|
|
||||||||
Animal: DNA Viruses |
Division of Life Sciences, College of Natural Sciences1 and Research Institute for Genetic Engineering2, Chungbuk National University, Cheongju, Chungbuk 361-763, South Korea
Author for correspondence: Chan Hee Lee at Division of Life Sciences, College of Natural Sciences. Fax +82 43 273 2451. e-mail chlee{at}cbucc.chungbuk.ac.kr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Major histocompatibility complex (MHC) antigen molecules are important parts of the adaptive immune response. Therefore, many viruses that establish persistent infections find a way to escape the adaptive immune response by down-regulating the expression of MHC molecules on the infected cell surface (Ploegh, 1998
; Miller & Sedmak, 1999
; Alcami & Koszinowski, 2000
). This process requires the expression of virus genes. For example, HCMV encodes several genes, including US2, US3, US6 and US11, that are responsible for the destruction or impaired transport to the cell surface of the heavy chain of human leukocyte antigen (HLA) class I, a human MHC molecule (Ahn et al., 1996
, 1997
; Hengel et al., 1996
; Jones et al., 1996
; Wiertz et al., 1996
; Jones & Sun, 1997
). The innate immune response is also compromised by HCMV infection. HCMV inhibits IFN-
-stimulated antiviral and immunoregulatory responses by blocking multiple levels of IFN-
signal transduction (Miller et al., 1999
). This process also requires HCMV gene expression. The HCMV US28 gene is implicated in the depletion of the chemokine RANTES from the infected cell culture (Bodaghi et al., 1998
).
On the other hand, in the absence of HCMV gene expression, HCMV infection results in different effects. HCMV stimulates the expression of IFN (Zhu et al., 1998
) or IFN-inducible genes (Zhu et al., 1997
; Navarro et al., 1998
; Boyle et al., 1999
) and RANTES production is positively modulated (Michelson et al., 1997
). All of these innate immune responses do not require HCMV gene expression and can be mediated by inactivated viruses and, in some cases, dense bodies (DBs) (Pepperl et al., 2000
) or purified virion envelope glycoprotein B (gB) (Boyle et al., 1999
). Inactivated HCMV stimulates the induction of IFN-responsive genes (Zhu et al., 1997
). In these situations, virus particles are recognized by the host cell as foreign antigens. Thus, before the onset of virus gene expression, HCMV can induce a variety of cellular responses by physically interacting with the host cell.
In this study, we hypothesized that HCMV particles may affect the expression of HLA class I on the infected cell surface by binding to surface receptors and/or entering the host cell. We found (i) that UV-inactivated HCMV (UV-HCMV) stimulated the expression of HLA class I and (ii) that the physical interaction between HCMV envelope glycoprotein gB and heparan sulfate proteoglycans (HSPGs) was involved in HLA class I expression.
| Methods |
|---|
|
|
|---|
Cells and virus.
Inactivation of virus.
Heat-inactivation of HCMV was carried out by incubating the HCMV stock preparation at 56 °C for 30 min. UV-HCMV was prepared by irradiating HCMV with UV at a dose of 2 J/cm2. HCMV inactivated either by heat or by UV, as described above, completely lost infectivity. Serum-neutralization of HCMV was carried out by incubating HCMV for 30 min at 37 °C with an equal volume of pooled serum obtained from individuals who were HCMV sero-positive.
Reagents.
Heparin, heparinase I and sodium chlorate were purchased from Sigma. Monoclonal antibodies (MAbs) reactive with HCMV pp72, pp65 or gB were obtained from Virogen. MAb W6/32, which is reactive with the common region of classical HLA class I (A, B and C) antigens, was obtained from Serotek.
Indirect immunofluorescence assay.
HFF cells cultured on cover slips were infected or mock-infected with HCMV (infectious or inactivated). At appropriate times after virus infection, cells were fixed with absolute methanol at -20 °C for 10 min. After rehydration in ice-cold Trissaline for 5 min, cells were incubated with mouse MAbs at 37 °C for 1 h in a humidified chamber. Cells were then washed three times with Trissaline and incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G (IgG) for 45 min. Cover slips were mounted on glass slides and examined under a fluorescence microscope (BX50F-3, Olympus Opticals) with an FITC filter. Samples were photographed using a confocal microscope (MRC1024, Bio-Rad Laboratories).
Flow cytometry.
Cells were harvested by trypsinization and washed with PBS. The number of viable cells was determined using the trypan blue exclusion assay and 105 cells were transferred to a microcentrifuge tube. Cells were collected by centrifuging at 700 r.p.m. for 3 min and resuspending in 90 µl of PBS. Cells were then reacted with 10 µl of FITC-conjugated anti-HLA class I antibody (MAb W6/32) for 30 min at room temperature. Cells were washed with 1 ml of PBS and collected by centrifuging at 700 r.p.m. for 3 min. After resuspending the pellet in 200 µl of PBS, 104 cells were analysed by flow cytometry (FACS Calibur-S, Becton-Dickinson).
RTPCR.
Total cellular RNA was extracted from 106 HFF cells (mock-, HCMV- or UV-HCMV-infected) using the RNeasy RNA Extraction kit (Qiagen), according to the manufactures protocol. The amount of extracted RNA was measured and cDNA was synthesized from 2 µg of extracted RNA using the Omniscript Reverse Transcription kit (Qiagen). Briefly, the reaction mixture containing 0·5 mM of each dNTP, 1 µM oligo(dT) primer, 20 U RNase inhibitor, 4 U Omniscript reverse transcriptase (RT) and 2 µg of sample RNA in 20 µl RT buffer was incubated at 37 °C for 60 min. The RT was inactivated by incubating at 93 °C for 5 min and cooling on ice for 10 min. PCR was performed in 50 µl Taq buffer (10 mM TrisHCl, pH 8·3, 50 mM KCl and 2 mM MgCl2) containing 1·5 µl of template cDNA, as prepared above, 0·3 µM of the HLA class I primer pair (forward, 5 GATTCTCCCCAGACGCCGAG, and reverse, 5 CTGCCAGGTCAGTGTCATCT), 0·2 mM of each dNTP and 5 U Taq polymerase, based on the method described by Johnson et al. (2000)
. The reaction was incubated in a Primus96 Plus thermocycler (MWG Biotech) using the hot-start method of 1 cycle at 94 °C for 1·5 min, followed by 28 cycles at 60 °C for 30 s, 72 °C for 1 min and 94 °C for 30 s and then 1 cycle at 72 °C for 10 min. PCR products were analysed by 1% agarose gel electrophoresis. Gels were stained with ethidium bromide, visualized by a short-wave UV trans-illuminator and photographed.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Contact of HCMV particles with host cells has been reported to induce immediate-early cellular responses (Fortunato et al., 2000b
). These include the rapid influx of calcium from the extracellular medium into the cell and transcription of proto-oncogenes, such as c-fos, c-jun and c-myc (Albrecht et al., 1991
). Generation of reactive oxygen intermediates is stimulated by the physical contact of HCMV particles, which leads to the activation of transcription factor NF-
B (Speir et al., 1996
). All these immediate-early cellular responses appear to be a prerequisite for HCMV replication, since increased calcium and activation of NF-
B are thought to stimulate HCMV immediate-early gene expression (Kang et al., 1993
; Speir et al., 1996
). Recently, chromosome 1q42 breakage (Fortunato et al., 2000a
), expression of IFN-inducible genes (Navarro et al., 1998
; Boyle et al., 1999
) and induction of the chemokine RANTES (Michelson et al., 1997
) were reported to result from HCMV infection. Each of these cellular responses does not require HCMV gene expression and can be mediated by inactivated virus or purified virion gB (Boyle et al., 1999
). Interestingly, although the initial physical contact with HCMV particles stimulates several IFN-inducible genes as the infection progresses, virus gene expression results in the suppression of IFN signalling (Miller et al., 1999
). While the induction of RANTES requires only virus contact with cells, the depletion of RANTES requires HCMV US28 gene expression (Bodaghi et al., 1998
). Therefore, some of the immediate-early cellular responses that do not require virus gene expression but need physical contact with virus particles are counteracted by subsequent virus gene expression. Our study adds another line to a growing list of immediate-early cellular responses to HCMV infection that do not require virus gene expression.
The physical interaction between HCMV particles and the cell surface appears to require at least two components: viral envelope glycoproteins and HSPGs on the surface of infected cells. It has been known for some time that HSPGs are involved, although maybe not exclusively, in the binding of HCMV during the initial phase of the virus replication cycle (Neyts et al., 1992
; Compton et al., 1993
). Therefore, we tested the possibility that, upon interaction with UV-HCMV, HSPGs stimulate HLA class I expression. Treatment of UV-HCMV-infected HFF cells with heparin or preincubation of HFF cells with heparinase I blocked the stimulation of cell surface HLA class I presentation by UV-HCMV in a dose-dependent manner. Inhibition of HSPG biosynthesis by sodium chlorate, which affects the sulfation step in the biosynthesis of the HSPGs (Keller et al., 1989
), also diminished the effect of UV-HCMV on HLA class I expression. Accordingly, intact and natural forms of HSPGs seem to be involved in the pathway leading to the stimulation of HLA class I by interaction with HCMV particles. Although HCMV binding to the cell surface HSPGs is the initial interaction between the virus and the host cell, HSPGs alone are believed to be insufficient (Pietropaolo & Compton, 1997
). Several cellular proteins on the cell surface, such as the 92.5 kDa phosphoprotein, CD13 or annexin II, would function downstream of the HSPGvirus interaction (Keay et al., 1989
; Soderberg et al., 1993
; Wright et al., 1994
). It is possible that components on the cell surface other than HSPGs may be involved in the stimulation of HLA class I expression by UV-HCMV.
The virion components for initial binding to HSPGs have been characterized to be gB and/or glycoprotein complex II (gC-II), which are present on the envelope of the virus (Kari & Gehrz, 1992
; Compton et al., 1993
; Boyle & Compton, 1998
). Treatment of virus with trypsin degrades the protein moiety of the envelope glycoproteins and we found that brief treatment of UV-HCMV with trypsin reduced the HLA class I-enhancing activity of UV-HCMV in a concentration-dependent manner. Furthermore, MAb anti-gB blocked the effect of UV-HCMV on HLA class I expression. Therefore, the molecules involved in an interaction with HSPGs on HFF cells appear to include envelope glycoproteins such as gB. If HSPGs are not the sole molecules involved in the stimulation of HLA class I expression by UV-HCMV, as suggested above, it is worthwhile to note that an undefined non-heparin component in the absence of HSPGs could be bound to gB (Boyle & Compton, 1998
). It is not clear whether HCMV gB is the sole glycoprotein involved in the stimulation of HLA class I expression on HFF cells by HCMV. Further studies are needed to identify all of the viral and cellular components that are required for the physical interaction of HCMV and HFF cells leading to the increase in cell surface HLA class I expression.
It has been taken for granted or customary to say that certain effects are due to virus binding to cellular receptors if the effects are observed with inactivated viruses, DBs or non-infectious enveloped viruses (NIEPs), or if the effects are inhibited by blocking the interaction of the virus with cellular receptors. For example, Yurochko & Huang (1999)
proposed that the expression of immunoregulatory genes, such as interleukin-1
, is induced by HCMV binding to human monocytes, since this stimulation was blocked by treatment with neutralizing anti-gB or anti-gH antibodies. However, inactivated viruses, such as UV-HCMV, or DBs can enter the host cell in a manner similar to normal infectious virus (Pepperl et al., 2000
). The presence of virion components in the cells infected with UV-HCMV, NIEPs or DBs may raise the possible role of virion components in the stimulation of HLA class I gene expression or other initial signal transduction cascades induced by HCMV (Fortunato et al., 2000b
). This possibility can be supported further by the reports that suggest that certain virion components, such as the tegument protein pp71 (Homer et al., 1999
; Bresnahan & Shenk, 2000
) or the lower matrix protein pp65 (Gallina et al., 1999
), can modulate the functions of heterologous genes. Thus, the stimulation of HLA class I expression could result from, at least in part, the virion components present inside the host cell. Further studies are needed to elucidate the relative role of virus binding (interaction between envelope glycoproteins such as gB and HSPGs) and entry in stimulating the expression of HLA class I molecules. Whatever the mechanism is, it is clear that the stimulation of HLA class I expression does not require HCMV gene expression.
What is the significance of the stimulation of cell surface HLA class I expression on HCMV-infected cells? Viruses, although regarded as living with active genetic entities once inside the host cell, are seen at first sight as foreign antigens. Binding of virus particles to cellular receptor molecules such as HSPGs may serve as a signal for the host cell to recognize the infecting virus. Host cells naturally respond to infecting viruses by activating defence mechanisms, such as the stimulation of IFN-inducible genes (Navarro et al., 1998
; Boyle et al., 1999
; Zhu et al., 1998
) or enhancing the expression of HLA class I molecules, as suggested in this study. Furthermore, HCMV-infected cells secrete soluble factors, including IFN-
, into the extracellular medium before dying from the virus infection (Lee et al., 2001
). Host cells are now equipped with antiviral defence systems, which provides additional meaning for the development and application of a HCMV vaccine. An attenuated, live vaccine has been studied extensively and an improved strain may result from genetic manipulation. An immunogenic subunit vaccine, such as the HCMV gB vaccine, is currently undergoing clinical trials to determine if the antibodies alone will be protective (Plotkin, 1999
). Although inactivated or subunit vaccines would be expected to be less effective than live, attenuated vaccines in stimulating specific immune responses, they are expected, as our data suggests, to augment the immune response by stimulating the expression of HLA class I. Further studies are merited to elucidate the components and mechanisms necessary for the stimulation of HLA class I expression by the interaction of HCMV with cell surface HSPGs as well as to understand the clinical importance of HCMV in the defence against virus infection.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ahn, K., Gruhler, A., Galocha, B., Jones, T. R., Wiertz, E. J., Ploegh, H. L., Peterson, P. A., Yang, Y. & Fruh, K. (1997). The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptide translocation by TAP. Immunity 6, 613-621.[Medline]
Albrecht, T., Fons, M. P., Boldogh, I., AbuBakar, S., Deng, C. Z. & Millinoff, D. (1991). Metabolic and cellular effects of human cytomegalovirus infection. Transplantation Proceedings 23, 48-54.
Alcami, A. & Koszinowski, U. H. (2000). Viral mechanisms of immune evasion. Trends in Microbiology 9, 410-418.
Bodaghi, B., Jones, T. R., Zipeto, D., Vita, C., Sun, L., Laurent, L., Arenzana-Seisdedos, F., Virelizier, J. L. & Michelson, S. (1998). Chemokine sequestration by viral chemoreceptors as a novel viral escape strategy: withdrawal of chemokines from the environment of cytomegalovirus-infected cells. Journal of Experimental Medicine 188, 855-866.
Boyle, K. A. & Compton, T. (1998). Receptor-binding properties of a soluble form of human cytomegalovirus glycoprotein B. Journal of Virology 72, 1826-1833.
Boyle, K. A., Pietropaolo, R. L. & Compton, T. (1999). Engagement of the cellular receptor for glycoprotein B of human cytomegalovirus activates the interferon-responsive pathway. Molecular and Cellular Biology 19, 3607-3613.
Bresnahan, W. A. & Shenk, T. E. (2000). UL82 virion protein activates expression of immediate early viral genes in human cytomegalovirus-infected cells. Proceedings of the National Academy of Sciences, USA 97, 14506-14511.
Britt, W. J. & Alford, C. A. (1996). Cytomegalovirus. In Virology , pp. 2493-2593. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Compton, T., Nowlin, D. M. & Cooper, N. R. (1993). Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virology 193, 834-841.[Medline]
Fortunato, E. A., DellAquila, M. L. & Spector, D. H. (2000a). Specific chromosome 1 breaks induced by human cytomegalovirus. Proceedings of the National Academy of Sciences, USA 97, 853-858.
Fortunato, E. A., McElroy, A. K., Sanchez, I. & Spector, D. H. (2000b). Exploitation of cellular signaling and regulatory pathways by human cytomegalovirus. Trends in Microbiology 8, 111-119.[Medline]
Gallina, A., Simoncini, L., Garbelli, S., Percivalle, E., Pedrali-Noy, G., Lee, K. S., Erikson, R. L., Plachter, B., Gerna, G. & Milanesi, G. (1999). Polo-like kinase 1 as a target for human cytomegalovirus pp65 lower matrix protein. Journal of Virology 73, 1468-1478.
Hengel, H., Flohr, T., Hämmerling, G. J., Koszinowski, U. H. & Momburg, F. (1996). Human cytomegalovirus inhibits peptide translocation into the endoplasmic reticulum for MHC class I assembly. Journal of General Virology 77, 2287-2296.
Hengel, H., Brune, W. & Koszinowski, U. H. (1998). Immune evasion by cytomegalovirus: survival strategies of a highly adapted opportunist. Trends in Microbiology 6, 190-197.[Medline]
Homer, E. G., Rinaldi, A., Nicholl, M. J. & Preston, C. M. (1999). Activation of herpesvirus gene expression by the human cytomegalovirus protein pp71. Journal of Virology 73, 8512-8518.
Johnson, D. R., Biedermann, B. C. & Mook-Kanamori, B. (2000). Rpaid cloning of HLA class I cDNA by locus-specific PCR. Journal of Immunological Methods 233, 119-129.[Medline]
Jones, T. R. & Sun, L. (1997). Human cytomegalovirus US2 destabilizes major histocompatibility complex class I heavy chains. Journal of Virology 71, 2970-2979.[Abstract]
Jones, T. R., Wiertz, E. J., Sun, L., Fish, K. N., Nelson, J. A. & Ploegh, H. L. (1996). Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains. Proceedings of the National Academy of Sciences, USA 15, 11327-11333.
Kang, K. H., Yoo, C. H. & Lee, C. H. (1993). Increased cytosolic free calcium concentration following HCMV infection of human embryo lung cells. Molecules and Cells 3, 319-325.
Kari, B. & Gehrz, R. (1992). A cytomegalovirus glycoprotein complex designated gC-II is a major heparin-binding component of the envelope. Journal of Virology 66, 1761-1764.
Keay, S., Merigan, T. C. & Rasmussen, L. (1989). Identification of cell surface receptors for the 86-kilodalton glycoprotein of human cytomegalovirus. Proceedings of the National Academy of Sciences, USA 86, 10100-10103.
Keller, K. M., Brauer, P. R. & Keller, J. M. (1989). Modulation of cell surface heparan sulfate structure by growth of cells in the presence of chlorate. Biochemistry 28, 8100-8107.[Medline]
Lee, G. C., Song, B. H. & Lee, C. H. (2001). Increase in the expression of human leukocyte antigen class I in human fibroblasts by soluble factors secreted from human cytomegalovirus-infected cells. Molecules and Cells 11, 392-398.[Medline]
Michelson, S., Dal Monte, P., Zipeto, D., Bodaghi, B., Laurent, L., Oberlin, E., Arenzana-Seisdedos, F., Virelizier, J. L. & Landini, M. P. (1997). Modulation of RANTES production by human cytomegalovirus infection of fibroblasts. Journal of Virology 71, 6495-6500.[Abstract]
Miller, D. M. & Sedmak, D. D. (1999). Viral effects on antigen processing. Current Opinion in Immunology 11, 94-99.[Medline]
Miller, D. M., Zhang, Y., Rahill, B. M., Waldman, W. J. & Sedmak, D. D. (1999). Human cytomegalovirus inhibits IFN-
-stimulated antiviral and immunoregulatory responses by blocking multiple levels of IFN-
signal transduction. Journal of Immunology 162, 6107-6113.
Navarro, L., Mowen, K., Rodems, S., Weaver, B., Reich, N., Spector, D. & David, M. (1998). Cytomegalovirus activates interferon immediate-early response gene expression and an interferon regulatory factor 3-containing interferon-stimulated response element-binding complex. Molecular and Cellular Biology 18, 3796-3802.
Neyts, S., Snoeck, R., Schols, D., Balzarini, J., Esko, J. D., Van Schepdael, A. & De Clercq, E. (1992). Sulfated polymers inhibit the interaction of human cytomegalovirus with cell surface heparan sulfate. Virology 189, 48-58.[Medline]
Pepperl, S., Munster, J., Mach, M., Harris, J. R. & Plachter, B. (2000). Dense bodies of human cytomegalovirus induce both humoral and cellular immune responses in the absence of viral gene expression. Journal of Virology 74, 6132-6146.
Pietropaolo, R. L. & Compton, T. (1997). Direct interaction between human cytomegalovirus glycoprotein B and cellular annexin II. Journal of Virology 71, 9803-9807.[Abstract]
Ploegh, H. L. (1998). Viral strategies of immune evasion. Science 280, 248-253.
Plotkin, A. A. (1999). Cytomegalovirus vaccine. American Heart Journal 138, S484-S487.[Medline]
Soderberg, C., Giugni, T. D., Zaia, J. A., Larsson, S., Wahlberg, J. M. & Moller, E. (1993). CD13 (human amniopeptidase N) mediates human cytomegalovirus infection. Journal of Virology 67, 6576-6585.
Speir, E., Shibutani, T., Yu, Z. X., Ferrans, V. & Epstein, S. E. (1996). Role of reactive oxygen intermediates in cytomegalovirus gene expression and in the response of human smooth muscle cells to viral infection. Circulation Research 79, 1143-1152.
Wiertz, E., Jones, T. R., Sun, L., Bogyo, M., Geuze, H. J. & Ploegh, H. L. (1996). The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol. Cell 84, 769-779.[Medline]
Wiertz, E., Hill, A., Tortorella, D. & Ploegh, H. (1997). Cytomegaloviruses use multiple mechanisms to elude the host immune response. Immunology Letters 57, 213-216.[Medline]
Wright, J. F., Kuroski, A. & Wasi, S. (1994). An endothelial cell-surface form of annexin II binds human cytomegalovirus. Biochemical and Biophysical Research Communications 198, 983-989.[Medline]
Yurochko, A. D. & Huang, E. S. (1999). Human cytomegalovirus binding to human monocytes induces immunoregulatory gene expression. Journal of Immunology 162, 4806-4816.
Zhu, H., Cong, J. P. & Shenk, T. (1997). Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs. Proceedings of the National Academy of Sciences, USA 94, 13985-13990.
Zhu, H., Cong, J. P., Mamtora, G., Gingeras, T. & Shenk, T. (1998). Cellular gene expression altered by human cytomegalovirus: global monitoring with oligonucleotide arrays. Proceedings of the National Academy of Sciences, USA 95, 14470-14475.
Received 2 April 2001;
accepted 6 July 2001.
This article has been cited by other articles:
![]() |
H. F. Vischer, J. C. M. Granneman, and J. Bogerd Identification of Follicle-Stimulating Hormone-Selective {beta}-Strands in the N-Terminal Hormone-Binding Exodomain of Human Gonadotropin Receptors Mol. Endocrinol., August 1, 2006; 20(8): 1880 - 1893. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jenssen, P. Hamill, and R. E. W. Hancock Peptide Antimicrobial Agents Clin. Microbiol. Rev., July 1, 2006; 19(3): 491 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Jones, C. Petrow-Sadowski, D. C. Bertolette, Y. Huang, and F. W. Ruscetti Heparan Sulfate Proteoglycans Mediate Attachment and Entry of Human T-Cell Leukemia Virus Type 1 Virions into CD4+ T Cells J. Virol., October 15, 2005; 79(20): 12692 - 12702. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pollara, M. Jones, M. E. Handley, M. Rajpopat, A. Kwan, R. S. Coffin, G. Foster, B. Chain, and D. R. Katz Herpes Simplex Virus Type-1-Induced Activation of Myeloid Dendritic Cells: The Roles of Virus Cell Interaction and Paracrine Type I IFN Secretion J. Immunol., September 15, 2004; 173(6): 4108 - 4119. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |