J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshioka, M.
Right arrow Articles by Kobayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshioka, M.
Right arrow Articles by Kobayashi, K.
Agricola
Right arrow Articles by Yoshioka, M.
Right arrow Articles by Kobayashi, K.
Journal of General Virology (2001), 82, 2385-2392.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Heterogeneous, restricted patterns of Epstein–Barr virus (EBV) latent gene expression in patients with chronic active EBV infection

Mikio Yoshioka1, Nobuhisa Ishiguro1, Hiroaki Ishiko2, Xiaoming Ma1, Hideaki Kikuta1 and Kunihiko Kobayashi1

Department of Pediatrics, Hokkaido University School of Medicine, N-15, W-7, Kita-ku, Sapporo 060-8638, Japan1
Department of Infectious Diseases, Mitsubishi Kagaku Bio-Clinical Laboratories, Tokyo, Japan2

Author for correspondence: Hideaki Kikuta. Fax +81 11 706 7898. e-mail hide-ki{at}med.hokudai.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr virus (EBV) has been shown to infect T lymphocytes and to be associated with a chronic active infection (CAEBV), which has been recognized as a mainly non-neoplastic T-cell lymphoproliferative disorder (T-cell LPD). The systemic distribution of EBV genomes was studied, by real-time PCR, in multiple tissues from six patients with CAEBV, including three patients with T-cell LPD, one patient with B-cell LPD and two patients with undetermined cell-type LPD. There were extremely high loads of EBV genomes in all tissues from the patients. This reflects an abundance of circulating and infiltrating EBV-infected cells and a wide variety of clinical symptoms in the affected tissues. We chose one sample from each patient that was shown by real-time PCR to contain a high load of EBV genomes and examined the expression of EBV latent genes by RT–PCR. EBER1 and EBNA1 transcripts were detected in all samples. Only one sample also expressed EBNA2, LMP1 and LMP2A transcripts in addition to EBER1 and EBNA1 transcripts. Two of the remaining five samples expressed LMP1 and LMP2A transcripts. One sample expressed LMP2A but not LMP1 and EBNA2 transcripts. Another sample expressed EBNA2 but not LMP1 and LMP2A transcripts. The other sample did not express transcripts of any of the other EBNAs or LMPs. None of the samples expressed the viral immediate-early gene BZLF1. These results showed that EBV latent gene expression in CAEBV is heterogeneous and that restricted forms of EBV latency might play a pathogenic role in the development of CAEBV.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr virus (EBV) is a human herpesvirus associated with an array of conditions that range from asymptomatic infection and infectious mononucleosis to lethal lymphoproliferative disease (LPD), nasopharyngeal carcinoma (NPC), Burkitt’s lymphoma (BL), and B-cell lymphoma in the immunocompromised host (Griffin, 2000Down ). EBV has recently been implicated in the aetiology of an increasing number of diseases, including gastric carcinoma (Imai et al., 1994Down ), Hodgkin’s lymphoma (HD) (Pallesen et al., 1993Down ), NK/T-cell lymphoma (Jones et al., 1988Down ; Harabuchi et al., 1990Down ; Su et al., 1991Down ), and non-neoplastic T-cell LPD such as chronic active EBV infection (CAEBV) (Kikuta et al., 1988Down ) and EBV-associated haemophagocytic syndrome (EBV-AHS) (Kawaguchi et al., 1993Down ; Su et al., 1994Down ). CAEBV is characterized by such clinical symptoms as fever, lymphadenopathy, splenomegaly, hepatitis, interstitial pneumonitis, nephritis, coronary artery aneurysms and uveitis, which persist over a period of months to several years. Laboratory findings include anaemia, thrombocytopenia, leukopenia and hypergammaglobulinaemia with extremely high titres of antibodies against EBV lytic-cycle proteins (Rickinson, 1986Down ; Schooley et al., 1986Down ). CAEBV is a life-threatening illness leading to the development of lymphoma, myelodysplastic syndrome, EBV-AHS, opportunistic infection or multiple organ failure. The most striking finding of CAEBV is that EBV usually infects T lymphocytes and only occasionally B lymphocytes (Kikuta et al., 1989Down ; Ohga et al., 1999Down ). Though EBV-infected cells show a clonal proliferation in CAEBV (Kikuta et al., 1989Down ), the EBV-infected cells have the morphology not of lymphoblastoid cells but of small- to medium-sized lymphoid cells in the majority of cases. This makes us suspect that EBV-infected cells must represent a different form of EBV latency from that of neoplastic T-cell LPD.

EBV-infected cells may sustain three distinct forms of virus latency (Rowe et al., 1992Down ; Griffin, 2000Down ). EBV infects B lymphocytes and induces indefinite cell proliferation. The lymphoblastoid cell lines (LCLs) carry episomal viral genomes and are usually non-lytic for virus replication. The LCL expresses the full spectrum of latent proteins or transcripts (latency III), including six EBV-encoded nuclear antigens [EBNAs 1, 2, 3A, 3B, 3C and latent protein (LP)], three latent membrane proteins (LMPs 1, 2A and 2B), two small nonpolyadenylated nuclear RNAs (EBERs 1 and 2), and transcripts from the BamHI-A region of the virus genome (BARF0) (Brooks et al., 1993Down ; Chen et al., 1999Down ). This form of latency is also encountered in some post-transplant LPD cases. In EBV-positive cases of NPC (Brooks et al., 1992Down ) and HD (Pallesen et al., 1991Down ), EBERs, BARF0, EBNA1 and the LMPs are expressed (latency II), whereas in BL, only EBERs, BARF0 and EBNA1 have been detected (latency I) (Chen et al., 1995Down ; Niedobitek et al., 1995Down ). The cell phenotype-dependent differences in EBV latent gene expression may reflect the strategy of the virus in relation to latent infection.

An EBV-infected T-cell lymphoma is a clonal expansion of a single EBV-infected cell with a pattern of gene expression that is distinct from that in BL but similar to that in NPC. However, despite the accumulation of clinical evidence in cases of neoplastic T-cell LPD (Pallesen et al., 1993Down ; Suzushima et al., 1995Down ), nothing is known about the form of EBV latency in cases of non-neoplastic T-cell LPD, including CAEBV. To understand the pathogenesis of CAEBV, especially T-cell LPD, it is essential to characterize the EBV latent gene expression in the disorder. Real-time PCR was first applied to the measurement of copy numbers of the EBV genome in various tissues in order to avoid underestimation of EBV latent gene expression by RT–PCR. Then EBV latent gene expression in the samples with high viral loads was examined. To the best of our knowledge, this is the first report describing EBV latent gene expression in patients with CAEBV.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Tissue samples and cells.
Multiple tissue samples were obtained from six patients with CAEBV, including three patients with T-cell LPD, one patient with B-cell LPD and two patients with undetermined cell-type LPD. Samples were obtained at autopsy except for Pt-3 (at biopsy) after obtaining informed consent from the patients’ parents. The tissue samples were immediately snap-frozen at -80 °C. The diagnosis of CAEBV was based on clinical, serological and virological evidence (Rickinson, 1986Down ; Schooley et al., 1986Down ). The results of the virological study are summarized in Table 1Down. For three of the six patients, we determined the clonality of EBV-infected cells by using terminal repeat analysis (Kikuta et al., 1989Down ). All patients died in spite of treatment with a wide variety of agents. Raji cells were used as a positive control in real-time PCR. B95-8 EBV-immortalized reference cell lines (R-LCL) and BJAB cell lines were used as positive and negative controls, respectively, for EBV latent gene expression in RT–PCR. The B95-8 cell line, with 3% of cells in the lytic cycle, was used as a positive control for lytic replication.


View this table:
[in this window]
[in a new window]
 
Table 1. EBV virology in patients with chronic active EBV infection

 
{blacksquare} DNA and RNA extraction.
Genomic DNA was extracted from the frozen tissue samples, cells and cell lines by digestion with proteinase K, extraction with phenol–chloroform and precipitation with ethanol. Total RNA was extracted from the frozen tissue samples and cell lines by using the RNAzol B (TEL-TEST, Texas, USA) method according to the manufacturer’s protocol.

{blacksquare} Real-time PCR.
A real-time PCR assay was used to measure copy numbers of the EBV genome in tissues. The PCR primers for this assay were based on the EBNA1-encoding BKRF1 gene; the forward and reverse primer sequences were 5' GGATGCGATTAAGGACCTTGTT 3' (nucleotide position 109677–109698) and 5'AAAGCTGCACACAGTCACCCT 3' (109749–109729) (Baer et al., 1984Down ), respectively. The real-time PCR assay was carried out using a TaqMan PCR regent kit (PE Applied Biosystems) according to the manufacturer’s instructions. A fluorogenic probe [5'-(6-FAM)-TGACAAAGCCCGCTCCTACCTGCAAT (nucleotide position 109700–109725)-(TAMRA)-3'] located between the PCR primers was synthesized by Sawady Technology Co. (Tokyo, Japan). The PCR reaction mixture consisted of 200 µmol each of dATP, dCTP and dGTP, 400 µmol dUTP, 1·25 U AmpliTaq Gold (PE Applied Biosystems), 50 mmol/l KCl, 10 mmol/l Tris–HCl (pH 8·3), 5 mmol/l of MgCl2, 10 mmol/l EDTA, 0·5 U AmpErase uracil N-glycosylase (UNG), 25 pmol of each primer, 5 pmol TaqMan probe and 1 µg DNA in a volume of 50 µl. After activation of the UNG (2 min, 50 °C) and activation of the AmpliTaq Gold for 10 min at 95 °C, 50 cycles (15 s at 95 °C and 1 min at 60 °C) were carried out with an ABI PRISM 7700 Sequence Detection system (PE Applied Biosystems). To set up the assay, a standard curve of the threshold cycle (CT) values was obtained from serial 10-fold dilutions of 1 µg of Raji cell DNA on the basis that 1 µg of Raji cell DNA was extracted from 2·5x105 cells and one Raji cell contains 50 copies of the EBV genome. The CT value was determined by the first cycle number at which fluorescence was greater than or equal to 10 times that of the background. The CT values from clinical samples were plotted on the standard curve, and the copy number was calculated automatically using Sequence Detector software version 1.6 (PE Applied Biosystems). The lower limit of sensitivity was 2·5x10 EBV DNA copies/ µg DNA.

