|
|
||||||||
Animal: RNA Viruses |
Centro Nacional de Biología Fundamental, Instituto de Salud Carlos III, Majadahonda, Madrid 28220, Spain1
Centro de Salud Sandoval, Comunidad Autónoma de Madrid, Madrid 28010, Spain2
Author for correspondence: Cecilio López-Galíndez. Fax +34 91 509 7918. e-mail clopez{at}isciii.es
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The error-prone replication system of HIV-1, the presence of two genomes in the virion, which favours recombination (Jetzt et al., 2000
), the high virus turnover and elevated population size result in the presence of multiple variants within patients, described as virus quasispecies (Eigen & Biebricher, 1988
; Meyerhans et al., 1989
). There are reports of the existence of distinct variants within infected patients, especially in different compartments of the body (Ball et al., 1994
; Delwart et al., 1998
; Korber et al., 1994
; Wong et al., 1997
; Zhu et al., 1996
), but even in the same organ (Cheynier et al., 1994
; Delassus et al., 1992
). Variants within infected patients can belong to the same subtype (Sala et al., 1995
) but also to distinct subtypes, as shown by the existence of multiple intersubtype recombinants (Sabino et al., 1994
) or intergroup M/O recombinants (Takehisa et al., 1999
).
The evolution of HIV-1 quasispecies within patients has been explored in several studies that have analysed the degree of genetic variation of HIV-1 in relation to disease progression (Bagnarelli et al., 1999
; Delwart et al., 1997
; Ganeshan et al., 1997
; McDonald et al., 1997
; Salvatori et al., 1997
; Shankarappa et al., 1998
, 1999
; Shioda et al., 1997
). However, discordant results were obtained when the contribution of selective pressures, as measured by the Ka/Ks ratio, to virus evolution was studied in relation to disease progression. The only repeated finding was a positive correlation between progression to AIDS and a homogenization in virus quasispecies (Ganeshan et al., 1997
; Liu et al., 1997
; McDonald et al., 1997
; Shioda et al., 1997
; Wolinsky et al., 1996
; Yamaguchi & Gojobori, 1997
; Zhang et al., 1993
). Recently, a general pattern of divergence (considered as the evolution from an initial founder strain) and diversity (the breath of the virus population at a given time-point) has been described (Shankarappa et al., 1999
).
The evolution time of HIV-1 infection has permitted the classification of patients into slow, typical or rapid progressors. In this study, we have analysed virus genomes from a group of 46 patients with typical patterns of clinical evolution. From these patients, six individuals were selected on the basis of virus genetic variability and they were submitted to quasispecies analysis from two to three samples obtained over 1 to 4 years. The patterns of virus evolution obtained were not the same in all the patients selected, pointing to the existence of different virus and host factors contributing to the evolution of HIV-1 quasispecies in vivo.
| Methods |
|---|
|
|
|---|
Patients.
|
Clinical samples and separation of viral nucleic acids.
Quantification of plasma viraemia.
The HIV-1 RNA copy number in plasma was quantified with the Amplicor HIV Monitor test kit following the manufacturers protocols (Roche Diagnostic Systems) (Mulder et al., 1994
).
PCR amplification, cloning and sequencing.
Three initial amounts of proviral DNA, 0·1, 1 and 5 µg, were amplified in a nested PCR. In order to avoid bottlenecking, the DNA concentration used in the study was the second dilution that gave a positive band in the gel. The first amplification covered almost the complete gp160 and, in a second amplification, the C2-fusion peptide region was obtained. The sequences of primers 60EU, 50EBND and 27EU have been described previously (Casado et al., 2000a
, b
). The sequence of primer 22ED is 5' 8228AATTCCACAAACTTGCCCATTT8207 3'; numbers correspond to positions in the NL4-3 genome (GenBank accession number M19921). The first-round primers, 60EU and 50EBND, were used with the following cycling conditions: 94 °C for 5 min; 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min; and a final incubation at 72 °C for 10 min. In the second-round PCR, 2 µl of the first-round products was amplified in fresh reaction buffer plus primers 27EU and 22ED with the same cycling conditions, except that the length of the elongation step at 72 °C was 1 min. Titan RTPCR (Promega) was used to amplify RNA samples. In this method, cDNA synthesis as well as the first-round PCR were performed in one step, without the requirement for the addition of reagents between cDNA synthesis and first-round PCR. Primers and cycling conditions were the same as in nested PCR for PBMC samples, with the addition of a preliminary step of 30 min at 50 °C in the first PCR. PCR products were cloned into a TA vector (Invitrogen) and 15 to 20 clones per clinical sample (clones derived from proviral DNA or genomic RNA) were sequenced directly with primers 27EU and 96ED (5' 7852AGACAATAATTGTCTGGCCTGTACCGT7826 3'), spanning a region that includes part of the C2 conserved region, the V3, V4 and V5 hypervariable regions, the CD4+-binding domain and the gp120gp41 cleavage domain. A physical separation of the different amplification steps was established to avoid cross-contamination, but replicate control amplifications with no template were also included in every PCR experiment to test carry-over contamination. DNA sequencing was performed by using the ABI PRISM Dye Terminator cycle sequencing ready reaction kit (Perkin-Elmer) according to the manufacturers instructions. Sequencing reactions were resolved by electrophoresis on a 5% polyacrylamide gel in an ABI PRISM 377 automated sequencer (Perkin-Elmer).
Heteroduplex mobility assay (HMA).
The first sample from each patient was analysed by HMA by using the second-round PCR products obtained. The PCR was then adjusted to 0·1 M NaCl, 10 mM TrisHCl, pH 7·8, and 2 mM EDTA, using a 10x DNA-annealing solution stock. Heteroduplex formation was maximized by denaturing 9 µl PCR products at 94 °C for 2 min and rapid cooling in wet ice. Heteroduplexes were then resolved in a 5% polyacrylamide gel in TBE at 200 V for 5 h (Delwart et al., 1993
). Gels were stained with ethidium bromide, illuminated with UV and photographed.
Phylogenetic analysis of sequences.
Sequence editing and assembling were performed using the program CHROMAS 1.45 (C. McCarthy, Griffith University, Southport, Australia). All alignments of nucleotide sequences were performed with CLUSTAL W (Thompson et al., 1994
) and later edited manually. All positions with an alignment gap in at least one sequence were excluded from pairwise comparisons. Phylogenetic reconstructions were generated by using the program packages PHYLIP (Felsenstein, 1993
) and MEGA (Kumar et al., 1993
). Pairwise evolutionary nucleotide distances were estimated with Kimuras two-parameter model with a transition/transversion ratio of 2. Phylogenetic trees were constructed from the same distance matrices with the neighbour-joining algorithm; robustness of the trees was evaluated by bootstrap analysis on 1000 replicas. Phylogenetic trees were edited using TreeView version 1.5 (Page, 1996
). Intrasample (heterogeneity) and intersample (divergence) sequence variations were respectively expressed as the mean distance for all pairwise comparisons between sequences within a sample or from two different samples. Rates of synonymous nucleotide substitutions per synonymous site (Ks) and non-synonymous substitutions per non-synonymous site (Ka) were estimated by the method of Nei & Gojobori (1986)
as implemented in the MEGA program.
First, a phylogenetic identification of the viruses infecting each patient was carried out. For this analysis, several clones of the virus quasispecies of each individual patient were selected, as well as a sequence of virus MN for use as an outgroup. Phylogenetic trees were established by the neighbour-joining method as well as the maximum-parsimony and maximum-likelihood methods with similar branching patterns, as implemented in the PHYLIP package. The statistical value of the tree was evaluated by bootstrap analysis of 1000 replicas as described in the previous paragraph. The analysis showed that all isolates formed independent clades in the tree, supported by highly statistically significant bootstrap values (>95%; data not shown), confirming the lack of cross-contamination. Five of the six viruses formed a group of sequences that included the MN sequence, identifying the set as subtype B. Virus I16 displayed a large genetic distance from this group, as expected for a subtype F virus (Casado et al., 2000a
).
Recombination analysis.
Recombination analysis was performed with the SimPlot program (Ray, 1999
). Briefly, this program calculates and plots the percentage identity of the query sequence to a panel of reference sequences in a sliding window, which is moved along the alignment in steps. A 140-nucleotide window and a step size of 20 nucleotides were used. This program identified informative sites and possible recombination breakpoints in the alignments. These breakpoints divided the alignment into segments, which were submitted to phylogenetic tree constructions as described above.
Statistical analysis.
All of the statistical analyses were performed with Graph Pad PRISM version 2.01. The unpaired t-test was used to compare group means.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
Recombination analysis
Taking advantage of the existence of different clades with high bootstrap values in the quasispecies of patients I01, IH03 and H16 (see Fig. 3
), we analysed the contribution of genetic recombination to the evolution of virus quasispecies. The study was performed with the help of the SimPlot program, as indicated in Methods. For this study, we selected separated sequences from patients IH01, IH03 and H16, which are circled in Fig. 3
. For example, in isolate H16, the two populations found in the 1993 sample were named A and B, and those obtained in 1994 were designated C and D. We carried out SimPlot analysis of the sequences of groups C and D against sequences from groups A and B. One outgroup sequence from another isolate was used in the analysis and the results obtained with clade D are shown in Fig. 4
. The sequence of group D showed more similarity to sequence A at the 5' end, whereas it was closer to sequence B in the middle part of the sequence. Finally, at the 3' end, all clades were homologous (Fig. 4a
). Fig. 4(b)
shows a bootscan analysis, allowing the identification of a recombination break-point at position 250 in relation to the 5' end of the fragment. Sequences were separated according to these fragments and were analysed by neighbour-joining (Fig. 4c
, d
). The sequence of set D clustered with sequence A in 89% of the trees in the 5' region and clustered together with sequence B in the 3' region in 91% of the trees. The 210 nucleotides at the 3' end of the 660 nucleotide fragment were very similar between the A and B groups of sequences. The genetic distance between population D and the two parental populations, A and B, was lower than the distance between populations A and B. Similar analysis with sequences from clade C did not reveal any recombination event in those virus subpopulations (data not shown). Similarly, recombination events were detected in patients IH03 and I01. However, in these patients, only individual recombinant sequences were detected (boxed in Fig. 3
), like sequence 16 from 1994 in patient IH03, which was a recombinant between sequences A and B with a breaking point at position 483 (data not shown). Sequence 15 from 1993 in patient I01 was a recombinant between population A and B and the breaking point is at position 180 (data not shown). In patients I09, IH07 and I16, we could not perform the recombination analysis as it was impossible to identify statistically independent groups of sequences within the virus quasispecies.
Comparison of sequences of virus RNA (vRNA) from sera and provirus DNA
In order to analyse further the evolution of the virus quasispecies within patients, vRNA was studied at different time-points for two of the infected individuals, H16 and I09, as explained in Methods (Fig. 5
). In patient I09, proviral sequences from 1993 clones 17 and 28 were intermingled among numerous 1993 vRNA sequences, indicating active replication of this provirus population. These 1993 vRNA sequences resulted in provirus forms found in the 1996 samples. vRNA population C of the 1996 sample was very interesting, because it confirmed that replicating populations were phylogenetically close to the future provirus DNA, such as sequences 13, 20 and 05 from 1997. The same could be applied to vRNA sequences in branch B, which was rooted between sequences from 1993, 1996 and 1997.
|
| Discussion |
|---|
|
|
|---|
In contrast, the other tree topology could be characterized by the presence of only one clade of virus sequences. Sequences were not separated by years and, moreover, a temporal relationship could be established between sequences from one year and sequences from subsequent years (see patients I09, IH07 and I16 in Fig. 3
). In these patients, a few clades showed high bootstrap values. However, these clades correspond to non-syncytial (NSI) and syncytial (Sl) virus populations like the ones identified in patients IH07 and I09 (see later and Fig. 3
).
The differences in the evolutionary characteristics found within the group of patients analysed could be attributed to a sampling problem, because two samples were analysed in the first patients and three in the last ones (see Methods and Table 1
). However, the individual analysis of each of the 15 different quasispecies studied (as shown in Fig. 2
) revealed the same tree topology in the sample corresponding to a single year as in the tree constructed with all the samples of the patient, with the exception of the 1993 sample of patient I16 and the 1997 sample of patient I09.
The divergence and heterogeneity values obtained from patients I09, I16 and IH07 could be associated with the consistent pattern described by Shankarappa et al. (1999)
, particularly in patients IH07 and I09, where we also detected the existence of the NSI to SI switch that precedes a decrease in virus heterogeneity. The pattern observed in patients I01, IH03 and H16 was different from this model. The detection of this different model could be related to the criteria used in our study for the selection of the patients based on the pattern of genetic variability of the virus.
Several points deserve attention regarding the recombination analysis carried out in patients H16, IH03 and I01. One relates to the evolutionary potential of this mechanism. In patient H16, the appearance of recombinant variants has resulted in a reduction of the heterogeneity of the quasispecies and, from a phylogenetic point of view, this recombinant variant was filling the evolutionary space between the two initial viruses (Lukashov & Goudsmit, 1997
). In this patient, recombination has produced a new variant that displays an evolutionary jump larger than evolution mediated by point mutation (Chao, 1994
; Domingo & Holland, 1994
; Lai, 1992
). The contribution of the recombinant forms to the overall evolution was limited, either because they do not replicate (for example, proviral population D in H16) or because they represent minor variants within the RNA or DNA quasispecies (see patients I01 and IH03). Only RNA subpopulation F of the 1993 sample in H16 did replicate. These results could reflect the lower fitness of recombinant forms in relation to their parental strains.
We have detected episodes of hypermutation in the virus quasispecies, as described previously (Meyerhans et al., 1994
; Vartanian et al., 1994
). These sequences are the result of sporadic events, but these hypermutated genomes could also contribute to the generation of new variants, such as genomes 10 and 17 of the 1994 sample in patient IH03, which could be the origin of sequence 09, possibly through genetic recombination (Fig. 3
). In this case, recombination could result in the rescue of deleterious mutations present in one of the two virion genomes by incorporating information from the intact template, resulting in genetic diversification but also acting as a repair mechanism (Jetzt et al., 2000
).
In order to explore the existence of clinical implications of the HIV-1 evolution observed in the patients, different clinical parameters were evaluated: the numbers of CD4+ and CD8+ cells as well as the CD4+/CD8+ ratio, virus load, antiretroviral treatment and clinical status. The results are shown in Table 1
; there were no differences between patients in the numbers of CD4+ and CD8+ cells or the ratio. Neither were there clear differences in pathogenesis or treatment between the patients displaying different evolutionary patterns. Of the first three patients, one was progressing to disease and was put on antiviral therapy (patient I01) and another was evolving to clinical manifestation (patient H16). Of the last three patients, two patients were progressing to AIDS (I09 and IH07) and one of them undertook therapy. In these two patients, two populations were detected in the intermediate samples that displayed sequences associated with different phenotypes (NSI and SI). In the last samples of the two patients, the SI sequences were predominant, confirming the phenotypic switch (see Fig. 3
). The two NSI and SI clades were separated by high bootstrap values in the phylogenetic trees.
A positive correlation was found in two other parameters, however. One was the time from HIV-1 seroconversion and the other the virus RNA load. In patients I01, IH03 and H16, the time between infection and sampling was longer than in patients I16, IH07 and I09. In general, the time from infection was not very precise because of the lack of seroconversion dates for some patients. For the probable infection date, we have adopted the median between the beginning of risk practices and the first serological confirmation of infection. For example, patient H16 began to have frequent unprotected sex in 1982, and the first positive serology was obtained in 1991, so we took 1986 as the probable infection date. With this criterion, the mean time since infection was 11·4 years for the first three patients and 5·2 for the last three. Virus load was also different between the groups. For the first three patients shown in Table 1
, a mean of 12933 viral RNA copies per ml was calculated, in contrast with the value of 136422 copies per ml for the second group. The mean for the first three patients is more than 10-fold lower than that for the last three individuals, although this difference is not statistically meaningful because of the wide dispersion of the data. The differences found in the pattern of virus evolution could be attributed to the size of the virus populations existing in the patients, because small virus populations tend to promote variation, as shown in vitro by Sánchez-Palomino et al. (1993)
. However, samples from patients with the same virus load, like sample 1993 of patient H16 and sample 1996 of patient I16 (see Table 1
), exhibited distinct phylogenetic patterns of evolution (see Fig. 3
).
It is not clear whether the two tree topologies and other phylogenetic characteristics were permanent over longer periods of virus evolution, or whether they reflect a punctuated virus evolution event. It is not possible to discriminate between different hypotheses regarding the evolution of HIV-1 observed in vivo because of the limited sampling and the short time of this study. It is feasible that all of the different HIV-1 evolutionary events detected in the study occur in every infected patient but only the existence of distinct and separated clades allowed its observation, like the discovery of recombinant forms or the presence of different Ka/Ks ratios within the same patient. On the other hand, it is conceivable that the virus evolution observed in patients I01, H16 and IH03 occurs only in a subgroup of patients. It is interesting to note that, in two studies, one with children and another with adults, different phylogenetic patterns of virus evolution were found and, in both reports, a longer clinical progression time was also found among viruses displaying a clustering with time (Ganeshan et al., 1997
; Wolinsky et al., 1996
).
The mode of virus evolution observed in the first three patients studied, characterized by statistically distinct virus subpopulations in phylogenetic trees, diverse peaks in the distribution of genetic distances, different Ka/Ks ratios in the same patient and lower virus loads, is compatible with contained and compartmentalized virus replication. The progressive replication of HIV-1 in germinal centres of lymph nodes is found in asymptomatic patients and it is followed by the destruction of the architecture of the lymph nodes in late stages of the disease (Pantaleo et al., 1993
, 1994
). There have been descriptions of differences in virus subpopulations in different germinal centres of the same organ as a consequence of founder effects (Cheynier et al., 1994
). These compartmentalized virus populations could be under different immunological pressures, as we detected for patient H16 (see Table 2
). The presence of different variants within patients could be the consequence of the generation of different variants during virus replication or of infection by more than one variant, either at the same time or by reinfection (Sabino et al., 1994
; Wang et al., 2000
; Zhu et al., 1995
). In contrast, in the mode of virus evolution displayed by patients I09, I16 and IH07, it was impossible to define individual populations, which probably indicates that virus replication was not contained in different lymph organs, perhaps as a consequence of the progressive loss of architectural integrity associated with the progression to AIDS (Pantaleo et al., 1993
, 1995
). Although low virus loads have been associated with defects in virus genes in some patients (Kestler et al., 1991
; Kirchhoff et al., 1995
; Mariani et al., 1996
), the different patterns of virus evolution observed in the patients analysed in this study seem to be a consequence of host-related factors, as shown in humans (Wolinsky et al., 1996
) and macaques (Pelletier et al., 1995
).
In summary, analysis of HIV-1 quasispecies from six patients with normal clinical progression patterns, selected for their different genetic variability profiles, has allowed the detection of different patterns of HIV-1 evolution in vivo. The different patterns were characterized by different virus phylogenetic trees and by the modes of genetic distance distribution. The pattern displaying independent clades allowed the detection of recombination episodes, or the recognition of different Ka/Ks ratios between distinct virus subpopulations within patients. The results of this study show thatHIV-1 evolution in vivo is not homogeneous and different evolutionary patterns can be found in infected patients.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bagnarelli, P., Mazzola, F., Menzo, S., Montroni, M., Butini, L. & Clementi, M. (1999). Host-specific modulation of the selective constraints driving human immunodeficiency virus type 1 env gene evolution. Journal of Virology 73, 3764-3777.
Ball, J. K., Holmes, E. C., Whitwell, H. & Desselberger, U. (1994). Genomic variation of human immunodeficiency virus type 1 (HIV-1): molecular analyses of HIV-1 in sequential blood samples and various organs obtained at autopsy. Journal of General Virology 75, 867-879.
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E. & Van der Noordaa, J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.
Casado, C., Urtasun, I., Martin-Walther, M. V., Garcia, S., Rodriguez, C., del Romero, J. & Lopez-Galindez, C. (2000a). Genetic analysis of HIV-1 samples from Spain. Journal of Acquired Immune Deficiency Syndromes 23, 68-74.
Casado, C., Urtasun, I., Saragosti, S., Chaix, M. L., de Rossi, A., Cattelan, A. M., Dietrich, U. & Lopez-Galindez, C. (2000b). Different distribution of HIV type 1 genetic variants in European patients with distinct risk practices. AIDS Research and Human Retroviruses 16, 299-304.[Medline]
Chao, L. (1994). Evolution of genetic exchange in RNA viruses. In The Evolutionary Biology of Viruses , pp. 233-250. Edited by S. S. Morse. New York:Raven Press.
Cheynier, R., Henrichwark, S., Hadida, F., Pelletier, E., Oksenhendler, E., Autran, B. & Wain-Hobson, S. (1994). HIV and T cell expansion in splenic white pulps is accompanied by infiltration of HIV-specific cytotoxic T lymphocytes. Cell 78, 373-387.[Medline]
Cheynier, R., Gratton, S., Halloran, M., Stahmer, I., Letvin, N. L. & Wain-Hobson, S. (1998). Antigenic stimulation by BCG vaccine as an in vivo driving force for SIV replication and dissemination. Nature Medicine 4, 421-427.[Medline]
Coffin, J. M. (1995). HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267, 483-489.
Delassus, S., Cheynier, R. & Wain-Hobson, S. (1992). Nonhomogeneous distribution of human immunodeficiency virus type 1 proviruses in the spleen. Journal of Virology 66, 5642-5645.
Delwart, E. L., Shpaer, E. G., Louwagie, J., McCutchan, F. E., Grez, M., Rübsamen-Waigmann, H. & Mullins, J. I. (1993). Genetic relationships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes. Science 262, 1257-1261.
Delwart, E. L., Pan, H., Sheppard, H. W., Wolpert, D., Neumann, A. U., Korber, B. & Mullins, J. I. (1997). Slower evolution of human immunodeficiency virus type 1 quasispecies during progression to AIDS. Journal of Virology 71, 7498-7508.[Abstract]
Delwart, E. L., Mullins, J. I., Gupta, P., Learn, G. H.Jr, Holodniy, M., Katzenstein, D., Walker, B. D. & Singh, M. K. (1998). Human immunodeficiency virus type 1 populations in blood and semen. Journal of Virology 72, 617-623.
Domingo, D. & Holland, J. J. (1994). Mutation rates and rapid evolution of RNA viruses. In The Evolutionary Biology of Viruses , pp. 161-184. Edited by S. S. Morse. New York:Raven Press.
Eigen, M. & Biebricher, C. K. (1988). Sequence space and quasispecies distribution. In RNA Genetics , pp. 211-245. Edited by E. Domingo, J. J. Holland & P. Ahlquist. Boca Raton, FL:CRC Press.
Felsenstein, J. (1993). PHYLIP (Phylogeny Interference Package), version 3.5c. Department of Genetics, University of Washington, Seattle, WA, USA. Distributed by the author.
Ganeshan, S., Dickover, R. E., Korber, B. T. M., Bryson, Y. J. & Wolinsky, S. M. (1997). Human immunodeficiency virus type 1 genetic evolution in children with different rates of development of disease. Journal of Virology 71, 663-677.[Abstract]
Ho, D. D., Neumann, A. U., Perelson, A. S., Chen, W., Leonard, J. M. & Markowitz, M. (1995). Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 373, 123-126.[Medline]
Jetzt, A. E., Yu, H., Klarmann, G. J., Ron, Y., Preston, B. D. & Dougherty, J. P. (2000). High rate of recombination throughout the human immunodeficiency virus type 1 genome. Journal of Virology 74, 1234-1240.
Kestler, H. W.III, Ringler, D. J., Mori, K., Panicali, D. L., Sehgal, P. K., Daniel, M. D. & Desrosiers, R. C. (1991). Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65, 651-662.[Medline]
Kirchhoff, F., Greenough, T. C., Brettler, D. B., Sullivan, J. L. & Desrosiers, R. C. (1995). Brief report: absence of intact nef sequences in a long-term survivor with nonprogressive HIV-1 infection. New England Journal of Medicine 332, 228-232.
Korber, B. T. M., MacInnes, K., Smith, R. F. & Myers, G. (1994). Mutational trends in V3 loop protein sequences observed in different genetic lineages of human immunodeficiency virus type 1. Journal of Virology 68, 6730-6744.
Kumar, S., Tamura, K. & Nei, M. (1993). MEGA: Molecular Evolutionary Genetics Analysis, version 1.01. University Park, PA: Pennsylvania State University.
Lai, M. M. (1992). Genetic recombination in RNA viruses. Current Topics in Microbiology and Immunology 176, 21-32.[Medline]
Larder, B. A., Chesebro, B. & Richman, D. D. (1990). Susceptibilities of zidovudine-susceptible and -resistant human immunodeficiency virus isolates to antiviral agents determined by using a quantitative plaque reduction assay. Antimicrobial Agents and Chemotherapy 34, 436-441.
Liu, S.-L., Schacker, T., Musey, L., Shriner, D., McElrath, M. J., Corey, L. & Mullins, J. I. (1997). Divergent patterns of progression to AIDS after infection from the same source: human immunodeficiency virus type 1 evolution and antiviral responses. Journal of Virology 71, 4284-4295.[Abstract]
López-Galíndez, C., Rojas, J. M., Nájera, R., Richman, D. D. & Perucho, M. (1991). Characterization of genetic variation and 3'-azido-3'-deoxythymidine-resistance mutations of human immunodeficiency virus by the RNase A mismatch cleavage method. Proceedings of the National Academy of Sciences, USA 88, 4280-4284.
Lukashov, V. V. & Goudsmit, J. (1997). Evolution of the human immunodeficiency virus type 1 subtype-specific V3 domain is confined to a sequence space with a fixed distance to the subtype consensus. Journal of Virology 71, 6332-6338.[Abstract]
McDonald, R. A., Mayers, D. L., Chung, R. C., Wagner, K. F., Ratto-Kim, S., Birx, D. L. & Michael, N. L. (1997). Evolution of human immunodeficiency virus type 1 env sequence variation in patients with diverse rates of disease progression and T-cell function. Journal of Virology 71, 1871-1879.[Abstract]
Mariani, R., Kirchhoff, F., Greenough, T. C., Sullivan, J. L., Desrosiers, R. C. & Skowronski, J. (1996). High frequency of defective nef alleles in a long-term survivor with nonprogressive human immunodeficiency virus type 1 infection. Journal of Virology 70, 7752-7764.[Abstract]
Meyerhans, A., Cheynier, R., Albert, J., Seth, M., Kwok, S., Sninsky, J., Morfeldt-Manson, L., Asjö, B. & Wain-Hobson, S. (1989). Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations. Cell 58, 901-910.[Medline]
Meyerhans, A., Vartanian, J. P., Hultgren, C., Plikat, U., Karlsson, A., Wang, L., Eriksson, S. & Wain-Hobson, S. (1994). Restriction and enhancement of human immunodeficiency virus type 1 replication by modulation of intracellular deoxynucleoside triphosphate pools. Journal of Virology 68, 535-540.
Mulder, J., McKinney, N., Christopherson, C., Sninsky, J., Greenfield, L. & Kwok, S. (1994). Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: application to acute retroviral infection. Journal of Clinical Microbiology 32, 292-300.
Myers, G., Korber, B., Hahn, B. H., Jeang, K.-T., Mellors, J. W., McCutchan, F. E., Henderson, L. E. & Pavlakis, G. N. (editors) (1995). Human Retroviruses and AIDS 1995: a Compilation and Analysis of Nucleic Acid and Amino Acid Sequences. Los Alamos, NM: Theoretical Biology and Biophysics Group, Los Alamos National Laboratory.
Nei, M. & Gojobori, T. (1986). Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution 3, 418-426.[Abstract]
Nixon, D. F., Townsend, A. R., Elvin, J. G., Rizza, C. R., Gallwey, J. & McMichael, A. J. (1988). HIV-1 gag-specific cytotoxic T lymphocytes defined with recombinant vaccinia virus and synthetic peptides. Nature 336, 484-487.[Medline]
Page, R. D. (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.
Pantaleo, G., Graziosi, C., Demarest, J. F., Butini, L., Montroni, M., Fox, C. H., Orenstein, J. M., Kotler, D. P. & Fauci, A. S. (1993). HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature 362, 355-358.[Medline]
Pantaleo, G., Graziosi, C., Demarest, J. F., Cohen, O. J., Vaccarezza, M., Gantt, K., Muro-Cacho, C. & Fauci, A. S. (1994). Role of lymphoid organs in the pathogenesis of human immunodeficiency virus (HIV) infection. Immunological Reviews 140, 105-130.[Medline]
Pantaleo, G., Menzo, S., Vaccarezza, M., Graziosi, C., Cohen, O. J., Demarest, J. F., Montefiori, D., Orenstein, J. M., Fox, C., Schrager, L. K., Margolick, J. B., Buchbinder, S., Giorgi, J. V. & Fauci, A. S. (1995). Studies in subjects with long-term nonprogressive human immunodeficiency virus infection. New England Journal of Medicine 332, 209-216.
Pelletier, E., Saurin, W., Cheynier, R., Letvin, N. L. & Wain-Hobson, S. (1995). The tempo and mode of SIV quasispecies development in vivo calls for massive viral replication and clearance. Virology 208, 644-652.[Medline]
Perucho, M., Goldfarb, M., Shimizu, K., Lama, C., Fogh, J. & Wigler, M. (1981). Human-tumor-derived cell lines contain common and different transforming genes. Cell 27, 467-476.[Medline]
Plikat, U., Nieselt-Struwe, K. & Meyerhans, A. (1997). Genetic drift can dominate short-term human immunodeficiency virus type 1 nef quasispecies evolution in vivo. Journal of Virology 71, 4233-4240.[Abstract]
Ray, S. C. (1999). SimPlot for Windows 95/NT, version 2.4. Baltimore, MD. Distributed by the author.
Sabino, E. C., Shpaer, E. G., Morgado, M. G., Korber, B. T. M., Diaz, R. S., Bongertz, V., Cavalcante, S., Galvão-Castro, B., Mullins, J. I. & Mayer, A. (1994). Identification of human immunodeficiency virus type 1 envelope genes recombinant between subtypes B and F in two epidemiologically linked individuals from Brazil. Journal of Virology 68, 6340-6346.
Sala, M., Pelletier, E. & Wain-Hobson, S. (1995). HIV-1 gp120 sequences from a doubly infected drug user. AIDS Research and Human Retroviruses 11, 653-655.[Medline]
Salvatori, F., Masiero, S., Giaquinto, C., Wade, C. M., Brown, A. J. L., Chieco-Bianchi, L. & de Rossi, A. (1997). Evolution of human immunodeficiency virus type 1 in perinatally infected infants with rapid and slow progression to disease. Journal of Virology 71, 4694-4706.[Abstract]
Sánchez-Palomino, S., Rojas, J. M., Martínez, M. A., Fenyö, E. M., Nájera, R., Domingo, E. & López-Galíndez, C. (1993). Dilute passage promotes expression of genetic and phenotypic variants of human immunodeficiency virus type 1 in cell culture. Journal of Virology 67, 2938-2943.
Shankarappa, R., Gupta, P., Learn, G. H.Jr, Rodrigo, A. G., Rinaldo, C. R.Jr, Gorry, M. C., Mullins, J. I., Nara, P. L. & Ehrlich, G. D. (1998). Evolution of human immunodeficiency virus type 1 envelope sequences in infected individuals with differing disease progression profiles. Virology 241, 251-259.[Medline]
Shankarappa, R., Margolick, J. B., Gange, S. J., Rodrigo, A. G., Upchurch, D., Farzadegan, H., Gupta, P., Rinaldo, C. R., Learn, G. H., He, X., Huang, X. L. & Mullins, J. I. (1999). Consistent viral evolutionary changes associated with the progression of human immunodeficiency virus type 1 infection. Journal of Virology 73, 10489-10502.
Shioda, T., Oka, S., Xin, X., Liu, H., Harukuni, R., Kurotani, A., Fukushima, M., Hasan, M. K., Shiino, T., Takebe, Y., Iwamoto, A. & Nagai, Y. (1997). In vivo sequence variability of human immunodeficiency virus type 1 envelope gp120: association of V2 extension with slow disease progression. Journal of Virology 71, 4871-4881.[Abstract]
Simmonds, P., Zhang, L. Q., McOmish, F., Balfe, P., Ludlam, C. A. & Brown, A. J. L. (1991). Discontinuous sequence change of human immunodeficiency virus (HIV) type 1 env sequences in plasma viral and lymphocyte-associated proviral populations in vivo; implications for models of HIV pathogenesis. Journal of Virology 65, 6266-6276.
Takehisa, J., Zekeng, L., Ido, E., Yamaguchi-Kabata, Y., Mboudjeka, I., Harada, Y., Miura, T., Kaptu, L. & Hayami, M. (1999). Human immunodeficiency virus type 1 intergroup (M/O) recombination in Cameroon. Journal of Virology 73, 6810-6820.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Vartanian, J.-P., Meyerhans, A.,
sjö, B. & Wain-Hobson, S. (1991). Selection, recombination, and G
A hypermutation of human immunodeficiency virus type 1 genomes. Journal of Virology 65, 1779-1788.
Vartanian, J.-P., Meyerhans, A., Sala, M. & Wain-Hobson, S. (1994). G
A hypermutation of the human immunodeficiency virus type 1 genome: evidence for dCTP pool imbalance during reverse transcription. Proceedings of the National Academy of Sciences, USA 91, 3092-3096.
Wang, B., Lal, R. B., Dwyer, D. E., Miranda-Saksena, M., Boadle, R., Cunningham, A. L. & Saksena, N. K. (2000). Molecular and biological interactions between two HIV-1 strains from a coinfected patient reveal the first evidence in favor of viral synergism. Virology 274, 105-119.[Medline]
Wei, X., Ghosh, S. K., Taylor, M. E., Johnson, V. A., Emini, E. A., Deutsch, P., Lifson, J. D., Bonhoeffer, S., Nowak, M. A., Hahn, B. H., Saag, M. S. & Shaw, G. M. (1995). Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373, 117-122.[Medline]
Wolinsky, S. M., Korber, B. T. M., Neumann, A. U., Daniels, M., Kunstman, K. J., Whetsell, A. J., Furtado, M. R., Cao, Y., Ho, D. D., Safrit, J. T. & Koup, R. A. (1996). Adaptive evolution of human immunodeficiency virus type 1 during the natural course of infection. Science 272, 537-542.[Abstract]
Wong, J. K., Ignacio, C. C., Torriani, F., Havlir, D., Fitch, N. J. S. & Richman, D. D. (1997). In vivo compartmentalization of human immunodeficiency virus: evidence from the examination of pol sequences from autopsy tissues. Journal of Virology 71, 2059-2071.[Abstract]
Yamaguchi, Y. & Gojobori, T. (1997). Evolutionary mechanisms and population dynamics of the third variable envelope region of HIV within single hosts. Proceedings of the National Academy of Sciences, USA 94, 1264-1269.
Yuste, E., Sánchez-Palomino, S., Casado, C., Domingo, E. & López-Galíndez, C. (1999). Drastic fitness loss in human immunodeficiency virus type 1 upon serial bottleneck events. Journal of Virology 73, 2745-2751.
Zhang, L. Q., MacKenzie, P., Cleland, A., Holmes, E. C., Brown, A. J. L. & Simmonds, P. (1993). Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. Journal of Virology 67, 3345-3356.
Zhu, T., Wang, N., Carr, A., Wolinsky, S. & Ho, D. D. (1995). Evidence for coinfection by multiple strains of human immunodeficiency virus type 1 subtype B in an acute seroconvertor. Journal of Virology 69, 1324-1327.[Abstract]
Zhu, T., Wang, N., Carr, A., Nam, D. S., Moor-Jankowski, R., Cooper, D. A. & Ho, D. D. (1996). Genetic characterization of human immunodeficiency virus type 1 in blood and genital secretions: evidence for viral compartmentalization and selection during sexual transmission. Journal of Virol