ligated to the XhoI/BamHI-cleaved pSG5-CTLA4 fragment, which contained the pSG5 backbone and the hIgG1 Fc gene. The ligation product was transformed into E. coli DH5
cells and colonies were screened for the appropriate plasmid. The sequence of the resulting plasmid (pSG5-gp350Ig) was confirmed by DNA sequencing. The region from amino acids 23 to 137 of the gp25 protein was fused to the signal peptide of murine IL-6 in a manner identical to that described above with the exception of the PCR primers to be used. For the first step, the oligonucleotide CATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGGCCTTCCCTAATTGGGCATACCCATGTTG was used as the forward primer, and CCAGAGGGATCCCCCCCGCGATGCCATGCGTA as the reverse primer. For the second step, the oligonucleotide CTAGCCACTGGTCGACCACCAATGAAGTTCCTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTG was used as the forward primer, and the same reverse primer was used. The PCR product was restriction endonuclease-digested and ligated with the pSG5 vector containing the hIgG1 Fc gene as described for pSG5-gp350Ig construction. The resulting construct (pSG5-gp25Ig) was sequenced to ensure that no coding mutations were present. The deletion mutant gp350
30, corresponding to amino acids 31 to 810 of the gp350 sequence, and the deletion mutants gp25(51137), gp25(51100), gp25(5170), gp25(71100) and gp25(2370), corresponding to amino acids 51 to 137, 51 to 100, 51 to 70, 71 to 100 and 23 to 70 of the gp25 sequence, respectively, were generated by two steps of PCR as described above with specific oligonucleotide primers. Forward primers were designed to contain the signal sequence of murine IL-6. PCR products were digested with appropriate restriction enzymes and ligated with the pSG5 vector containing the hIgG1 Fc gene. All deletion mutants were sequenced after cloning.
Production of Ig fusion proteins.
COS-7 cells were transfected with expression plasmids using LipofectAmine Plus (Gibco). At 24 h after transfection, culture medium was removed and replaced with serum-free DMEM. Incubation was continued for 6 days at 37 °C, at which time the spent medium was collected. After removal of cellular debris by low-speed centrifugation, the supernatant was filtered through a 0·2 µm pore-size membrane. The supernatants contained Ig fusion proteins at concentrations of 0·5 to 4 µg/ml. Protein concentrations were estimated by Coomassie blue staining of bands after SDSPAGE using BSA as a standard. Supernatants, which were adjusted to contain the similar amounts of fusion proteins and to which BSA was added to give a final concentration of 0·1% (w/v) for blocking of non-specific binding, were used for the binding experiments. For blocking experiments, Ig fusion proteins were purified using protein ASepharose adsorption and low-pH elution, followed by dialysis against medium (Linsley et al., 1991a
).
Antibodies.
Rabbit anti-human IgG, biotinylated rabbit anti-human IgG and R-phycoerythrin-conjugated streptavidin were purchased from Dako. Horseradish peroxidase-conjugated sheep anti-human Ig was purchased from Amersham.
Blocking infection with Ig fusion proteins and antibodies.
To block infection with Ig fusion proteins, 120 µl of purified Ig fusion proteins in medium was added to epithelial cells grown in 24-well tissue culture plates, and incubated for 1 h at 37 °C; 30 µl of 5% rabbit anti-human IgG (cross-linking antibody) was added and incubated for 1 h at 37 °C, and 50 µl of virus solution was added and incubated for 2 h at 37 °C. The medium with the virus was then removed, and the cells were rinsed three times with medium and returned to culture. At day 3, cells were harvested and analysed for EGFP expression.
Immunostaining and FACS analysis.
Binding of Ig fusion proteins to B and epithelial cell lines was detected by indirect immunostaining. Before staining, adherent cells were removed from their culture vessels by incubation in PBS containing 2 mM EDTA. Cells were first incubated with supernatants containing Ig fusion proteins for 1 h at 4 °C. They were then washed, and incubated with biotinylated rabbit anti-human IgG (Dako) for 30 min at 4 °C. After washing, cells were allowed to react with R-phycoerythrin-conjugated streptavidin (Dako) for 30 min at 4 °C. Stained cells were analysed with a FACSCalibur (Becton Dickinson). For detection of cells infected with EGFP-EBV, cells were harvested 3 days after infection, and a total of 50000 cells was analysed for EGFP fluorescence with a FACSCalibur.
| Results |
|---|
|
|
|---|
Various human cell lines were incubated with the virus solution containing EGFP-EBV, and 3 days later infected cells were evident as EGFP-positive cells by fluorescence microscopy and FACS analysis (Fig. 1C
). Infectivities of various human cell lines were examined by FACS analysis, and are listed in Table 1
. Approximately 40 to 60% of Raji cells and 20 to 30% of BJAB cells were positive for EGFP fluorescence after infection with EGFP-EBV. Epithelial cell lines Lovo, NU-GC-3, 293 and AGS could also be successfully infected with EGFP-EBV, but the percentages of EGFP-positive cells in these cell lines were lower than with Raji and BJAB cells.
|
|
|
30Ig, which lacked the CD21-binding region of gp350 (Fig. 2A
|
|
|
|
| Discussion |
|---|
|
|
|---|
Using this virus as a reporter, we examined the role of gp350 in EBV infection of epithelial cells utilizing a soluble gp350Ig fusion protein. Although the binding of gp350Ig to epithelial cell lines was marginal in our detection system, EBV infection was almost completely inhibited by treatment of cells with gp350Ig fusion protein in three of the four EBV-infectable epithelial cell lines examined, i.e. 293, NU-GC-3 and Lovo. But in one cell line, AGS, no inhibition was observed after gp350Ig pretreatment. This result clearly showed that EBV infection of 293, NU-GC-3 and Lovo cells was gp350-dependent, and infection of AGS cells was gp350-independent. This is consistent with previous reports (Yoshiyama et al., 1997
; Imai et al., 1998
; Fingeroth et al., 1999
; Janz et al., 2000
).
We also found that another soluble fusion protein, gp25Ig, preferentially bound to epithelial cell lines rather than B cell lines. We identified amino acids 71 to 100 of gp25 as the critical region for binding to epithelial cells. Our finding of gp25Ig binding to epithelial cells presents the possibility that gp25 directly participates in attachment of virions to epithelial cells. Previously, it has been shown that the gp85gp25 complex mediates the infection of epithelial cells (Li et al., 1995
; Wang & Hutt-Fletcher, 1998
; Wang et al., 1998
). Molesworth et al. (2000)
and our group (Oda et al., 2000
) recently showed that a recombinant EBV lacking gp85 had impaired attachment to CD21-negative epithelial cells, and they further showed that monoclonal antibodies to gp85 blocked the attachment of virions to epithelial cells, suggesting that gp85 rather than gp25 is important for this attachment. However, EBV lacking gp85 also failed to express detectable amounts of gp25 due to its rapid turnover (Molesworth et al., 2000
). It is also possible that monoclonal antibodies to gp85 might indirectly interfere with the interaction between gp25 in the complex and epithelial cells, as these antibodies can also bind to the gp85gp25 complex. Thus, these previous observations cannot exclude the possibility that gp25 in the complex directly participates in attachment of virions to epithelial cells.
Finally, we examined the ability of gp25Ig to inhibit EBV infection of epithelial cells. We observed that infection of AGS cells and Lovo cells was substantially inhibited by pretreatment of cells with gp25(71100)Ig, but infection of NU-GC-3 cells was not inhibited. This inhibition was considered to be specific because other control fusion proteins showed no inhibition. These results suggested that gp25 played a role in the infection of at least some epithelial cell lines. But the inhibition by gp25Ig pretreatment seemed to be inefficient even in effective cell lines. One possible explanation for this is that the binding affinity between gp25Ig and epithelial cells may be low compared to that between the gp25 complex on virions and epithelial cells, making the inhibition by gp25Ig inefficient.
Whether gp25 on virions actually contributes to their attachment to epithelial cells cannot be concluded from this study, and needs to be elucidated by further work.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA sequence and expression of the B95-8 EpsteinBarr virus genome. Nature 310, 207-211.[Medline]
Barranco, S. C., Townsend, C. M.Jr, Casartelli, C., Macik, B. G., Burger, N. L., Boerwinkle, W. R. & Gourley, W. K. (1983). Establishment and characterization of an in vitro model system for human adenocarcinoma of the stomach. Cancer Research 43, 1703-1709.
Drewinko, B., Romsdahl, M. M., Yang, L. Y., Ahearn, M. J. & Trujillo, J. M. (1976). Establishment of a human carcinoembryonic antigen-producing colon adenocarcinoma cell line. Cancer Research 36, 467-475.[Medline]
Fingeroth, J. D., Weis, J. J., Tedder, T. F., Strominger, J. L., Biro, P. A. & Fearon, D. T. (1984). EpsteinBarr virus receptor of human B lymphocytes is the C3d receptor CR2. Proceedings of the National Academy of Sciences, USA 81, 4510-4514.
Fingeroth, J. D., Diamond, M. E., Sage, D. R., Hayman, J. & Yates, J. L. (1999). CD21-dependent infection of an epithelial cell line, 293, by EpsteinBarr virus. Journal of Virology 73, 2115-2125.
Frade, R., Barel, M., Ehlin-Henriksson, B. & Klein, G. (1985). gp140, the C3d receptor of human B lymphocytes, is also the EpsteinBarr virus receptor. Proceedings of the National Academy of Sciences, USA 82, 1490-1493.
Fukayama, M., Hayashi, Y., Iwasaki, Y., Chong, J., Ooba, T., Takizawa, T., Koike, M., Mizutani, S., Miyaki, M. & Hirai, K. (1994). EpsteinBarr virus-associated gastric carcinoma and EpsteinBarr virus infection of the stomach. Laboratory Investigation 71, 73-81.[Medline]
Gluzman, Y. (1981). SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23, 175-182.[Medline]
Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology 36, 59-74.
Greenspan, J. S., Greenspan, D., Lennette, E. T., Abrams, D. I., Conant, M. A., Petersen, V. & Freese, U. K. (1985). Replication of EpsteinBarr virus within the epithelial cells of oral hairy leukoplakia, an AIDS-associated lesion. New England Journal of Medicine 313, 1564-1571.[Abstract]
Haan, K. M., Kwok, W. W., Longnecker, R. & Speck, P. (2000). EpsteinBarr virus entry utilizing HLA-DP or HLA-DQ as a coreceptor. Journal of Virology 74, 2451-2454.
Haddad, R. S. & Hutt-Fletcher, L. M. (1989). Depletion of glycoprotein gp85 from virosomes made with EpsteinBarr virus proteins abolishes their ability to fuse with virus receptor-bearing cells. Journal of Virology 63, 4998-5005.
Imai, S., Koizumi, S., Sugiura, M., Tokunaga, M., Uemura, Y., Yamamoto, N., Tanaka, S., Sato, E. & Osato, T. (1994). Gastric carcinoma: monoclonal epithelial malignant cells expressing EpsteinBarr virus latent infection protein. Proceedings of the National Academy of Sciences, USA 91, 9131-9135.
Imai, S., Nishikawa, J. & Takada, K. (1998). Cell-to-cell contact as an efficient mode of EpsteinBarr virus infection of diverse human epithelial cells. Journal of Virology 72, 4371-4378.
Janz, A., Oezel, M., Kurzeder, C., Mautner, J., Pich, D., Kost, M., Hammerschmidt, W. & Delecluse, H.-J. (2000). Infection of EpsteinBarr virus lacking major glycoprotein BLLF1 (gp350/220) demonstrates the existence of additional viral ligands. Journal of Virology 74, 10142-10152.
Kieff, E. (1996). EpsteinBarr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Li, Q., Turk, S. M. & Hutt-Fletcher, L. M. (1995). The EpsteinBarr virus (EBV) BZLF2 gene product associates with the gH and gL homologs of EBV and carries an epitope critical to infection of B cells but not of epithelial cells. Journal of Virology 69, 3987-3994.[Abstract]
Li, Q., Spriggs, M. K., Kovats, S., Turk, S. M., Comeau, M. R., Nepom, B. & Hutt-Fletcher, L. M. (1997). EpsteinBarr virus uses HLA class II as a cofactor for infection of B lymphocytes. Journal of Virology 71, 4657-4662.[Abstract]
Linsley, P. S., Brady, W., Grosmaire, L., Aruffo, A., Damle, N. K. & Ledbetter, J. A. (1991a). Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation. Journal of Experimental Medicine 173, 721-730.
Linsley, P. S., Brady, W., Urnes, M., Grosmaire, L. S., Damle, N. K. & Ledbetter, J. A. (1991b). CTLA-4 is a second receptor for the B cell activation antigen B7. Journal of Experimental Medicine 174, 561-569.
Miller, N. & Hutt-Fletcher, L. M. (1988). A monoclonal antibody to glycoprotein gp85 inhibits fusion but not attachment of EpsteinBarr virus. Journal of Virology 62, 2366-2372.
Molesworth, S. J., Lake, C. M., Borza, C. M., Turk, S. M. & Hutt-Fletcher, L. M. (2000). EpsteinBarr virus gH is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. Journal of Virology 74, 6324-6332.
Nemerow, G. R., Mold, C., Schwend, V. K., Tollefson, V. & Cooper, N. R. (1987). Identification of gp350 as the viral glycoprotein mediating attachment of EpsteinBarr virus (EBV) to the EBV/C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment C3d. Journal of Virology 61, 1416-1420.
Nemerow, G. R., Houghten, R. A., Moore, M. D. & Cooper, N. R. (1989). Identification of an epitope in the major envelope protein of EpsteinBarr virus that mediates viral binding to the B lymphocyte EBV receptor (CR2). Cell 56, 369-377.[Medline]
Nishikawa, J., Imai, S., Oda, T., Kojima, T., Okita, K. & Takada, K. (1999). EpsteinBarr virus promotes epithelial cell growth in the absence of EBNA2 and LMP1 expression. Journal of Virology 73, 1286-1292.
Oda, T., Imai, S., Chiba, S. & Takada, K. (2000). EpsteinBarr virus lacking glycoprotein gp85 cannot infect B cells and epithelial cells. Virology 276, 52-58.[Medline]
Parker, B. D., Bankier, A. T., Satchwell, S. C., Barrell, B. G. & Farrell, P. J. (1990). Sequence and transcription of Raji EpsteinBarr virus DNA spanning the B95-8 deletion region. Virology 179, 339-346.[Medline]
Pulvertaft, R. J. V. (1964). Cytology of Burkitts tumor (African lymphoma). Lancet i, 238-240.
Rickinson, A. B. & Kieff, E. (1996). EpsteinBarr virus. In Fields Virology , pp. 2397-2446. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Shibata, D. & Weiss, L. M. (1992). EpsteinBarr virus-associated gastric adenocarcinoma. American Journal of Pathology 140, 769-774.[Abstract]
Shimizu, N., Tanabe-Tochikura, A., Kuroiwa, Y. & Takada, K. (1994). Isolation of EpsteinBarr virus (EBV)-negative cell clones from the EBV-positive Burkitts lymphoma (BL) line Akata: malignant phenotypes of BL cells are dependent on EBV. Journal of Virology 68, 6069-6073.
Shimizu, N., Yoshiyama, H. & Takada, K. (1996). Clonal propagation of EpsteinBarr virus (EBV) recombinants in EBV-negative Akata cells. Journal of Virology 70, 7260-7263.
Spriggs, M. K., Armitage, R. J., Comeau, M. R., Strockbine, L., Farrah, T., Macduff, B., Ulrich, D., Alderson, M. R., Müllberg, J. & Cohen, J. I. (1996). The extracellular domain of the Epstein-Barr virus BZLF2 protein binds the HLA- DR
chain and inhibits antigen presentation. Journal of Virology 70, 5557-5563.
Takada, K. (1984). Cross-linking of cell surface immunoglobulins induces EpsteinBarr virus in Burkitt lymphoma lines. International Journal of Cancer 33, 27-32.
Takada, K. & Ono, Y. (1989). Synchronous and sequential activation of latently infected EpsteinBarr virus genomes. Journal of Virology 63, 445-449.
Takada, K., Horinouchi, K., Ono, Y., Aya, T., Osato, T., Takahashi, M. & Hayasaka, S. (1991). An EpsteinBarr virus-producer line Akata: establishment of the cell line and analysis of viral DNA. Virus Genes 5, 147-156.[Medline]
Wang, X. & Hutt-Fletcher, L. M. (1998). EpsteinBarr virus lacking glycoprotein gp42 can bind to B cells but is not able to infect. Journal of Virology 72, 158-163.
Wang, X., Kenyon, W. J., Li, Q., Müllberg, J. & Hutt-Fletcher, L. M. (1998). EpsteinBarr virus uses different complexes of glycoproteins gH and gL to infect B lymphocytes and epithelial cells. Journal of Virology 72, 5552-5558.
Yamada, A., Murakami, M., Ijima, K., Yagita, H., Okumura, K., Komatsu, S. & Uede, T. (1996). Long-term acceptance of major histocompatibility complex-mismatched cardiac allograft induced by a low dose of CTLA4IgM plus FK506. Microbiology and Immunology 40, 513-518.[Medline]
Yoshiyama, H., Shimizu, N. & Takada, K. (1995). Persistent EpsteinBarr virus infection in a human T-cell line: unique program of latent virus expression. EMBO Journal 14, 3706-3711.[Medline]
Yoshiyama, H., Imai, S., Shimizu, N. & Takada, K. (1997). EpsteinBarr virus infection of human gastric carcinoma cells: implication of the existence of a new virus receptor different from CD21. Journal of Virology 71, 5688-5691.[Abstract]
Young, L. S., Lau, R., Rowe, M., Niedobitek, G., Packham, G., Shanahan, F., Rowe, D. T., Greenspan, D., Greenspan, J. S., Rickinson, A. B. & Farrell, P. J. (1991). Differentiation-associated expression of the EpsteinBarr virus BZLF1 transactivator protein in oral hairy leukoplakia. Journal of Virology 65, 2868-2874.
Received 3 April 2001;
accepted 1 July 2001.
This article has been cited by other articles:
![]() |
E. Seto, T. Ooka, J. Middeldorp, and K. Takada Reconstitution of Nasopharyngeal Carcinoma-Type EBV Infection Induces Tumorigenicity Cancer Res., February 15, 2008; 68(4): 1030 - 1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wu and L. M. Hutt-Fletcher Compatibility of the gH homologues of Epstein-Barr virus and related lymphocryptoviruses J. Gen. Virol., August 1, 2007; 88(8): 2129 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Boccellato, E. Anastasiadou, P. Rosato, B. Kempkes, L. Frati, A. Faggioni, and P. Trivedi EBNA2 Interferes with the Germinal Center Phenotype by Downregulating BCL6 and TCL1 in Non-Hodgkin's Lymphoma Cells J. Virol., March 1, 2007; 81(5): 2274 - 2282. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wen, D. Iwakiri, K. Yamamoto, S. Maruo, T. Kanda, and K. Takada Epstein-Barr Virus BZLF1 Gene, a Switch from Latency to Lytic Infection, Is Expressed as an Immediate-Early Gene after Primary Infection of B Lymphocytes J. Virol., January 15, 2007; 81(2): 1037 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Urquiza, R. Lopez, H. Patino, J. E. Rosas, and M. E. Patarroyo Identification of Three gp350/220 Regions Involved in Epstein-Barr Virus Invasion of Host Cells J. Biol. Chem., October 21, 2005; 280(42): 35598 - 35605. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ahsan, T. Kanda, K. Nagashima, and K. Takada Epstein-Barr Virus Transforming Protein LMP1 Plays a Critical Role in Virus Production J. Virol., April 1, 2005; 79(7): 4415 - 4424. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. McShane and R. Longnecker Cell-surface expression of a mutated Epstein-Barr virus glycoprotein B allows fusion independent of other viral proteins PNAS, December 14, 2004; 101(50): 17474 - 17479. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kanda, M. Yajima, N. Ahsan, M. Tanaka, and K. Takada Production of High-Titer Epstein-Barr Virus Recombinants Derived from Akata Cells by Using a Bacterial Artificial Chromosome System J. Virol., July 1, 2004; 78(13): 7004 - 7015. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. de Lima, J. S. May, and P. G. Stevenson Murine Gammaherpesvirus 68 Lacking gp150 Shows Defective Virion Release but Establishes Normal Latency In Vivo J. Virol., May 15, 2004; 78(10): 5103 - 5112. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Isobe, K. Sugimoto, L. Yang, K. Tamayose, M. Egashira, T. Kaneko, K. Takada, and K. Oshimi Epstein-Barr Virus Infection of Human Natural Killer Cell Lines and Peripheral Blood Natural Killer Cells Cancer Res., March 15, 2004; 64(6): 2167 - 2174. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||