{blacksquare} RT–PCR.
In the present study, one tissue sample that was shown to contain high viral loads of EBV genomes by real-time PCR was selected and used as a representative tissue in each patient for RT–PCR. The tissue samples included those from five spleens and one lymph node, and they were examined for the presence of viral RNA transcripts using RT–PCR. A 3·2 µg sample of each RNA was incubated in a solution containing 100 ng of random hexadeoxynucleotides and 200 U of Moloney murine leukaemia virus reverse transcriptase (First-Strand cDNA Synthesis Kit; Amersham Pharmacia) in a final volume of 15 µl at 37 °C for 1 h to synthesise cDNA. A 0·2 µl sample of the cDNA was subjected to PCR analysis using different primer combinations to determine expression of EBV latent genes and the {beta}-actin gene. To evaluate the sensitivity of RT–PCR for detection of latent genes in tissues, the R-LCL was used as an EBV-positive control. Serial 10-fold dilutions of cDNA from the R-LCL were subjected to PCR. The primer sequences and PCR conditions used in this study, the expected sizes of PCR products and the sensitivities are summarized in Tables 2Down and 3Down. The PCR reaction mixture consisted of 100 µmol of each deoxyribonucleotide, 1·0 U AmpliTaq Gold, 50 mmol/l KCl, 10 mmol/l Tris–HCl (pH 8·3), 1·5 mmol/l MgCl2, 0·01% (w/v) gelatin, 10 pmol of each primer and cDNA in a volume of 25 µl.


View this table:
[in this window]
[in a new window]
 
Table 2. Primer sequences used for RT–PCR

 

View this table:
[in this window]
[in a new window]
 
Table 3. Amplification conditions and sensitivities of RT–PCR

 
{blacksquare} Southern blot hybridization.
Aliquots (10 µl) of the PCR-amplified product were subjected to electrophoresis through a 1·0% agarose gel and transferred onto Hybond ECL nitrocellulose membranes (Amersham). Hybridization and washing were then done according to the manufacturer’s protocol. The cloned fragments of the RT–PCR-amplified products from the positive controls were labelled with the ECL random prime labelling and detection systems (Amersham) and used as probes.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Real-time PCR
The EBV DNA load ranged from 6·5x102 to 3·7x106 copies/µg DNA in all tissue samples with a mean load of 4·0x105 copies/µg DNA (Fig. 1Down). Elevated EBV DNA loads in all tissues as well as in peripheral blood mononuclear cells (PBMC) have been reported in patients with CAEBV (Kimura et al., 1999Down ; Maeda et al., 1999Down ). The viral loads in B-cell LPD (Pt-2) appeared to be lower than in T-cell LPD. EBV-infected resting B cells have been shown to carry an episomal viral genome at a low copy number (2–5 copies per cell) (Thorley-Lawson et al., 1996Down ). As we were unable to determine the copy numbers of the EBV genome in the EBV-infected cells from CAEBV patients, we estimated the copy number to be 5 at maximum. One µg of genomic DNA from the tissue samples corresponds to 2·5x105 cells. At least five cells (6·5x102/5/2·5x104=5·2) in 104 cells of the tissues examined would have been infected with EBV in the absence of lytic infection.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1. EBV DNA load in tissue samples of six patients with chronic active EBV infection. a, Liver; b, lung; c, spleen; d, kidney; e, lymph node; f, heart; g, submandibular gland; h, PBMC; i, mononuclear cells from bone marrow; *, not tested.

 
RT–PCR
All EBV latent gene transcripts and the BZLF1 transcript could be detected (Fig. 2Down) down to at least 10-4 dilutions of cDNA from the positive controls, as shown in Table 3Up. This indicated that if there is more than one EBV-infected cell in 104 tissue cells, the RT–PCR assay can detect the resulting EBV latent gene expression. Several distinct patterns of gene expressions were identified in the patients with CAEBV, as summarized in Table 4Down. EBER1 and EBNA1 transcripts were consistently detected by RT–PCR in representative samples from the six patients. Three of the six representative samples, including those from two patients with T-cell LPD (Pt-3, Pt-5) and one patient with undetermined cell-type LPD (Pt-6), expressed LMP1 and LMP2A transcripts. One (Pt-3) of the three samples also expressed EBNA2 transcripts. A sample from the other patient with undetermined cell-type LPD (Pt-1) expressed LMP2A but not LMP1 and EBNA2 transcripts. A sample from the other patient with T-cell LPD (Pt-4) expressed EBNA2 but not LMP1 and LMP2A transcripts. The sample from the patient with B-cell LPD (Pt-2) did not express any of the other EBNAs or LMPs transcripts. None of the samples expressed BZLF1 transcripts.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. RT–PCR analysis for mRNA expression of EBV transcripts. Southern blot hybridization is shown together with the exons (boxes), primers (arrows) and sites of transcriptional promoter (flags) for each mRNA. Lane 1, Pt-1; lane 2, Pt-2; lane 3, Pt-3; lane 4, Pt-4; lane 5, Pt-5; lane 6, Pt-6; lane 7, negative control; lane 8, positive control.

 

View this table:
[in this window]
[in a new window]
 
Table 4. Summary of EBV transcripts in chronic active EBV infection as determined by RT–PCR

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
EBV establishes a life-long infection in humans with distinct virus latency programmes during acute and chronic phases of infection (Thorley-Lawson et al., 1996Down ; Thorley-Lawson & Babcock, 1999Down ; Faulkner et al., 2000Down ). During primary infection, EBV-infected B lymphocytes express the full spectrum of EBNAs and LMPs in addition to BARF0 and the EBERs. EBV-immortalized lymphoblasts are detected during the acute phase of infectious mononucleosis but are eventually eliminated by a strong cellular immune response to highly immunogenic EBNA2 and EBNA3 family proteins (Klein, 1994Down ). This expression pattern, which has been termed latency III, is also seen in LCL in culture. During chronic asymptomatic infection in healthy individuals, EBV resides in resting memory CD23- and CD80- (B7-) B cells. This population of cells expresses LMP2A, but EBNA1 was not consistently detected (Tierney et al., 1994Down ; Miyashita et al., 1995Down , 1997Down ; Decker et al., 1996Down ). EBV-associated tumours demonstrate a restricted pattern of latent gene expression (latency I/II) in which only EBNA1 is expressed (latency I) or in which LMP1, LMP2A and LMP2B in addition to EBNA1 are variably expressed (latency II) (Pallesen et al., 1991Down ; Brooks et al., 1992Down ; Chen et al., 1995Down ; Niedobitek et al., 1995Down ). BARF0 and EBERs are commonly expressed in all of the latent forms mentioned above (Brooks et al., 1993Down ; Chen et al., 1999Down ).

EBV is known to be a B-lymphotropic virus. However, recent evidence indicates that EBV can also infect T lymphocytes and may play a role in the development of T-cell LPD. A wide spectrum of non-neoplastic to neoplastic T-cell LPDs has been demonstrated to be frequently associated with EBV infection, including CAEBV (Kikuta et al., 1988Down ; Ohga et al., 1999Down ), EBV-AHS (Kawaguchi et al., 1993Down ; Su et al., 1994Down ), nasal or nasal-type lymphoma (Harabuchi et al., 1990Down ), peripheral T-cell lymphoma (Su et al., 1991Down ) and T-cell lymphoma (Suzushima et al., 1995Down ). Although T-cell LPDs are very rarely seen in Western countries, they are relatively common in Asia (Hsu & Glaser, 2000Down ). CAEBV is a life-threatening illness, which should be considered in the recently recognized spectrum of non-neoplastic T-cell LPDs and occasionally B-cell LPDs. While EBV latent gene expression of neoplastic T-cell LPD and EBV-infected T-cells in vitro has been reported, nothing is known about expression in non-neoplastic T-cell LPDs, such as CAEBV and EBV-AHS.

In EBV-positive T-cell lymphoma as well as in NPC and HD, viral transcripts consisting of EBNA1, LMP1 and LMP2A/2B have been detected by RT–PCR (Suzushima et al., 1995Down ). Kelleher et al. (1995)Down and Paterson et al. (1995)Down showed that EBV could infect immature human thymocytes and induce expression of EBNA1, EBNA2, and BZLF-1 but not LMP2A and EBER1, suggesting that the mode of EBV infection in thymocytes differed from that in B lymphocytes. Two research groups (Koizumi et al., 1992Down ; Fujiwara & Ono, 1995Down ) using an intact EBV or a recombinant EBV have shown that the MT-2 cell line can be infected by EBV and that the EBV-infected MT-2 cells expressed only EBNA1 and LMP1 genes, a characteristic of latency II EBV infection. However, the MT-2 cell line is already transformed by human T-cell leukaemia virus type I, and thus EBV-infected cells could not reflect EBV latent gene expression in T cells in vivo. Recently, Imai et al. (1996)Down established four EBV-infected IL-2-dependent T-cell lines from patients with CAEBV. These four T-cell lines expressed EBER1, EBNA1, LMP1, LMP2A and LMP2B but not EBNA2, 3A, 3B, 3C or LP. This form of latency was similar to that seen in the EBV-infected MT-2 cells. EBV gene expression in BL appears to be restricted to expression of EBNA1 only. However, most established BL cell lines drift from this restricted viral gene expression to the full spectrum of gene expression seen in LCL. Therefore, it is important to examine gene expression in primary samples. In fact, one of the T-cell lines established by Imai et al. (1996)Down was derived from Pt-4 in this study, while the sample from the patient expressed EBNA2 but not LMP1 and LMP2A transcripts in addition to EBER1 and EBNA1 expression as substantiated in the present study.

In this study, we examined the viral loads in tissue samples and EBV latent gene expression in CAEBV. To determine whether the RT–PCR technique is sensitive enough to definitively analyse EBV latent gene expression, we examined viral loads in a wide variety of primary tissues by real-time PCR. All tissues obtained from patients with CAEBV harboured larger amounts of EBV genomes than PBMC from healthy seropositive controls (Kimura et al., 1999Down ). The abundant EBV genomes in the tissues suggested a variety of serious symptoms and subsequent multiple organ failure in the patients. Though CAEBV is characterized by high antibody titres against lytic antigens, BZLF1 transcripts expressed during the lytic programme could not be detected in the tissue samples, indicating that high viral loads in the tissue samples did not seem to reflect virus replication (Takada et al., 1986Down ). Furthermore, we could not detect the linear molecules of EBV DNAs found during lytic infection in three patients (Pt-2, -4 and -6) by using terminal repeat analysis (Kikuta et al., 1989Down ). Therefore, we decided that the sensitivity of the RT–PCR for EBV latent gene expression was high enough to exclude the possibility of underestimation. All samples consistently expressed EBER1 and EBNA1 transcripts. Expression of EBNA1 would not necessarily be required in EBV-infected resting B cells of healthy carriers. However, EBNA1 may be essential for replication and maintenance of the EBV episomes in proliferating T cells as well as in B cells (Thorley-Lawson & Babcock, 1999Down ). Only one sample expressed all the latent genes including EBER1, EBNA1, EBNA2, LMP1 and LMP2A. This form of latency, termed latency III, is also encountered in some post-transplant LPDs and infectious mononucleosis (Thorley-Lawson & Babcock, 1999Down ). Two of the remaining five samples expressed LMP1 and LMP2A transcripts, showing the latency II form. This form of latency is similar to that seen in a subset of NPC and HD. One sample expressed LMP2A but not LMP1 and EBNA2 transcripts, similar to the latent form in resting B cells of healthy carriers. The transcript of the LMP2A gene is the only gene product consistently detected in latently infected B cells of healthy carriers (Tierney et al., 1994Down ; Miyashita et al., 1995Down , 1997Down ; Decker et al., 1996Down ). Another sample expressed EBNA2 but not LMP1 and LMP2A transcripts in addition to EBER1 and EBNA1. This latency form has been described in endemic BL (Niedobitek et al., 1995Down ). LMP1 and EBNA2 are thought to be responsible for the proliferative phenotype of infected B cells (Thorley-Lawson & Babcock, 1999Down ). Detection of LMP1 and EBNA2 transcripts may, therefore, be indicative of an EBV-driven proliferative state in CAEBV. The other sample did not express any of the other EBNA or LMP transcripts. This expression form resembled that of the phenotypically representative latency I. These results showed that EBV latent gene expression in CAEBV is heterogeneous and restricted, regardless of the cell type of LPD.

As tissue samples could not be examined at the cellular level, the latency form determined by RT–PCR may represent only the predominant form of EBV infection in CAEBV. A tissue sample may comprise different cell populations expressing different latency forms. However, as EBV-infected cells show clonal proliferation in CAEBV as well as in neoplastic T-cell LPD (Kikuta et al., 1989Down ), the present results lead us to propose that EBV latent gene expression is heterogeneous and that different states of virus–host interaction exist among cases of CAEBV. Except in one case the EBV-infected cells in CAEBV are distinguishable from those in infectious mononucleosis by the form of EBV latent gene expression. Furthermore, the severity of CAEBV may be due to the restricted expression of latent proteins, resulting in escape from the EBV-specific cytotoxic T lymphocytes and secondary functional impairment of the same T lymphocytes involved in host immunity against the virus.

Expression of different panels of latent gene products (latencies I, II and III) is controlled by use of three different EBNA promoters. While the C/W promoters permit expression of all EBNAs, the Q promoter only gives rise to EBNA1 (Schaefer et al., 1991Down ; Zetterberg et al., 1999Down ). Studies of EBNA promoters used in CAEBV and methylation patterns of the promoter regions are currently in progress.


   Acknowledgments
 
The authors thank Mr Stewart Chisholm for proofreading the manuscript.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfall, G., Hudson, G. S., Satchwell, S. C., Séguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein–Barr virus genome. Nature 310, 207-211.[Medline]

Brooks, L., Yao, Q. Y., Rickinson, A. B. & Young, L. S. (1992). Epstein–Barr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts. Journal of Virology 66, 2689-2697.[Abstract/Free Full Text]

Brooks, L. A., Lear, A. L., Young, L. S. & Rickinson, A. B. (1993). Transcripts from the Epstein–Barr virus BamHI A fragment are detectable in all three forms of virus latency. Journal of Virology 67, 3182-3190.[Abstract/Free Full Text]

Busson, P., McCoy, R., Sadler, R., Gilligan, K., Tursz, T. & Raab-Traub, N. (1992). Consistent transcription of the Epstein–Barr virus LMP2 gene in nasopharyngeal carcinoma. Journal of Virology 66, 3257-3262.[Abstract/Free Full Text]

Chen, F., Zou, J.-Z., di Renzo, L., Winberg, G., Hu, L.-F., Klein, E., Klein, G. & Ernberg, I. (1995). A subpopulation of normal B cells latently infected with Epstein–Barr virus resembles Burkitt lymphoma cells in expressing EBNA-1 but not EBNA-2 or LMP1. Journal of Virology 69, 3752-3758.[Abstract]

Chen, H., Smith, P., Ambinder, R. F. & Hyward, S. D. (1999). Expression of Epstein–Barr virus BamHI-A rightward transcripts in latently infected B cells from peripheral blood. Blood 93, 3026-3032.[Abstract/Free Full Text]

Decker, L. L., Klaman, L. D. & Thorley-Lawson, D. A. (1996). Detection of the latent form of Epstein–Barr virus DNA in the peripheral blood of healthy individuals. Journal of Virology 70, 3286-3289.[Abstract]

Faulkner, G. C., Krajewski, A. S. & Crawford, D. H. (2000). The ins and outs of EBV infection. Trends in Microbiology 8, 185-189.[Medline]

Fujiwara, S. & Ono, Y. (1995). Isolation of Epstein–Barr virus-infected clones of the human T-cell line MT-2: use of recombinant viruses with a positive selection marker. Journal of Virology 69, 3900-3903.[Abstract]

Griffin, B. E. (2000). Epstein–Barr virus (EBV) and human disease: facts, opinions and problems. Mutation Research 462, 395-405.[Medline]

Harabuchi, Y., Yamanaka, N., Kataura, A., Imai, S., Kinoshita, T., Mizuno, F. & Osato, T. (1990). Epstein–Barr virus in nasal T-cell lymphomas in patients with lethal midline granuloma. Lancet 335, 128-130.[Medline]

Hsu, J. L. & Glaser, S. L. (2000). Epstein–Barr virus-associated malignancies: epidemiologic patterns and etiologic implications. Critical Reviews in Oncology/Hematology 34, 27-53.[Medline]

Imai, S., Koizumi, S., Sugiura, M., Tokunaga, M., Uemura, Y., Yamamoto, N., Tanaka, S., Sato, E. & Osato, T. (1994). Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein–Barr virus latent infection protein. Proceedings of the National Academy of Sciences, USA 91, 9131-9135.[Abstract/Free Full Text]

Imai, S., Sugiura, M., Oikawa, O., Koizumi, S., Hirao, M., Kimura, H., Hayashibara, H., Terai, N., Tsutsumi, H., Oda, T., Chiba, S. & Osato, T. (1996). Epstein–Barr virus (EBV)-carrying and -expressing T-cell lines established from severe chronic active EBV infection. Blood 87, 1446-1457.[Abstract/Free Full Text]

Jones, J. F., Shurin, S., Abramowsky, C., Tubbs, R. R., Sciotto, C. G., Wahl, R., Sands, J., Gottman, D., Katz, B. Z. & Sklar, J. (1988). T-cell lymphomas containing Epstein–Barr viral DNA in patients with chronic Epstein–Barr virus infections. New England Journal of Medicine 318, 733-741.[Abstract]

Kawaguchi, H., Miyashita, T., Herbst, H., Niedobitek, G., Asada, M., Tsuchida, M., Hanada, R., Kinoshita, A., Sakurai, M., Kobayashi, N. & Mizutani, S. (1993). Epstein–Barr virus-infected T lymphocytes in Epstein–Barr virus-associated hemophagocytic syndrome. Journal of Clinical Investigation 92, 1444-1450.

Kelleher, C. A., Paterson, R. K., Dreyfus, D. H., Streib, J. E., Xu, J. W., Takase, K., Jones, J. F. & Gelfand, E. W. (1995). Epstein–Barr virus replicative gene transcription during de novo infection of human thymocytes: simultaneous early expression of BZLF-1 and its repressor RAZ. Virology 208, 685-695.[Medline]

Kikuta, H., Taguchi, Y., Tomizawa, K., Kojima, K., Kawamura, N., Ishizaka, A., Sakiyama, Y., Matsumoto, S., Imai, S., Kinoshita, T., Koizumi, S., Osato, T., Kobayashi, I., Hamada, I. & Hirai, K. (1988). Epstein–Barr virus genome-positive T lymphocytes in a boy with chronic active EBV infection associated with Kawasaki-like disease. Nature 333, 455-457.[Medline]

Kikuta, H., Nakanishi, M., Sakiyama, Y. & Matsumoto, S. (1989). Chronic active Epstein–Barr virus (EBV) infection is associated with clonotypic intracellular terminal regions of the EBV. Journal of Infectious Diseases 160, 546-547.[Medline]

Kikuta, H., Sakiyama, Y., Matsumoto, S., Hamada, I., Yazaki, M., Iwaki, T. & Nakano, M. (1993). Detection of Epstein–Barr virus DNA in cardiac and aortic tissues from chronic, active Epstein–Barr virus infection associated with Kawasaki disease-like coronary artery aneurysms. Journal of Pediatrics 123, 90-92.[Medline]

Kimura, H., Morita, M., Yabuta, Y., Kuzushima, K., Kato, K., Kojima, S., Matsuyama, T. & Morishima, T. (1999). Quantitative analysis of Epstein–Barr virus load by using a real-time PCR assay. Journal of Clinical Microbiology 37, 132-136.[Abstract/Free Full Text]

Klein, G. (1994). Epstein–Barr virus strategy in normal and neoplastic B cells. Cell 77, 791-793.[Medline]

Koizumi, S., Zhang, X.-K., Imai, S., Sugiura, M., Usui, N. & Osato, T. (1992). Infection of the HTLV-1-harboring T-lymphoblastoid line MT-2 by Epstein–Barr virus. Virology 188, 859-863.[Medline]

Maeda, A., Wakiguchi, H., Yokoyama, W., Hisakawa, H., Tomoda, T. & Kurashige, T. (1999). Persistently high Epstein-Barr virus (EBV) loads in peripheral blood lymphocytes from patients with chronic active EBV infection. Journal of Infectious Diseases 179, 1012-1015.[Medline]

Miyashita, E. M., Yang, B., Lam, K. M. C., Crawford, D. H. & Thorley-Lawson, D. A. (1995). A novel form of Epstein–Barr virus latency in normal B cells in vivo. Cell 80, 593-601.[Medline]

Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of Epstein–Barr virus persistence in vivo as a resting B cell. Journal of Virology 71, 4882-4891.[Abstract]

Niedobitek, G., Agathanggelou, A., Rowe, M., Jones, D. B., Turyaguma, P., Oryema, J., Wright, D. H. & Young, L. S. (1995). Heterogeneous expression of Epstein–Barr virus latent proteins in endemic Burkitt’s lymphoma. Blood 86, 659-665.[Abstract/Free Full Text]

Ohga, S., Kimura, N., Takada, H., Nagano, M., Ohshima, K., Nomura, A., Muraoka, K., Take, H., Yamamori, S. & Hara, T. (1999). Restricted diversification of T-cells in chronic active Epstein–Barr virus infection: potential inclination to T-lymphoproliferative disease. American Journal of Hematology 61, 26-33.[Medline]

Pallesen, G., Hamilton-Dutoit, S. J., Rowe, M. & Young, L. S. (1991). Expression of the Epstein–Barr virus latent gene products in tumor cells of Hodgkin’s disease. Lancet 337, 320-322.[Medline]

Pallesen, G., Hamilton-Dutoit, S. J. & Zhou, X. (1993). The association of Epstein–Barr virus (EBV) with T cell lymphoproliferations and Hodgkin’s disease: two new developments in the EBV field. Advances in Cancer Research 62, 179-239.[Medline]

Paterson, R. L. K., Kelleher, C. A., Streib, J. E., Amankonah, T. D., Xu, J. W., Jones, J. F. & Gelfand, E. W. (1995). Activation of human thymocytes after infection by EBV. Journal of Immunology 154, 1440-1449.[Abstract]

Rickinson, A. B. (1986). Chronic, symptomatic Epstein–Barr virus infections. Immunology Today 7, 13-14.

Rowe, M., Lear, A. L., Croom-Carter, D., Davies, A. H. & Rickinson, A. B. (1992). Three pathways of Epstein–Barr virus gene activation from EBNA1-positive latency in B lymphocytes. Journal of Virology 66, 122-131.[Abstract/Free Full Text]

Schaefer, B. C., Woisetschlaeger, M., Strominger, J. L. & Speck, S. H. (1991). Exclusive expression of Epstein–Barr virus nuclear antigen 1 in Burkitt lymphoma arises from a third promoter, distinct from the promoters used in latently infected lymphocytes. Proceedings of the National Academy of Sciences, USA 88, 6550-6554.[Abstract/Free Full Text]

Schooley, R. T., Carey, R. W., Miller, G., Henle, W., Eastman, R., Mark, E. J., Kenyon, K., Wheeler, E. O. & Rubin, R. H. (1986). Chronic Epstein–Barr virus infection associated with fever and interstitial pneumonitis: clinical and serologic features and response to antiviral chemotherapy. Annals of Internal Medicine 104, 636-643.

Su, I.-J., Hsieh, H.-C., Lin, K.-H., Uen, W.-C., Kao, C.-L., Chen, C.-J., Cheng, A.-L., Kadin, M. E. & Chen, J.-Y. (1991). Aggressive peripheral T-cell lymphomas containing Epstein–Barr viral DNA: a clinicopathologic and molecular analysis. Blood 77, 799-808.[Abstract/Free Full Text]

Su, I.-J., Chen, R.-L., Lin, D.-T., Lin, K.-S. & Chen, C.-C. (1994). Epstein–Barr virus (EBV) infects T lymphocytes in childhood EBV-associated hemophagocytic syndrome in Taiwan. American Journal of Pathology 144, 1219-1225.[Abstract]

Sugiyama, K., Ito, M., Ichimi, R., Higashikawa, M., Kawasaki, H., Komada, Y., Sakurai, M., Wakiguchi, H., Kikuta, H. & Fukayama, M. (1997). A case of Epstein–Barr virus infection with exophthalmos and ocular muscle swelling. Acta Paediatrica Japonica 39, 694-697.

Suzushima, H., Asou, N., Fujimoto, T., Nishimura, S., Okubo, H., Yamasaki, H., Osato, M., Matsuoka, M., Tsukamoto, A., Takai, K., Kawano, F. & Takatsuki, K. (1995). Lack of the expression of EBNA-2 and LMP-1 in T-cell neoplasms possessing Epstein–Barr virus. Blood 85, 480-486.[Abstract/Free Full Text]

Takada, K., Shimizu, N., Sakuma, S. & Ono, Y. (1986). Trans activation of the latent Epstein–Barr virus (EBV) genome after transfection of the EBV DNA fragment. Journal of Virology 57, 1016-1022.[Abstract/Free Full Text]

Thorley-Lawson, D. A. & Babcock, G. J. (1999). A model for persistent infection with Epstein–Barr virus: the stealth virus of human B cells. Life Sciences 65, 1433-1453.[Medline]

Thorley-Lawson, D. A., Miyashita, E. M. & Khan, G. (1996). Epstein–Barr virus and B cells: that’s all it takes. Trends in Microbiology 4, 204-208.[Medline]

Tierney, R. J., Steven, N., Young, L. S. & Rickinson, A. B. (1994). Epstein–Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. Journal of Virology 68, 7374-7385.[Abstract/Free Full Text]

Zetterberg, H., Stenglein, M., Jansson, A., Ricksten, A. & Rymo, L. (1999). Relative levels of EBNA1 gene transcripts from the C/W, F and Q promoters in Epstein–Barr virus-transformed lymphoid cells in latent and lytic stages of infection. Journal of General Virology 80, 457-465.[Abstract]

Received 18 April 2001; accepted 8 June 2001.


This article has been cited by other articles:


Home page
BloodHome page
H. Katano, M. A. Ali, A. C. Patera, M. Catalfamo, E. S. Jaffe, H. Kimura, J. K. Dale, S. E. Straus, and J. I. Cohen
Chronic active Epstein-Barr virus infection associated with mutations in perforin that impair its maturation
Blood, February 15, 2004; 103(4): 1244 - 1252.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Yoshioka, H. Kikuta, N. Ishiguro, X. Ma, and K. Kobayashi
Unique Epstein-Barr virus (EBV) latent gene expression, EBNA promoter usage and EBNA promoter methylation status in chronic active EBV infection
J. Gen. Virol., May 1, 2003; 84(5): 1133 - 1140.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshioka, M.
Right arrow Articles by Kobayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshioka, M.
Right arrow Articles by Kobayashi, K.
Agricola
Right arrow Articles by Yoshioka, M.
Right arrow Articles by Kobayashi, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS