|
|
||||||||
Animal: DNA Viruses |
Department of Pediatrics, Hokkaido University School of Medicine, N-15, W-7, Kita-ku, Sapporo 060-8638, Japan1
Department of Infectious Diseases, Mitsubishi Kagaku Bio-Clinical Laboratories, Tokyo, Japan2
Author for correspondence: Hideaki Kikuta. Fax +81 11 706 7898. e-mail hide-ki{at}med.hokudai.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
EBV-infected cells may sustain three distinct forms of virus latency (Rowe et al., 1992
; Griffin, 2000
). EBV infects B lymphocytes and induces indefinite cell proliferation. The lymphoblastoid cell lines (LCLs) carry episomal viral genomes and are usually non-lytic for virus replication. The LCL expresses the full spectrum of latent proteins or transcripts (latency III), including six EBV-encoded nuclear antigens [EBNAs 1, 2, 3A, 3B, 3C and latent protein (LP)], three latent membrane proteins (LMPs 1, 2A and 2B), two small nonpolyadenylated nuclear RNAs (EBERs 1 and 2), and transcripts from the BamHI-A region of the virus genome (BARF0) (Brooks et al., 1993
; Chen et al., 1999
). This form of latency is also encountered in some post-transplant LPD cases. In EBV-positive cases of NPC (Brooks et al., 1992
) and HD (Pallesen et al., 1991
), EBERs, BARF0, EBNA1 and the LMPs are expressed (latency II), whereas in BL, only EBERs, BARF0 and EBNA1 have been detected (latency I) (Chen et al., 1995
; Niedobitek et al., 1995
). The cell phenotype-dependent differences in EBV latent gene expression may reflect the strategy of the virus in relation to latent infection.
An EBV-infected T-cell lymphoma is a clonal expansion of a single EBV-infected cell with a pattern of gene expression that is distinct from that in BL but similar to that in NPC. However, despite the accumulation of clinical evidence in cases of neoplastic T-cell LPD (Pallesen et al., 1993
; Suzushima et al., 1995
), nothing is known about the form of EBV latency in cases of non-neoplastic T-cell LPD, including CAEBV. To understand the pathogenesis of CAEBV, especially T-cell LPD, it is essential to characterize the EBV latent gene expression in the disorder. Real-time PCR was first applied to the measurement of copy numbers of the EBV genome in various tissues in order to avoid underestimation of EBV latent gene expression by RTPCR. Then EBV latent gene expression in the samples with high viral loads was examined. To the best of our knowledge, this is the first report describing EBV latent gene expression in patients with CAEBV.
| Methods |
|---|
|
|
|---|
Tissue samples and cells.
|
DNA and RNA extraction.
Real-time PCR.
A real-time PCR assay was used to measure copy numbers of the EBV genome in tissues. The PCR primers for this assay were based on the EBNA1-encoding BKRF1 gene; the forward and reverse primer sequences were 5' GGATGCGATTAAGGACCTTGTT 3' (nucleotide position 109677109698) and 5'AAAGCTGCACACAGTCACCCT 3' (109749109729) (Baer et al., 1984
), respectively. The real-time PCR assay was carried out using a TaqMan PCR regent kit (PE Applied Biosystems) according to the manufacturers instructions. A fluorogenic probe [5'-(6-FAM)-TGACAAAGCCCGCTCCTACCTGCAAT (nucleotide position 109700109725)-(TAMRA)-3'] located between the PCR primers was synthesized by Sawady Technology Co. (Tokyo, Japan). The PCR reaction mixture consisted of 200 µmol each of dATP, dCTP and dGTP, 400 µmol dUTP, 1·25 U AmpliTaq Gold (PE Applied Biosystems), 50 mmol/l KCl, 10 mmol/l TrisHCl (pH 8·3), 5 mmol/l of MgCl2, 10 mmol/l EDTA, 0·5 U AmpErase uracil N-glycosylase (UNG), 25 pmol of each primer, 5 pmol TaqMan probe and 1 µg DNA in a volume of 50 µl. After activation of the UNG (2 min, 50 °C) and activation of the AmpliTaq Gold for 10 min at 95 °C, 50 cycles (15 s at 95 °C and 1 min at 60 °C) were carried out with an ABI PRISM 7700 Sequence Detection system (PE Applied Biosystems). To set up the assay, a standard curve of the threshold cycle (CT) values was obtained from serial 10-fold dilutions of 1 µg of Raji cell DNA on the basis that 1 µg of Raji cell DNA was extracted from 2·5x105 cells and one Raji cell contains 50 copies of the EBV genome. The CT value was determined by the first cycle number at which fluorescence was greater than or equal to 10 times that of the background. The CT values from clinical samples were plotted on the standard curve, and the copy number was calculated automatically using Sequence Detector software version 1.6 (PE Applied Biosystems). The lower limit of sensitivity was 2·5x10 EBV DNA copies/ µg DNA.
RTPCR.
In the present study, one tissue sample that was shown to contain high viral loads of EBV genomes by real-time PCR was selected and used as a representative tissue in each patient for RTPCR. The tissue samples included those from five spleens and one lymph node, and they were examined for the presence of viral RNA transcripts using RTPCR. A 3·2 µg sample of each RNA was incubated in a solution containing 100 ng of random hexadeoxynucleotides and 200 U of Moloney murine leukaemia virus reverse transcriptase (First-Strand cDNA Synthesis Kit; Amersham Pharmacia) in a final volume of 15 µl at 37 °C for 1 h to synthesise cDNA. A 0·2 µl sample of the cDNA was subjected to PCR analysis using different primer combinations to determine expression of EBV latent genes and the
-actin gene. To evaluate the sensitivity of RTPCR for detection of latent genes in tissues, the R-LCL was used as an EBV-positive control. Serial 10-fold dilutions of cDNA from the R-LCL were subjected to PCR. The primer sequences and PCR conditions used in this study, the expected sizes of PCR products and the sensitivities are summarized in Tables 2
and 3
. The PCR reaction mixture consisted of 100 µmol of each deoxyribonucleotide, 1·0 U AmpliTaq Gold, 50 mmol/l KCl, 10 mmol/l TrisHCl (pH 8·3), 1·5 mmol/l MgCl2, 0·01% (w/v) gelatin, 10 pmol of each primer and cDNA in a volume of 25 µl.
|
|
Southern blot hybridization.| Results |
|---|
|
|
|---|
|
|
|
| Discussion |
|---|
|
|
|---|
EBV is known to be a B-lymphotropic virus. However, recent evidence indicates that EBV can also infect T lymphocytes and may play a role in the development of T-cell LPD. A wide spectrum of non-neoplastic to neoplastic T-cell LPDs has been demonstrated to be frequently associated with EBV infection, including CAEBV (Kikuta et al., 1988
; Ohga et al., 1999
), EBV-AHS (Kawaguchi et al., 1993
; Su et al., 1994
), nasal or nasal-type lymphoma (Harabuchi et al., 1990
), peripheral T-cell lymphoma (Su et al., 1991
) and T-cell lymphoma (Suzushima et al., 1995
). Although T-cell LPDs are very rarely seen in Western countries, they are relatively common in Asia (Hsu & Glaser, 2000
). CAEBV is a life-threatening illness, which should be considered in the recently recognized spectrum of non-neoplastic T-cell LPDs and occasionally B-cell LPDs. While EBV latent gene expression of neoplastic T-cell LPD and EBV-infected T-cells in vitro has been reported, nothing is known about expression in non-neoplastic T-cell LPDs, such as CAEBV and EBV-AHS.
In EBV-positive T-cell lymphoma as well as in NPC and HD, viral transcripts consisting of EBNA1, LMP1 and LMP2A/2B have been detected by RTPCR (Suzushima et al., 1995
). Kelleher et al. (1995)
and Paterson et al. (1995)
showed that EBV could infect immature human thymocytes and induce expression of EBNA1, EBNA2, and BZLF-1 but not LMP2A and EBER1, suggesting that the mode of EBV infection in thymocytes differed from that in B lymphocytes. Two research groups (Koizumi et al., 1992
; Fujiwara & Ono, 1995
) using an intact EBV or a recombinant EBV have shown that the MT-2 cell line can be infected by EBV and that the EBV-infected MT-2 cells expressed only EBNA1 and LMP1 genes, a characteristic of latency II EBV infection. However, the MT-2 cell line is already transformed by human T-cell leukaemia virus type I, and thus EBV-infected cells could not reflect EBV latent gene expression in T cells in vivo. Recently, Imai et al. (1996)
established four EBV-infected IL-2-dependent T-cell lines from patients with CAEBV. These four T-cell lines expressed EBER1, EBNA1, LMP1, LMP2A and LMP2B but not EBNA2, 3A, 3B, 3C or LP. This form of latency was similar to that seen in the EBV-infected MT-2 cells. EBV gene expression in BL appears to be restricted to expression of EBNA1 only. However, most established BL cell lines drift from this restricted viral gene expression to the full spectrum of gene expression seen in LCL. Therefore, it is important to examine gene expression in primary samples. In fact, one of the T-cell lines established by Imai et al. (1996)
was derived from Pt-4 in this study, while the sample from the patient expressed EBNA2 but not LMP1 and LMP2A transcripts in addition to EBER1 and EBNA1 expression as substantiated in the present study.
In this study, we examined the viral loads in tissue samples and EBV latent gene expression in CAEBV. To determine whether the RTPCR technique is sensitive enough to definitively analyse EBV latent gene expression, we examined viral loads in a wide variety of primary tissues by real-time PCR. All tissues obtained from patients with CAEBV harboured larger amounts of EBV genomes than PBMC from healthy seropositive controls (Kimura et al., 1999
). The abundant EBV genomes in the tissues suggested a variety of serious symptoms and subsequent multiple organ failure in the patients. Though CAEBV is characterized by high antibody titres against lytic antigens, BZLF1 transcripts expressed during the lytic programme could not be detected in the tissue samples, indicating that high viral loads in the tissue samples did not seem to reflect virus replication (Takada et al., 1986
). Furthermore, we could not detect the linear molecules of EBV DNAs found during lytic infection in three patients (Pt-2, -4 and -6) by using terminal repeat analysis (Kikuta et al., 1989
). Therefore, we decided that the sensitivity of the RTPCR for EBV latent gene expression was high enough to exclude the possibility of underestimation. All samples consistently expressed EBER1 and EBNA1 transcripts. Expression of EBNA1 would not necessarily be required in EBV-infected resting B cells of healthy carriers. However, EBNA1 may be essential for replication and maintenance of the EBV episomes in proliferating T cells as well as in B cells (Thorley-Lawson & Babcock, 1999
). Only one sample expressed all the latent genes including EBER1, EBNA1, EBNA2, LMP1 and LMP2A. This form of latency, termed latency III, is also encountered in some post-transplant LPDs and infectious mononucleosis (Thorley-Lawson & Babcock, 1999
). Two of the remaining five samples expressed LMP1 and LMP2A transcripts, showing the latency II form. This form of latency is similar to that seen in a subset of NPC and HD. One sample expressed LMP2A but not LMP1 and EBNA2 transcripts, similar to the latent form in resting B cells of healthy carriers. The transcript of the LMP2A gene is the only gene product consistently detected in latently infected B cells of healthy carriers (Tierney et al., 1994
; Miyashita et al., 1995
, 1997
; Decker et al., 1996
). Another sample expressed EBNA2 but not LMP1 and LMP2A transcripts in addition to EBER1 and EBNA1. This latency form has been described in endemic BL (Niedobitek et al., 1995
). LMP1 and EBNA2 are thought to be responsible for the proliferative phenotype of infected B cells (Thorley-Lawson & Babcock, 1999
). Detection of LMP1 and EBNA2 transcripts may, therefore, be indicative of an EBV-driven proliferative state in CAEBV. The other sample did not express any of the other EBNA or LMP transcripts. This expression form resembled that of the phenotypically representative latency I. These results showed that EBV latent gene expression in CAEBV is heterogeneous and restricted, regardless of the cell type of LPD.
As tissue samples could not be examined at the cellular level, the latency form determined by RTPCR may represent only the predominant form of EBV infection in CAEBV. A tissue sample may comprise different cell populations expressing different latency forms. However, as EBV-infected cells show clonal proliferation in CAEBV as well as in neoplastic T-cell LPD (Kikuta et al., 1989
), the present results lead us to propose that EBV latent gene expression is heterogeneous and that different states of virushost interaction exist among cases of CAEBV. Except in one case the EBV-infected cells in CAEBV are distinguishable from those in infectious mononucleosis by the form of EBV latent gene expression. Furthermore, the severity of CAEBV may be due to the restricted expression of latent proteins, resulting in escape from the EBV-specific cytotoxic T lymphocytes and secondary functional impairment of the same T lymphocytes involved in host immunity against the virus.
Expression of different panels of latent gene products (latencies I, II and III) is controlled by use of three different EBNA promoters. While the C/W promoters permit expression of all EBNAs, the Q promoter only gives rise to EBNA1 (Schaefer et al., 1991
; Zetterberg et al., 1999
). Studies of EBNA promoters used in CAEBV and methylation patterns of the promoter regions are currently in progress.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Brooks, L., Yao, Q. Y., Rickinson, A. B. & Young, L. S. (1992). EpsteinBarr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts. Journal of Virology 66, 2689-2697.
Brooks, L. A., Lear, A. L., Young, L. S. & Rickinson, A. B. (1993). Transcripts from the EpsteinBarr virus BamHI A fragment are detectable in all three forms of virus latency. Journal of Virology 67, 3182-3190.
Busson, P., McCoy, R., Sadler, R., Gilligan, K., Tursz, T. & Raab-Traub, N. (1992). Consistent transcription of the EpsteinBarr virus LMP2 gene in nasopharyngeal carcinoma. Journal of Virology 66, 3257-3262.
Chen, F., Zou, J.-Z., di Renzo, L., Winberg, G., Hu, L.-F., Klein, E., Klein, G. & Ernberg, I. (1995). A subpopulation of normal B cells latently infected with EpsteinBarr virus resembles Burkitt lymphoma cells in expressing EBNA-1 but not EBNA-2 or LMP1. Journal of Virology 69, 3752-3758.
Chen, H., Smith, P., Ambinder, R. F. & Hyward, S. D. (1999). Expression of EpsteinBarr virus BamHI-A rightward transcripts in latently infected B cells from peripheral blood. Blood 93, 3026-3032.
Decker, L. L., Klaman, L. D. & Thorley-Lawson, D. A. (1996). Detection of the latent form of EpsteinBarr virus DNA in the peripheral blood of healthy individuals. Journal of Virology 70, 3286-3289.
Faulkner, G. C., Krajewski, A. S. & Crawford, D. H. (2000). The ins and outs of EBV infection. Trends in Microbiology 8, 185-189.[Medline]
Fujiwara, S. & Ono, Y. (1995). Isolation of EpsteinBarr virus-infected clones of the human T-cell line MT-2: use of recombinant viruses with a positive selection marker. Journal of Virology 69, 3900-3903.
Griffin, B. E. (2000). EpsteinBarr virus (EBV) and human disease: facts, opinions and problems. Mutation Research 462, 395-405.[Medline]
Harabuchi, Y., Yamanaka, N., Kataura, A., Imai, S., Kinoshita, T., Mizuno, F. & Osato, T. (1990). EpsteinBarr virus in nasal T-cell lymphomas in patients with lethal midline granuloma. Lancet 335, 128-130.[Medline]
Hsu, J. L. & Glaser, S. L. (2000). EpsteinBarr virus-associated malignancies: epidemiologic patterns and etiologic implications. Critical Reviews in Oncology/Hematology 34, 27-53.[Medline]
Imai, S., Koizumi, S., Sugiura, M., Tokunaga, M., Uemura, Y., Yamamoto, N., Tanaka, S., Sato, E. & Osato, T. (1994). Gastric carcinoma: monoclonal epithelial malignant cells expressing EpsteinBarr virus latent infection protein. Proceedings of the National Academy of Sciences, USA 91, 9131-9135.
Imai, S., Sugiura, M., Oikawa, O., Koizumi, S., Hirao, M., Kimura, H., Hayashibara, H., Terai, N., Tsutsumi, H., Oda, T., Chiba, S. & Osato, T. (1996). EpsteinBarr virus (EBV)-carrying and -expressing T-cell lines established from severe chronic active EBV infection. Blood 87, 1446-1457.
Jones, J. F., Shurin, S., Abramowsky, C., Tubbs, R. R., Sciotto, C. G., Wahl, R., Sands, J., Gottman, D., Katz, B. Z. & Sklar, J. (1988). T-cell lymphomas containing EpsteinBarr viral DNA in patients with chronic EpsteinBarr virus infections. New England Journal of Medicine 318, 733-741.[Abstract]
Kawaguchi, H., Miyashita, T., Herbst, H., Niedobitek, G., Asada, M., Tsuchida, M., Hanada, R., Kinoshita, A., Sakurai, M., Kobayashi, N. & Mizutani, S. (1993). EpsteinBarr virus-infected T lymphocytes in EpsteinBarr virus-associated hemophagocytic syndrome. Journal of Clinical Investigation 92, 1444-1450.
Kelleher, C. A., Paterson, R. K., Dreyfus, D. H., Streib, J. E., Xu, J. W., Takase, K., Jones, J. F. & Gelfand, E. W. (1995). EpsteinBarr virus replicative gene transcription during de novo infection of human thymocytes: simultaneous early expression of BZLF-1 and its repressor RAZ. Virology 208, 685-695.[Medline]
Kikuta, H., Taguchi, Y., Tomizawa, K., Kojima, K., Kawamura, N., Ishizaka, A., Sakiyama, Y., Matsumoto, S., Imai, S., Kinoshita, T., Koizumi, S., Osato, T., Kobayashi, I., Hamada, I. & Hirai, K. (1988). EpsteinBarr virus genome-positive T lymphocytes in a boy with chronic active EBV infection associated with Kawasaki-like disease. Nature 333, 455-457.[Medline]
Kikuta, H., Nakanishi, M., Sakiyama, Y. & Matsumoto, S. (1989). Chronic active EpsteinBarr virus (EBV) infection is associated with clonotypic intracellular terminal regions of the EBV. Journal of Infectious Diseases 160, 546-547.[Medline]
Kikuta, H., Sakiyama, Y., Matsumoto, S., Hamada, I., Yazaki, M., Iwaki, T. & Nakano, M. (1993). Detection of EpsteinBarr virus DNA in cardiac and aortic tissues from chronic, active EpsteinBarr virus infection associated with Kawasaki disease-like coronary artery aneurysms. Journal of Pediatrics 123, 90-92.[Medline]
Kimura, H., Morita, M., Yabuta, Y., Kuzushima, K., Kato, K., Kojima, S., Matsuyama, T. & Morishima, T. (1999). Quantitative analysis of EpsteinBarr virus load by using a real-time PCR assay. Journal of Clinical Microbiology 37, 132-136.
Klein, G. (1994). EpsteinBarr virus strategy in normal and neoplastic B cells. Cell 77, 791-793.[Medline]
Koizumi, S., Zhang, X.-K., Imai, S., Sugiura, M., Usui, N. & Osato, T. (1992). Infection of the HTLV-1-harboring T-lymphoblastoid line MT-2 by EpsteinBarr virus. Virology 188, 859-863.[Medline]
Maeda, A., Wakiguchi, H., Yokoyama, W., Hisakawa, H., Tomoda, T. & Kurashige, T. (1999). Persistently high Epstein-Barr virus (EBV) loads in peripheral blood lymphocytes from patients with chronic active EBV infection. Journal of Infectious Diseases 179, 1012-1015.[Medline]
Miyashita, E. M., Yang, B., Lam, K. M. C., Crawford, D. H. & Thorley-Lawson, D. A. (1995). A novel form of EpsteinBarr virus latency in normal B cells in vivo. Cell 80, 593-601.[Medline]
Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of EpsteinBarr virus persistence in vivo as a resting B cell. Journal of Virology 71, 4882-4891.
Niedobitek, G., Agathanggelou, A., Rowe, M., Jones, D. B., Turyaguma, P., Oryema, J., Wright, D. H. & Young, L. S. (1995). Heterogeneous expression of EpsteinBarr virus latent proteins in endemic Burkitts lymphoma. Blood 86, 659-665.
Ohga, S., Kimura, N., Takada, H., Nagano, M., Ohshima, K., Nomura, A., Muraoka, K., Take, H., Yamamori, S. & Hara, T. (1999). Restricted diversification of T-cells in chronic active EpsteinBarr virus infection: potential inclination to T-lymphoproliferative disease. American Journal of Hematology 61, 26-33.[Medline]
Pallesen, G., Hamilton-Dutoit, S. J., Rowe, M. & Young, L. S. (1991). Expression of the EpsteinBarr virus latent gene products in tumor cells of Hodgkins disease. Lancet 337, 320-322.[Medline]
Pallesen, G., Hamilton-Dutoit, S. J. & Zhou, X. (1993). The association of EpsteinBarr virus (EBV) with T cell lymphoproliferations and Hodgkins disease: two new developments in the EBV field. Advances in Cancer Research 62, 179-239.[Medline]
Paterson, R. L. K., Kelleher, C. A., Streib, J. E., Amankonah, T. D., Xu, J. W., Jones, J. F. & Gelfand, E. W. (1995). Activation of human thymocytes after infection by EBV. Journal of Immunology 154, 1440-1449.[Abstract]
Rickinson, A. B. (1986). Chronic, symptomatic EpsteinBarr virus infections. Immunology Today 7, 13-14.
Rowe, M., Lear, A. L., Croom-Carter, D., Davies, A. H. & Rickinson, A. B. (1992). Three pathways of EpsteinBarr virus gene activation from EBNA1-positive latency in B lymphocytes. Journal of Virology 66, 122-131.
Schaefer, B. C., Woisetschlaeger, M., Strominger, J. L. & Speck, S. H. (1991). Exclusive expression of EpsteinBarr virus nuclear antigen 1 in Burkitt lymphoma arises from a third promoter, distinct from the promoters used in latently infected lymphocytes. Proceedings of the National Academy of Sciences, USA 88, 6550-6554.
Schooley, R. T., Carey, R. W., Miller, G., Henle, W., Eastman, R., Mark, E. J., Kenyon, K., Wheeler, E. O. & Rubin, R. H. (1986). Chronic EpsteinBarr virus infection associated with fever and interstitial pneumonitis: clinical and serologic features and response to antiviral chemotherapy. Annals of Internal Medicine 104, 636-643.
Su, I.-J., Hsieh, H.-C., Lin, K.-H., Uen, W.-C., Kao, C.-L., Chen, C.-J., Cheng, A.-L., Kadin, M. E. & Chen, J.-Y. (1991). Aggressive peripheral T-cell lymphomas containing EpsteinBarr viral DNA: a clinicopathologic and molecular analysis. Blood 77, 799-808.
Su, I.-J., Chen, R.-L., Lin, D.-T., Lin, K.-S. & Chen, C.-C. (1994). EpsteinBarr virus (EBV) infects T lymphocytes in childhood EBV-associated hemophagocytic syndrome in Taiwan. American Journal of Pathology 144, 1219-1225.[Abstract]
Sugiyama, K., Ito, M., Ichimi, R., Higashikawa, M., Kawasaki, H., Komada, Y., Sakurai, M., Wakiguchi, H., Kikuta, H. & Fukayama, M. (1997). A case of EpsteinBarr virus infection with exophthalmos and ocular muscle swelling. Acta Paediatrica Japonica 39, 694-697.
Suzushima, H., Asou, N., Fujimoto, T., Nishimura, S., Okubo, H., Yamasaki, H., Osato, M., Matsuoka, M., Tsukamoto, A., Takai, K., Kawano, F. & Takatsuki, K. (1995). Lack of the expression of EBNA-2 and LMP-1 in T-cell neoplasms possessing EpsteinBarr virus. Blood 85, 480-486.
Takada, K., Shimizu, N., Sakuma, S. & Ono, Y. (1986). Trans activation of the latent EpsteinBarr virus (EBV) genome after transfection of the EBV DNA fragment. Journal of Virology 57, 1016-1022.
Thorley-Lawson, D. A. & Babcock, G. J. (1999). A model for persistent infection with EpsteinBarr virus: the stealth virus of human B cells. Life Sciences 65, 1433-1453.[Medline]
Thorley-Lawson, D. A., Miyashita, E. M. & Khan, G. (1996). EpsteinBarr virus and B cells: thats all it takes. Trends in Microbiology 4, 204-208.[Medline]
Tierney, R. J., Steven, N., Young, L. S. & Rickinson, A. B. (1994). EpsteinBarr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. Journal of Virology 68, 7374-7385.
Zetterberg, H., Stenglein, M., Jansson, A., Ricksten, A. & Rymo, L. (1999). Relative levels of EBNA1 gene transcripts from the C/W, F and Q promoters in EpsteinBarr virus-transformed lymphoid cells in latent and lytic stages of infection. Journal of General Virology 80, 457-465.[Abstract]
Received 18 April 2001;
accepted 8 June 2001.
This article has been cited by other articles:
![]() |
H. Katano, M. A. Ali, A. C. Patera, M. Catalfamo, E. S. Jaffe, H. Kimura, J. K. Dale, S. E. Straus, and J. I. Cohen Chronic active Epstein-Barr virus infection associated with mutations in perforin that impair its maturation Blood, February 15, 2004; 103(4): 1244 - 1252. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yoshioka, H. Kikuta, N. Ishiguro, X. Ma, and K. Kobayashi Unique Epstein-Barr virus (EBV) latent gene expression, EBNA promoter usage and EBNA promoter methylation status in chronic active EBV infection J. Gen. Virol., May 1, 2003; 84(5): 1133 - 1140. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |