J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Vugt, J. J. F. A.
Right arrow Articles by Bøtner, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Vugt, J. J. F. A.
Right arrow Articles by Bøtner, A.
Agricola
Right arrow Articles by van Vugt, J. J. F. A.
Right arrow Articles by Bøtner, A.
Journal of General Virology (2001), 82, 2615-2620.
© 2001 Society for General Microbiology


Animal: RNA Viruses

High frequency RNA recombination in porcine reproductive and respiratory syndrome virus occurs preferentially between parental sequences with high similarity

Joke J. F. A. van Vugta,1, Torben Storgaardb,1, Martin B. Oleksiewicz1 and Anette Bøtner1

Danish Veterinary Institute for Virus Research, Lindholm, DK-4771 Kalvehave, , Denmark1

Author for correspondence: Torben Storgaard. Fax +45 44 43 45 58. e-mail TStS{at}novonordisk.com


   Abstract
TOP
Abstract
Introduction
References
 
Two types of porcine reproductive and respiratory syndrome virus (PRRSV) exist, a North American type and a European type. The co-existence of both types in some countries, such as Denmark, Slovakia and Canada, creates a risk of inter-type recombination. To evaluate this risk, cell cultures were co-infected with either a North American and a European type of PRRSV or two diverse types of European isolate. Subsequently, an approximately 600 bp region of the PRRSV genome was tested for recombination by quantitative real-time RT–PCR. Between 0·1 and 2·5% RNA recombination was found between the European isolates, but no recombination was detected between the European and North American types. Calculation of the maximum theoretical risk of European–American recombination, based on the sensitivity of the RT–PCR system, revealed that RNA recombination between the European and North American types of PRRSV is at least 10000 times less likely to occur than RNA recombination between diverse European isolates.


   Introduction
TOP
Abstract
Introduction
References
 
After the initial peak of porcine reproductive and respiratory syndrome (PRRS) outbreaks in 1987–1991 (Keffaber, 1989Down ; Wensvoort et al., 1991Down ), the disease is now endemic in North America, Europe and Asia. Until recently, the European type of PRRS virus (PRRSV) was restricted to Europe, while the American type of PRRSV was restricted to North America and Asia. Now, however, European wild-type PRRSV has been isolated from pigs in North America (Dewey et al., 2000Down ) and American wild-type PRRSV has been isolated in Slovakia (Psikal et al., 1999Down ). Furthermore, in several European countries, a modified, live vaccine based on the American type of PRRSV has been used and, at least in Denmark, this live vaccine has reverted to wild-type virus (Bøtner et al., 1997Down ; Nielsen et al., 2001Down ; Storgaard et al., 1999Down ). Recombination between the American isolates of PRRSV (intra-type recombination) occurs (Yuan et al., 1999Down ), so the co-existence of the European and the American type of PRRSV within herds and even within single animals, as seen in some countries such as Denmark (Anette Bøtner, personal communication), creates a potential risk for inter-type recombination. This could result in serious problems with virus typing and vaccination and might potentially even generate a virus with new biological properties.

To examine inter- and intra-type PRRSV RNA recombination, MARC-145 cells were co-infected (m.o.i. of 0·01 TCID50 per cell) with the Danish 111/92 isolate (Madsen et al., 1998Down ) and the American PRRS live vaccine virus (Ingelvac PRRS Vet) (Boehringer Ingelheim) or co-infected with the Danish and Dutch Lelystad isolates of PRRSV (Meulenberg et al., 1993Down ). The Lelystad and Danish isolates were adapted to MARC-145 cells by serial passage. For control infections, MARC-145 cells were mock-infected with medium or infected solely with the Danish, Lelystad or American isolate. After 3 days of incubation at 37 °C, cells were lysed and total RNA was isolated. cDNA was synthesized using PRRSV-specific primers, essentially as described previously (Oleksiewicz et al., 1998Down ). Detection of viral RNA recombination by PCR requires primers that are absolutely specific for each of the three virus isolates. Danish-specific forward (5' GCGTCACTTTCAACAAGCCATCTC) and reverse (5' TTTGATGGTAACAAGGTCGCTGC) primers that amplified an expected fragment of 894 bp only when used on cDNA from Danish PRRSV-infected cells were designed (Fig. 1Down, lanes 2–5). Lelystad-specific forward (5' GGTCTCAGCAGCGCAAGAGAA) and reverse (5' CAAATCCTGCAGTGGATACAGCG) primers that amplified an expected fragment of 687 bp only when used on cDNA from Lelystad PRRSV-infected cells were also designed (Fig. 1Down, lanes 6–8). Finally, American-specific forward (5' GCGATAGGGACACCTGTGTATGTT) and reverse (5' GGTAGACACAGTGACTAAAGCGACT) primers that amplified an expected fragment of 626 bp only when used on cDNA from American PRRSV-infected cells were designed (Fig. 1Down, lanes 9–11). All three forward primers were located within the 3' end of open reading frame (ORF) 3 and all three reverse primers were located within the 3' end of ORF 5 (Fig. 2Down). PCR was carried out using AmpliTaq Gold polymerase according to the manufacturer’s instructions (Applied Biosystems), starting with a hot-start activation step of 5 min at 95 °C, followed by 45 cycles of 95 °C for 15 s, 60 °C for 15 s and 72 °C for 15 s. To exclude the possibility that artificial recombination might have occurred during RNA isolation, cDNA synthesis or PCR amplification, Danish–American and Danish–Lelystad mixture controls were produced by combining cell lysates from the single PRRSV control infections in a 1:1 ratio before RNA isolation. To detect European intra-type recombination, PCR was carried out using the Danish-specific forward primer and the Lelystad-specific reverse primer on cDNA from Danish–Lelystad co-infected cells and from the Danish–Lelystad mixture control. A band with the expected size of 667 bp was seen only on cDNA from co-infected cells and not from the corresponding mixture control (Fig. 1Down, lanes 12–14). When the equivalent experiment was performed to detect European–American inter-type recombination, no specific band was detected in any of the reactions (Fig. 1Down, lanes 15–17). It was concluded, therefore, that intra- but not inter-type recombination occurred under the in vitro cell culture conditions used.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. PCR using homologous or heterologous primer pairs. Lanes 1 and 18 are marker lanes containing {Phi}X174 HaeIII-digested DNA. The size (bp) of the marker bands is indicated on the left. The primers used for PCR were the Danish (lanes 2–5), Lelystad (Dutch) (lanes 6–8) or North American (lanes 9–11) forward and reverse primer pairs. The Danish forward and Lelystad reverse primers (lanes 12–14) and the Danish forward and North American reverse primers (lanes 15–17) were also used. The results of PCR on cDNA from cells infected with the Danish (lanes 2, 7 and 10), Lelystad (lanes 3 and 6) and American (lanes 4 and 9) isolates are shown. The results of PCR on cDNA from cells co-infected with the Danish and Lelystad isolates (lane 12), a lysate mixture from cells singly infected with the Danish and Lelystad isolates (lane 13), cells co-infected with the Danish and American isolates (lane 15) or a lysate mixture from cells singly infected with the Danish and American isolates (lane 16) are shown. Lanes 5, 8, 11, 14 and 17 show the result of PCR on cDNA from mock-infected cells. The PCR products are 894 bp (lane 2), 687 bp (lane 6), 626 bp (lane 9) and 667 bp (lane 12) in size. DK, Danish; NL, Lelystad; US, North American; Neg., negative control; Mix cont., mixture control.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Identification of recombination hot spots between Danish and Lelystad PRRSV. The positions of the Danish-specific forward primer ({blacktriangleright}) and the Lelystad-specific reverse primer ({triangleleft}) are shown in relation to PRRSV ORFs 3–5. The identity of the two parental sequences (Danish and Lelystad) is shown using a sliding window of 20 bp and a step size of 10 bp. Each of the 13 sequenced clones (A–M corresponding to AF315699–AF3115711) is drawn. Solid lines indicate sequences originating from the Danish parental strain, while dashed lines indicate sequences originating from the Lelystad parental strain. Boxes connecting the solid and the dashed lines indicate regions of complete identity between the two parental strains. The actual site of RNA recombination is within these boxes.

 
To determine sites of recombination, the Danish–Lelystad recombinant PCR product was gel-purified and cloned into the pCRII vector (Invitrogen), according to the manufacturer’s instructions. Plasmid DNA purified from 13 individual clones was sequenced using BigDye chain terminators, as recommended by the manufacturer (Applied Biosystems), and the result was compared to both the sequence of the Danish 111/92 isolate (GenBank accession no. AY034879) and the sequence of the Lelystad isolate (GenBank accession no. M96262). All 13 sequences obtained have been submitted to GenBank (accession nos AF315699AF315711). Seven of the clones had recombined in a 104 bp region in ORF 5, with complete identity between the parental strains (Fig. 2Up). Two clones had recombined in a region of 52 bp in ORF 4, with complete identity between the parental strains. Three clones had recombined in 5 (ORF 4), 8 (ORF 4) and 26 (ORF 5) bp regions, with complete sequence identity between the parental strains. Finally, one clone differed from the rest in that two deletions had been introduced at the site of recombination (Fig. 2Up), suggesting that the mechanism of recombination is not always precise, as described previously for other RNA viruses (Nagy & Bujarski, 1995Down ). The Danish and Lelystad PRRSV isolates have 94% overall identity in the region examined for recombination (621 bp), while the Danish and American PRRSV isolates only have 60% overall identity in the region examined for recombination (579 bp). Despite the low level of overall identity between the Danish and American isolates in the 579 bp area, small regions (up to 11 bp) of complete identity do exist. The presence of recombination between the two European isolates in short stretches of identity (less than 11 bp) and the absence of recombination between the Danish and American isolates suggest that short stretches of perfect identity should be flanked by longer regions with a high percentage of identity in order to recombine (Fig. 2Up). The total absence of RNA recombination between the Danish and American PRRSV isolates could, however, be caused by insufficient sensitivity of our RT–PCR assay or by non-optimal experimental conditions for virus recombination. To evaluate these two possibilities, a quantitative real-time RT–PCR was established for the different viral RNA targets. This was carried out by adding SYBR Green I (375000x concentration, diluted in the final PCR) (Molecular Probes) to the PCR set-up. SYBR Green I increases its fluorescence upon binding to the PCR product (double-stranded DNA) and this increase in fluorescence was measured in each PCR elongation step using an ABI 7700 thermal cycler (Applied Biosystems). For this real-time PCR, the specificity of the primers was further increased by the addition of Perfect Match PCR Enhancer (Stratagene) to a final concentration of 1 mU/µl. To determine the quantitative nature of the five different PCR tests (Danish, Lelystad, American, Danish–Lelystad and Danish–American), PCR products were produced for each of the target sequences using their respective primer set and cloned into the pCRII vector. As no Danish–American PCR product was produced under the experimental conditions used, this PCR product was made artificially using internal primers with overlap extension, as described by others (Horton et al., 1989Down ). Tenfold dilutions were then produced for each of the five plasmid controls, spanning the range of 1–108 DNA copies per reaction. Real-time PCR was performed in triplicate and the logarithm of the number of DNA copies per sample was plotted as a function of the PCR cycle at which the fluorescence increased above the background level (CT value) (Ririe et al., 1997Down ). This resulted in a nearly perfect linear correlation (r2>0·99) for all five different primer combinations, showing that all primer combinations resulted in a quantitative PCR with a linear range of eight orders of magnitude (data not shown). Moreover, the CT value versus the copy number plots allowed us to compensate for the slightly different amplification efficiencies of these five PCR tests (data not show). We then used the quantitative PCR set-up to calculate the percentage of recombination in co-infected cell cultures. The percentage of recombination was calculated by dividing the number of recombinant molecules by the average number of non-recombinant molecules in the sample. To find the optimal conditions for RNA recombination, cell cultures were infected with different virus ratios and harvested at different time-points. In a total of 43 experiments, the percentage of European intra-type RNA recombination in the cell lysate ranged from 0·1 to 2·5%, with no apparent correlation to the amount or ratio of virus used. Also, the cell supernatant was investigated for the presence of intra-type recombinant RNA. At 6 and 24 h after infection, no RNA recombination between the two European isolates could be detected in the supernatant. At 48 and 72 h after infection, between 0·1 and 0·9% RNA recombination was detected in the supernatant from cells co-infected with the Danish and Lelystad isolates (Fig. 3ADown). This percentage of European intra-type recombination found in the current study might be slightly less than the percentage of recombination reported previously for other arteriviruses. Among two North American PRRSV isolates, up to 10% RNA recombination was found in a 1182 bp region (Yuan et al., 1999Down ) and for lactate dehydrogenase-elevating virus, up to 5% RNA recombination was found in a 1276 bp region (Li et al., 1999Down ). The current study is the first to show recombination in the European type and also, it is the only one that has quantified precisely the level of RNA recombination. The fragment investigated for recombination in the current study is almost half the size of those reported previously for arterivirus recombination (Li et al., 1999Down ; Yuan et al., 1999Down ) and it would be expected that the relative amount of recombination is proportional to the length of the fragment studied. It is interesting to speculate that if there is up to 2·5% recombination in a 621 bp fragment, the level of RNA recombination for the complete genome of 15000 bp would be up to 60%, assuming an evenly distributed level of sequence identity across the whole viral genome. That does not even take into account double crossovers undetected by the current assay (Baric et al., 1990Down ) and also does not account for the fact that the present study only measured Danish–Lelystad recombination and not Lelystad–Danish recombination. Of course, it is highly speculative, but, nevertheless, the calculations suggest that, on average, more than one recombination event might take place per viral genome per cell culture passage.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Real-time PCR for quantification of RNA recombination. Real-time amplification plots are given for a representative experiment to detect (A) European intra-type or (B) European–American inter-type recombination. (A) cDNA synthesized from a supernatant sample taken 72 h post-infection from a cell culture co-infected with the Danish (m.o.i. of 0·01 TCID50 per cell) and Lelystad (m.o.i. of 0·01 TCID50 per cell) isolates gave a CT value of 26 when using the Danish-specific forward and reverse primers ({diamond}) and when using the Lelystad-specific forward and reverse primers ({square}). Using the Danish-specific forward primer and the Lelystad-specific reverse primer to detect European intra-type recombinant RNA resulted in a CT value of 34 ({triangleup}). The equivalent primer pairs used on cDNA from the European intra-type mixture control resulted in CT values of 26 ({circ}, Danish), 26 (+, Lelystad) and 40 (x, recombinant). The latter CT value of 40 (x) was shown to represent non-specific amplification, as determined by subsequent melting-point analysis (data not shown). (B) cDNA synthesized from a cell lysate sample taken 48 h post-infection from a cell culture co-infected with the Danish (m.o.i. of 0·01 TCID50 per cell) and American (m.o.i. of 0·01 TCID50 per cell) isolates gave a CT value of 18 when using the Danish-specific forward and reverse primers ({diamond};) and a CT value of 20 when using the American-specific forward and reverse primers ({square}). Using the Danish-specific forward primer and the American-specific reverse primer to detect inter-type recombinant RNA resulted in no amplification at all ({triangleup}). The equivalent primer pairs used on cDNA from the inter-type mixture control resulted in CT values of 21 ({circ}, Danish) and 18 (+, American) or no amplification (x, recombinant).

 
All tested virus ratios between the Danish and Lelystad isolate resulted in RNA recombination, showing that the current assay was robust at generating recombinant RNA. The same quantitative RT–PCR methodology was therefore applied to study whether there was recombination between the European and North American types of PRRSV. Under none of the conditions tested was recombination observed (Fig. 3BUp). Nevertheless, the quantitative real-time PCR allowed us to determine the sensitivity of the assay to detect inter-type recombination by comparing the minimal amount of recombinant RNA that could have been detected with the amount of the parental virus RNA present in the co-infected cells. It was calculated that if inter-type recombination was present at a low level, below the sensitivity of the RT–PCR, recombination occurred at a frequency of less than 10-6. The maximum theoretical risk of inter-type recombination seems therefore to be at least 10000 times less likely to occur than European intra-type recombination.

Because recombination destroys molecular clocks (Schierup & Hein, 2000Down ), the recent demonstration of a perfect molecular clock in the European type of PRRSV (Forsberg et al., 2001Down ; Oleksiewicz et al., 2000Down ) indicates that recombination among Danish isolates of PRRSV has been a rare event in the field. Taken together with the result of the current study, the risk of inter-type recombination in the field might seem very low. Furthermore, even if inter-type RNA recombinants are generated at a low level under field conditions, there is a good chance that such recombinants are not viable due to the low level of similarity between the parental strains (Godeny et al., 1993Down ) or that inter-type recombination would be out competed by one of the original virus isolates, as seen for the recombinants of the American PRRSV isolates in cell culture (Yuan et al., 1999Down ). However, if an inter-type recombinant virus had a selective advantage due to, for example, pre-existing immunity to the parental viruses in the pig population, even an extremely rare non-homologous recombination event could rapidly spread in the pig population. It is important, therefore, that the risk of new inter-type PRRSV recombinants is kept in mind constantly when evaluating current and new diagnostic procedures.


   Acknowledgments
 
Preben Normann is thanked for the introduction to the automatic DNA sequencer. This project was partially supported by a grant (BIOT99-2) from the Danish Ministry of Food, Agriculture and Fishery given to Torben Storgaard. Joke van Vugt did the experimental work as part of her Masters degree in biology at the Wageningen University in The Netherlands.


   Footnotes
 
The GenBank accession nos of the sequences reported in this paper are AF315699AF315711 and AY034879.

a Present address: Laboratory of Entomology, Bode 49, Postbus 9101, 6700 HB Wageningen, The Netherlands. Back

b Present address: Novo Nordisk A/S, Novo Nordisk Park, DK-2760, Mløv, Denmark. Back


   References
TOP
Abstract
Introduction
References
 
Baric, R. S. , Fu, K. , Schaad, M. C. & Stohlman, S. A. (1990). Establishing a genetic recombination map for murine coronavirus strain A59 complementation groups. Virology 177, 646-656.[Medline]

Bøtner, A., Strandbygaard, B., Sørensen, K. J., Have, P., Madsen, K. G. , Madsen, E. S. & Alexandersen, S. (1997). Appearance of acute PRRS-like symptoms in sow herds after vaccination with a modified live PRRS vaccine. Veterinary Record 141, 497-499.[Free Full Text]

Dewey, C. , Charbonneau, G. , Carman, S. , Hamel, A. , Nayar, G. , Friendship, R. , Eernisse, K. & Swenson, S. (2000). Lelystad-like strain of porcine reproductive and respiratory syndrome virus (PRRSV) identified in Canadian swine. Canadian Veterinary Journal 41, 493-494.

Forsberg, R. , Oleksiewicz, M. B. , Petersen, A.-M. K. , Hein, J. , Bøtner, A. & Storgaard, T. (2001). A molecular clock dates the common ancestor of European-type porcine reproductive and respiratory syndrome virus at more than 10 years before the emergence of disease. Virology , in press

Godeny, E. K. , Chen, L. , Kumar, S. N. , Methven, S. L. , Koonin, E. V. & Brinton, M. A. (1993). Complete genomic sequence and phylogenetic analysis of the lactate dehydrogenase-elevating virus (LDV). Virology 194, 585-596.[Medline]

Horton, R. M. , Hunt, H. D. , Ho, S. N. , Pullen, J. K. & Pease, L. R. (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68.[Medline]

Keffaber, K. K. (1989). Reproductive failure of unknown etiology. American Association of Swine Practitioners 1, 1-10.

Li, K. , Chen, Z. & Plagemann, P. (1999). High-frequency homologous genetic recombination of an arterivirus, lactate dehydrogenase-elevating virus, in mice and evolution of neuropathogenic variants. Virology 258, 73-83.[Medline]

Madsen, K. G. , Hansen, C. M. , Madsen, E. S. , Strandbygaard, B. , Bøtner, A. & Sørensen, K. J. (1998). Sequence analysis of porcine reproductive and respiratory syndrome virus of the American type collected from Danish swine herds. Archives of Virology 143, 1683-1700.[Medline]

Meulenberg, J. J. M. , Hulst, M. M. , de Meijer, E. J. , Moonen, P. L. J. M. , den Besten, A. , de Kluyver, E. P. , Wensvoort, G. & Moormann, R. J. M. (1993). Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192, 62-72.[Medline]

Nagy, P. D. & Bujarski, J. J. (1995). Efficient system of homologous RNA recombination in brome mosaic virus: sequence and structure requirements and accuracy of crossovers. Journal of Virology 69, 131-140.[Abstract]

Nielsen, H. S. , Oleksiewicz, M. B. , Forsberg, R. , Stadejek, T. , Bøtner, A. & Storgaard, T. (2001). Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. Journal of General Virology 82, 1263-1272.[Abstract/Free Full Text]

Oleksiewicz, M. B. , Bøtner, A. , Madsen, K. G. & Storgaard, T. (1998). Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RT–PCR amplification of whole viral genes. Veterinary Microbiology 64, 7-22.[Medline]

Oleksiewicz, M. B. , Bøtner, A. , Toft, P. , Grubbe, T. , Nielsen, J. , Kamstrup, S. & Storgaard, T. (2000). Emergence of porcine reproductive and respiratory syndrome virus deletion mutants: correlation with the porcine antibody response to a hypervariable site in the ORF 3 structural glycoprotein. Virology 267, 135-140.[Medline]

Psikal, I. , Moutelikova, R. , Kosinova, E. , Mojzis, M. , Smid, B. , Nejedla, E. , Indik, S. & Rodak, L. (1999). Molecular identification and genotyping of porcine reproductive and respiratory syndrome virus (PRRSV) strains in the Czech and Slovak Republics. Proceedings of the 3rd International Symposium of PRRSV and Aujeszky 1, 175-176.

Ririe, K. M. , Rasmussen, R. P. & Wittwer, C. T. (1997). Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245, 154-160.[Medline]

Schierup, M. H. & Hein, J. (2000). Recombination and the molecular clock. Molecular Biology of Evolution 17, 1578-1579.

Storgaard, T. , Oleksiewicz, M. & Bøtner, A. (1999). Examination of the selective pressures on a live PRRS vaccine virus. Archives of Virology 144, 2389-2401.[Medline]

Wensvoort, G. , Terpstra, C. , Pol, J. M. A. , ter Laak, E. A. , Bloemraad, M. , de Kluyver, E. P. , Kragten, C. , van Buiten, L. , den Besten, A. , Wagenaar, F. , Broeckhuijsen, J. M. , Moonen, P. L. J. M. , Zetstra, T. , de Boer, E. A. , Tibben, H. J. , de Jong, M. F. , van’t Veld, P. , Groenland, G. J. R. , van Gennep, J. A. , Voets, M. , Verheijden, J. H. M. & Bramskamp, J. (1991). Mystery swine disease in the Netherlands: the isolation of Lelystad virus. Veterinary Quarterly 13, 121-130.[Medline]

Yuan, S. , Nelsen, C. J. , Murtaugh, M. P. , Schmitt, B. J. & Faaberg, K. S. (1999). Recombination between North American strains of porcine reproductive and respiratory syndrome virus. Virus Research 61, 87-98.[Medline]




This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
T. Stadejek, M. B. Oleksiewicz, D. Potapchuk, and K. Podgorska
Porcine reproductive and respiratory syndrome virus strains of exceptional diversity in eastern Europe support the definition of new genetic subtypes
J. Gen. Virol., July 1, 2006; 87(7): 1835 - 1841.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
A. Wasilk, J. D. Callahan, J. Christopher-Hennings, T. A. Gay, Y. Fang, M. Dammen, M. E. Reos, M. Torremorell, D. Polson, M. Mellencamp, et al.
Detection of U.S., Lelystad, and European-Like Porcine Reproductive and Respiratory Syndrome Viruses and Relative Quantitation in Boar Semen and Serum Samples by Real-Time PCR
J. Clin. Microbiol., October 1, 2004; 42(10): 4453 - 4461.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. H. Ansari, L.-M. Chen, D. Liang, L. H. Gil, W. Zhong, and R. O. Donis
Involvement of a Bovine Viral Diarrhea Virus NS5B Locus in Virion Assembly
J. Virol., September 15, 2004; 78(18): 9612 - 9623.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. L. Ropp, C. E. M. Wees, Y. Fang, E. A. Nelson, K. D. Rossow, M. Bien, B. Arndt, S. Preszler, P. Steen, J. Christopher-Hennings, et al.
Characterization of Emerging European-Like Porcine Reproductive and Respiratory Syndrome Virus Isolates in the United States
J. Virol., April 1, 2004; 78(7): 3684 - 3703.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. L. Smits, A. Lavazza, K. Matiz, M. C. Horzinek, M. P. Koopmans, and R. J. de Groot
Phylogenetic and Evolutionary Relationships among Torovirus Field Variants: Evidence for Multiple Intertypic Recombination Events
J. Virol., September 1, 2003; 77(17): 9567 - 9577.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Vugt, J. J. F. A.
Right arrow Articles by Bøtner, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Vugt, J. J. F. A.
Right arrow Articles by Bøtner, A.
Agricola
Right arrow Articles by van Vugt, J. J. F. A.
Right arrow Articles by Bøtner, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS