J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chua, B. H.
Right arrow Articles by Chua, K. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chua, B. H.
Right arrow Articles by Chua, K. B.
Agricola
Right arrow Articles by Chua, B. H.
Right arrow Articles by Chua, K. B.
Journal of General Virology (2001), 82, 2629-2639.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Comparison of the complete nucleotide sequences of echovirus 7 strain UMMC and the prototype (Wallace) strain demonstrates significant genetic drift over time

B. H. Chua1, P. C. McMinn2, S. K. Lam1 and K. B. Chua1

Department of Medical Microbiology, Faculty of Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia1
Division of Virology, TVW Telethon Institute for Child Health Research, Perth, WA, Australia2

Author for correspondence: K. B. Chua. Fax +60 3 7958 4844. e-mail chuakb{at}ummc.edu.my


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The complete nucleotide sequences are reported of two strains of echovirus 7, the prototype Wallace strain (Eo7-Wallace) and a recent Malaysian strain isolated from the cerebrospinal fluid of a child with fatal encephalomyelitis (Eo7-UMMC strain). The molecular findings corroborate the serological placement of the UMMC strain as echovirus 7. Both Eo7-Wallace and Eo7-UMMC belong to the species human enterovirus B and are most closely related to echovirus 11. Eo7-UMMC has undergone significant genetic drift from the prototype strain in the 47 years that separate the isolation of the two viruses. Phylogenetic analysis revealed that Eo7-UMMC did not arise from recombination with another enterovirus serotype. The molecular basis for the severely neurovirulent phenotype of Eo7-UMMC remains unknown. However, it is shown that mutations in the nucleotide sequence of the 5' untranslated region (UTR) of Eo7-UMMC result in changes to the putative structure of the 5' UTR. It is possible that these changes contribute to the neurovirulence of Eo7-UMMC.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human enteroviruses are small, single-stranded positive-sense RNA viruses and form a separate genus within the family Picornaviridae. The genus Enterovirus contains four species, human enteroviruses A, B, C and D (King et al., 2000Down ). The 68 individual serotypes originally identified by neutralization (Melnick, 1996Down ) are distributed between the four species according to their degree of genetic relatedness (King et al., 2000Down ). The genomic RNA of enteroviruses consists of approximately 7500 nt, is polyadenylated at the 3' terminus and carries a small viral peptide (VPg) covalently attached to its 5' end. The 5' untranslated region (UTR) of the RNA is approximately 700 nt in length and is unusually long compared with the homologous region of cellular mRNA. This region is thought to self-fold into secondary structures that act as the binding site for cellular ribosomes prior to translation. The coding region encompasses a single open reading frame (ORF) that encodes a polyprotein divided into three subregions, P1, P2 and P3. The P1 region encodes the genetic information of four structural proteins, VP4, VP2, VP3 and VP1. The non-structural proteins (except VPg) are encoded in the P2 (2A, 2B and 2C) and P3 (3A, 3B, 3C and 3D) regions. A short 3' UTR of approximately 100 nt separates the coding region from the poly(A) tail. Both the 5' and 3' UTRs carry signals for protein translation and genome replication and are highly conserved between members of the genus (Melnick, 1996Down ).

With the exception of the polioviruses, distinct clinical entities associated with particular enterovirus serotypes are rare, although several defined clinical entities caused by specific enterovirus serotypes have been well described (Melnick, 1996Down ). One of the best-known examples is hand, foot and mouth disease (HFMD), a febrile papulovesicular eruption most frequently associated with coxsackievirus A16 (CA16) infection. Several other serotypes within the human enterovirus A species [CA4, CA5, CA9 and CA10 and enterovirus 71 (EV71)] have also been reported to cause HFMD (Melnick, 1996Down ).

HFMD is endemic in Malaysia. In 1997, a large outbreak of HFMD resulted in the deaths of 41 children due to acute brainstem encephalitis (Lum et al., 1998aDown , bDown ). Both CA16 and EV71 were isolated from cases of HFMD, but EV71 was the only virus isolated from fatal cases (Lum et al., 1998aDown , bDown ). A similar outbreak of HFMD, with several fatal cases, occurred in peninsular Malaysia during the latter part of 2000. In addition to CA16 and EV71, echovirus 7 (Eo7) was also isolated from cases of HFMD seen at the University of Malaya Medical Centre (UMMC) during this outbreak. In the past, Eo7 has been implicated as a cause of mild febrile exanthematous diseases in children, although there have been several earlier reports of fatal infections (Madhavan & Sharma, 1969Down ; Andersson et al., 1975Down ; Wreghitt et al., 1989Down ; Ho-Yen et al., 1989Down ). However, during the 2000 HFMD outbreak, Eo7 was isolated from several fatal cases of encephalomyelitis (Lum et al., 2001Down ). Moreover, to our knowledge, Eo7 infection has not previously been reported in association with HFMD, although there has been a report of maculopapular eruption with distribution confined mainly to the hands and feet (Ho-Yen et al., 1989Down ). In this paper, we compare the complete nucleotide sequences of the Eo7 UMMC strain, isolated from the cerebrospinal fluid of a child with HFMD and fatal encephalomyelitis, and the prototype Eo7 (Wallace strain), isolated from the stool of an asymptomatic child (Ramos-Alvaraz & Sabin, 1954Down ). A detailed analysis of genetic differences between Eo7-UMMC and Eo7-Wallace is presented, including comparison of nucleotide and deduced amino acid sequences and secondary structure analysis in the 5' UTR. Finally, the phylogenetic relationship of Eo7 to other human enteroviruses is presented.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus and cells.
The prototype Eo7, Wallace strain, was kindly provided by Ms Margery Kennett (WHO Regional Poliovirus Reference Laboratory, Melbourne, Australia) and was passaged twice on human rhabdomyosarcoma (RD) cells (ATCC CCL 136). The Eo7-UMMC strain was isolated from the cerebrospinal fluid of a 3-year-old boy with HFMD and fatal encephalomyelitis using Vero E6 cells (ATCC CRL 1587). The viruses were plaque-purified once, following the method of Dougherty (1964)Down . Two 25-cm2 culture flasks containing confluent monolayers of RD cells were infected with either Eo7-Wallace or Eo7-UMMC at an m.o.i. of 20 p.f.u. per cell. The infected cells were harvested by centrifugation at 1000 g for 10 min following the development of extensive cytopathic effect.

{blacksquare} Virus RNA isolation, genome amplification and sequencing.
Total RNA was extracted from the infected RD cell pellet using the Qiagen RNeasy Mini kit and the eluted total RNA was quantified using the GeneQuant II RNA/DNA Calculator (Pharmacia). The complete nucleotide sequences of a number of enteroviruses, Eo1 (accession no. AF029859), Eo5 (NC_002601), Eo6 (NC_001657), Eo9 (NC_001656), Eo11 (X80059), Eo30 (NC_000873), coxsackievirus B (CB) 1 (NC_001472), CB2 (NC_000881), CB3 (U57056), CB4 (NC_001360), CB5 (AF114383), CB6 (NC_002003), CA9 (NC_002347), CA16 (NC_001612), CA21 (NC_001428), CA24 (D90457), EV70 (NC_001430), EV71 BrCr strain (EV71-BrCr) (NC_001769), EV71-MS (U22522), poliovirus type 1 (PV1) (K01392), poliovirus type 2 (PV2) (NC_002058) and poliovirus type 3 (PV3) (M12197), were obtained from GenBank.

The complete nucleotide sequences of these enteroviruses were aligned using the Clone Manager 5/Align Plus-4 software (S&E Software). Fifteen pairs of degenerate primers, covering the predicted entire genomic nucleotide sequence, were synthesized based on the relatively conserved nucleotide regions of these enteroviruses (Table 1Down). Segments of the complete Eo7 genome were amplified by RT–PCR with the extracted viral RNA as the template for the reaction. The PCR products were sequenced by ABI Prism Big-Dye dideoxy chain-termination cycle sequencing (Pharmacia) using the respective degenerate forward and reverse primers and analysed on an ABI 377 automatic sequencer (Applied Biosystems). The derived sequences of all segments were assembled by using the Clone Manager 5/Align Plus-4 software. Overlapping virus-specific primers were then synthesized, based on the sequence information derived from the degenerate primers, to cover regions of the degenerate primer sites. Further virus genome sequences were obtained by RT–PCR by using the virus-specific primers and the extracted RNA as the template. Thus, each nucleotide within the viral genome was sequenced at least four times.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used to sequence the complete genomes of Eo7-Wallace and Eo7-UMMC

 
{blacksquare} Sequence information for the 5' end of the Eo7 genome.
The sequence of the 5' UTR of both Eo7-Wallace and Eo7-UMMC was obtained by two approaches. The preliminary sequence of the 5' UTR of the viral genome was first obtained by RT–PCR with virus-specific reverse primers [5' GCTTGCTGTTGATCGGTGTGTG 3' (Wallace), 5' GTAACAGAAGTGCCTGGTCATG 3' (UMMC)] and a 20-mer oligonucleotide primer (5' TTAAAACAGCCTGTGGGTTG 3') based on the known conserved 20 nucleotides at the 5' terminus of the enterovirus genome. The technique of rapid amplification of cDNA ends (RACE), based on the improved technique of Tillett et al. (2000)Down , was used to verify the sequence of the 5' terminus of the Eo-7 genome obtained previously by RT–PCR. Three virus-specific primers were designed; the first primer (CR) was about 200 nt, the second (BR) was about 150 nt and the third (AR) was about 100 nt from the predicted 5' terminus of the genome. An adaptor–anchor (DT88, 5' GAAGAGAAGGTGGAAATGGCGTTTTGG 3') and anchor primer (DT89, 5'-CCAAAACGCCATTTCCACCTTCTCTTC-3') were made as described (Tillett et al., 2000Down ).

Single-stranded cDNA synthesis reactions were performed by reverse transcription (Thermoscript RT kit) using the most distal primer (CR). The RNA templates were removed by alkaline lysis and the single-stranded cDNA was extracted by precipitation with isopropanol, 3 M sodium acetate and glycogen. The precipitate was dissolved in 20 µl Tris–HCl (pH 8·0) after two washes in 80% ethanol. Ligation of each single-stranded cDNA to the anchor (DT88) was carried out overnight at 30 °C in a 13 µl reaction: 10 µl cDNA, 1·3 µl 10x ligation buffer, 0·3 µl T4 RNA ligase and 1·4 µl DT88 anchor (4 pmol/µl).

Amplification of the ligated 5' terminus of the viral genome (3' terminus of cDNA) was performed in a 50 µl reaction consisting of 44 µl Platinum PCR Supermix (Gibco BRL), 2 µl anchor primer (DT89, 20 pmol/µl), 2 µl primer BR (20 pmol/µl) and 2 µl of the ligated product. A standard 35-cycle PCR amplification was performed with an annealing step of 55 °C for 30 s, following which a second PCR (hemi-nested) was performed using DT89 and primer AR under the same cycling conditions.

The presence of the amplified hemi-nested PCR product was confirmed by agarose gel electrophoresis. The appropriately sized product was purified by gel extraction using the QIAquick gel purification kit (Qiagen); between 30 and 40 ng of purified product was sequenced.

{blacksquare} Nucleotide and deduced amino acid sequence analysis.
Sequence data derived from the cDNA fragments generated by RT–PCR and 5' RACE were manipulated using the Clone Manager 5/Align Plus 4 software. Multiple sequence alignments were undertaken using a standard linear scoring matrix with the following parameter settings: mismatch penalty of 1, open gap penalty of 4, extended gap penalty of 1 and similarity significance value cut-off of 60%. A homology search was conducted using the BLAST server at the National Center for Biotechnology Information (National Library of Medicine, Bethesda, MD, USA).

Multiple sequence alignments and a neighbour-joining phylogram were generated using the Clustal X program (Higgins & Sharp, 1989Down ). Phylogenetic analysis was conducted using PROTDIST and KITSCH programs in the PHYLIP software package, version 3.5c (Felsenstein, 1993Down ). The most likely evolutionary relationships were determined by evaluation of trees from 1000 randomized resampling cycles. Bootstrap verification of the resulting phylogenetic tree was performed by analysis of 1000 bootstrapped pseudo-replicates using the SEQBOOT, NEIGHBOR and CONSENSE programs of the PHYLIP package. Phylogenetic trees were constructed using TreeView (Page, 1996Down ). The RNA secondary structures of the 5' and 3' UTRs were constructed using RNAStructure version 3.5 (Mathews et al., 1999Down ).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Nucleotide sequences of Eo7-Wallace and Eo7-UMMC
The complete nucleotide sequences of Eo7-Wallace and Eo7-UMMC were assembled separately from sequence data derived from 15 PCR products using the 15 degenerate primer pairs and a further 15 PCR products using the 15 virus-specific primer pairs (Table 1Up). The 5' termini were verified by 5' RACE. Thus, each nucleotide of the genome was sequenced at least four times. The complete nucleotide sequences of the two strains have been deposited in GenBank under accession numbers AY036578 (UMMC) and AY036579 (Wallace). The Eo7-Wallace genome is 7427 nt in length, excluding the poly(A) tail. The 5' UTR contains 742 nt, followed by an ORF that encodes a viral polyprotein consisting of 2195 codons, between a start codon (AUG) at position 743 and a stop codon (UAA) at position 7325. The 3' UTR is 100 nt in length. The Eo7-UMMC genome is 7426 nt in length, excluding the poly(A) tail. Thus, the Eo7-UMMC genome is one nucleotide shorter than that of Eo7-Wallace, with the difference located within the 5' UTR. The two virus genomes share identical nucleotide lengths within the ORF and 3' UTR. Thus, the ORF of Eo7-UMMC commences at nt 742 and finishes at nt 7324.

Sequence comparison between the genomes of Eo7-Wallace and Eo7-UMMC
The sequences of the 5' UTRs of Eo7-Wallace and Eo7-UMMC were aligned using Clone Manager 5/Align Plus 4 software (Fig. 1aDown). Two regions with higher sequence variation (underlined) were noted; region one extends from nt 89 to 168 and region two corresponds to the last 100 nt (643–742) of the 5' UTR. Within the first more-variable region, Eo7-UMMC has a 2-base (AT) deletion at positions 102 and 103 but has an extra base (A) at position 127, compared with the 5' UTR sequence of Eo7-Wallace (Fig. 1aDown, bold and italic). The degree of nucleotide identity between the two 5' UTRs is shown in Table 2Down.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of untranslated regions of Eo7-Wallace and Eo7-UMMC. (a) Alignment of the 5' UTR and (b) alignment of the 3' UTR. Regions of higher nucleotide variability are underlined.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Nucleotide and deduced amino acid sequence identity between Eo7-Wallace and Eo7-UMMC

 
An alignment of the 3' UTRs of Eo7-Wallace and Eo7-UMMC is shown in Fig. 1(b)Up. There are only 12 nucleotide differences between the two and the variation is distributed within two regions. The 3' UTR has the highest level of nucleotide identity (88% between the two viral genomes; Table 2Up).

An alignment of the deduced polyprotein sequences of Eo7-Wallace and Eo7-UMMC is shown in Fig. 2Down. The initiation site for the synthesis of the viral polyprotein and the predicted cleavage sites for the individual peptides were based on homology with other enteroviruses and with the established sequence motifs of enterovirus protein-cleavage sites (Pallansch et al., 1984Down ; Kozak, 1986Down ; Pincus et al., 1986Down ; Jenkins et al., 1987Down ). The cleavage sites and individual peptides are indicated by downward-pointing arrows immediately above the cleavage site of the aligned sequences (Fig. 2Down). The amino acid motifs (Fig. 2Down, in bold) involved in the cleavage of the polyprotein are identical for Eo7-Wallace and Eo7-UMMC and the various viral peptides are of equal lengths. The degree of nucleotide and amino acid sequence identity between the two viruses is shown in Table 2Up. Overall, the degree of identity between the two ORFs is 80 (nt) and 96 (aa) %. As expected, the P3 region (nt 82%; aa 97%) had the highest level of identity, followed by the P1 (nt 78%; aa 95%) and P2 (nt 79%; aa 95%) regions. Of the individual proteins, 3C had the highest level of identity (98%) and 2A had the lowest level of identity (92%).



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 2. Alignment of the deduced amino acid sequences of the polyproteins of Eo7-Wallace and Eo7-UMMC. The cleavage sites and the adjacent functional peptides (proteins) are indicated by downward-pointing arrows and labelled accordingly immediately above the cleavage site. The amino acids involved in the cleavage of the polyprotein into individual functional proteins are in bold. The highly conserved motif GDD found in positive-sense RNA polymerases is in bold and italic.

 
Comparison of the secondary RNA structures of the 5' and 3' UTRs
Putative RNA secondary structures of the 5' UTR and 3' UTR of Eo7-Wallace and Eo7-UMMC were constructed using RNAStructure, version 3.5, and are shown in Figs 3Down and 4Down. Both the 5' and 3' UTR RNA secondary structures of Eo7-UMMC [{Delta}G=-272 kcal/mol (-65 kJ/mol) and -32·4 kcal/mol (-7·7 kJ/mol)] have a thermodynamically more favourable energy level compared with Eo7-Wallace [{Delta}G=-256 kcal/mol (-61 kJ/mol) and -31·5 kcal/mol (-7·5 kJ/mol)]. Furthermore, the 5' UTR RNA secondary structure of Eo7-UMMC [{Delta}G=-253·1 kcal/mol (-60·5 kJ/mol)] remained at a thermodynamically more stable energy level than that of Eo7-Wallace [{Delta}G=-239·5 kcal/mol (-57·2 kJ/mol)] when re-analysed by arbitrarily removing 100 nt proximal to the putative start codon (data not shown). Similarly, the 3' UTR RNA secondary structure of Eo7-UMMC [{Delta}G=-35·1 kcal/mol (-8·4 kJ/mol)] remained at a lower energy level compared with Eo7-Wallace [{Delta}G=-26·5 kcal/mol (-6·3 kJ/mol)] when an arbitrary 100 nt poly(A) tail was added to the 3' end (data not shown). In contrast to the 3' UTR RNA secondary structures of both viruses (Fig. 4Down), the RNA secondary structures of the 5' UTRs appeared to have quite different configurations (Fig. 3Down). In the case of the 5' UTR RNA secondary structure of Eo7-UMMC, domains II and VI were closer to domain I; these two domains (II and VI) correspond to regions of lower nucleotide sequence identity (Fig. 1aUp). Domain IV of Eo7-UMMC 5' UTR RNA secondary structure also appeared to have a larger number of putative stem–loop structures. The configurations of domains I–V of the 5' UTR RNA secondary structures of both viruses were not affected by the arbitrary removal of 100 nt proximal to the putative start codon (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. The predicted RNA secondary structures of the 5' UTRs of Eo7-Wallace (a) and Eo7-UMMC (b), generated by the computer program RNAStructure version 3.5. The predicted structural domains are shown in roman numerals (bold).

 


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. The predicted RNA secondary structures of the 3' UTRs of Eo7-Wallace (a) and Eo7-UMMC (b), generated by the computer program RNAStructure version 3.5.

 
Sequence comparison of Eo7 (Wallace and UMMC) with other human enteroviruses
The complete nucleotide sequences of several human enteroviruses were aligned with the complete nucleotide sequences of Eo7-Wallace and Eo7-UMMC using Clone Manager 5/Align Plus 4 software. The 5' UTR, P1, P2, P3 and 3' UTR regions were identified and aligned separately. The degrees of identity of the complete genomic sequences and sub-genomic regions are shown in Table 3Down. Eo7-Wallace and Eo7-UMMC were most closely related to Eo11. By contrast, the 5' UTR and P3 regions of the two Eo7 strains were most homologous to the coxsackie B viruses and the P2 and 3' UTR regions were most homologous to Eo5. Similar to the complete genomic sequence, the P1 region has the closest similarity to Eo11. As expected, the P1 regions of Eo7-Wallace and Eo7-UMMC had the lowest degree of identity, not only to one another, but also to other enterovirus serotypes.


View this table:
[in this window]
[in a new window]
 
Table 3. Nucleotide sequence identity between Eo7 and other selected enterovirus serotypes

 
Phylogenetic relationships of Eo7 (Wallace and UMMC) to other enteroviruses
To assess the broad genetic relationships between some representative human enteroviruses, Eo7-Wallace and Eo7-UMMC, phylogenetic trees based on the 5' UTR nucleotide sequences and deduced polyprotein sequences were constructed. As reported in other studies, the human enteroviruses cluster into two major groups based on their 5' UTR sequences (Pöyry et al., 1996Down ) and into four species based on their deduced polyprotein sequences; the latter has been adopted as the formal classification with the genus Enterovirus (King et al., 2000Down ). A phylogenetic tree based on the 5' UTR sequence shows that both Eo7-Wallace and Eo7-UMMC belong to the coxsackievirus B–echovirus cluster (Fig. 5aDown); Eo7-Wallace appears to be closely related to CB1 and CB3 and Eo7-UMMC appears to be closely related to CB2, Eo6 and CB6. A phylogenetic tree based on the polyprotein sequence (Fig. 5bDown) shows that both Eo7-Wallace and Eo7-UMMC are closely linked and belong the species human enterovirus B. The topology of the tree based on the whole polyprotein was very similar to the topology of trees based on the VP1 gene or the 3' half of the VP1 gene alone (data not shown) (Oberste et al., 1999aDown , bDown ; Norder et al., 2001Down ).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. Phylogenetic trees based on 5' UTR nucleotide sequences (a) and deduced polyprotein amino acid sequences (b) of viruses belonging to the genus Enterovirus. The unrooted bootstrapped neighbour-joining trees were generated by using the Clustal X and PHYLIP programs and the branch lengths represent relative genetic distances. Abbreviations and GenBank accession numbers are given in Methods. In (b), members within related clusters are enclosed in circles. The topologies of both trees support the inclusion of Eo7-Wallace and Eo7-UMMC within the species human enterovirus B (King et al., 2000Down ).

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
An outbreak of HFMD occurred in peninsular Malaysia during the latter part of 2000. In addition to EV71, other enterovirus serotypes, including CA16 and Eo7, were isolated from HFMD cases. Furthermore, Eo7 was the sole pathogen isolated from three cases of acute encephalomyelitis, a clinical syndrome similar to that of EV71-associated brainstem encephalitis observed during HFMD epidemics in Malaysia in 1997 (Lum et al., 1999a, b) and in Taiwan in 1998 (Liu et al., 2000Down ). In addition, one of the Eo7-infected children presented with HFMD. To our knowledge, HFMD has not been associated previously with acute Eo7 infection. Although most of the earlier reports of Eo7 infection have indicated that the virus gives rise primarily to mild disease or asymptomatic infection, several reports have shown that it may cause sporadic cases or small outbreaks of severe and fatal encephalitis in otherwise healthy children. Madhavan & Sharma (1969)Down reported that Eo7 was the predominant virus isolated from 26 cases of encephalitis in Pondicherry, India. Several of these patients died within a few hours of admission to hospital, but unfortunately no other clinical details are available. In 1973, two mixed enterovirus epidemics of aseptic meningitis and meningoencephalitis, caused by Eo7 and CB5, were reported in Sweden (Andersson et al., 1975Down ). In these outbreaks, milder central nervous system disease, in particular aseptic meningitis, was attributed to Eo7. Fatal Eo7 infections have also been reported during outbreaks in neonatal intensive care units (Wreghitt et al., 1989Down ).

Analysis of the complete nucleotide and deduced amino acid sequence of the UMMC strain confirmed its original identification in neutralization tests as Eo7 (Lum et al., 2001Down ). Sequence homology studies based on alignment of the complete genome and sub-genomic regions showed clearly that Eo7-UMMC is not a recombinant virus. However, the data indicate that the sequence of Eo7-UMMC has drifted significantly from that of the prototype Eo7 (Wallace) strain in the 47 years that separate the isolation of the two strains. Comparison of the Eo7-UMMC sequence with available sequence data from other recent Eo7 strains shows that it is closely related to recent isolates of Eo7 (94% nucleotide sequence identity), with the greatest sequence identity being to a recent Eo7 isolate from Spain (GenBank accession no. AF252186; data not shown). The VP1 sequence of Eo7-Wallace reported here differs from that reported by Oberste et al. (1999Down a) (accession no. AF081324) by three nucleotides (one amino acid; methionine to valine). By contrast, our Eo7-Wallace VP1 sequence exactly matches the VP1 gene sequence of Eo7-Wallace reported by J. L. Bailly and others (unpublished accession no. AJ241426), suggesting that the AF081324 VP1 sequence of Eo7-Wallace may have been inaccurate or derived from a clone that was genetically diverged from that sequenced as AJ241426 and by ourselves.

An interesting result has emerged from comparison of the putative RNA secondary structure of the UTRs of Eo7-UMMC and Eo7-Wallace. The secondary structures of both the 5' and 3' UTRs of Eo7-UMMC ‘fold’ at a thermodynamically lower energy level than Eo7-Wallace and are presumably more stable. The extent to which the neurovirulence phenotype of Eo7 may be influenced by a thermodynamically more stable 5' UTR secondary structure requires further study. Interestingly, similar analysis of the folding energy levels of the putative 5' UTR secondary structures of poliovirus 1 Mahoney [accession no. J02281, {Delta}G=-242·0 kcal/mol (-57·8 kJ/mol)], Sabin 1 [accession no. J02282, {Delta}G=-246·7 kcal/mol (-58·9 kJ/mol)] and a neurovirulent isolate [accession no. AJ132961, {Delta}G=-250·8 kcal/mol (-59·9 kJ/mol)], poliovirus 2 Lansing [accession no. M12197, {Delta}G=-251·7 kcal/mol (-60·1 kJ/mol)] and Sabin 2 P712 Ch 2ab [accession no. X00595, {Delta}G=-246·2 kcal/mol (-58·8 kJ/mol)] and poliovirus 3 P3/Leon/37 [accession no. K01392, {Delta}G=-275·4 kcal/mol (-65·8 kJ/mol)] and Sabin 3 [accession no. AJ293918, {Delta}G=-239·0 kcal/mol (-57·1 kJ/mol)] has shown that the 5' UTR secondary structures of the neurovirulent or wild strains are at a thermodynamically lower energy level than those of the attenuated Sabin strains, with the exception of the poliovirus 1 Mahoney strain (data not shown). Furthermore, the 5' UTR RNA secondary structure of Eo7-UMMC assumed a configuration that is quite distinct from that of Eo7-Wallace. The UTR of the enterovirus genome is known to form secondary, and possibly higher order, RNA structures. Biochemical and genetic data have been used to support a model of the secondary structural motifs within the 5' UTR of poliovirus (Skinner et al., 1989Down ; Pilipenko et al., 1989Down ). Secondary structural models of the 5' UTR of CB1 (Iizuka et al., 1987Down ), CB3, CB4 (Skinner et al., 1989Down ), CA9 (Chang et al., 1989Down ) and swine vesicular disease virus (Inoue et al., 1989Down ; Seechurn et al., 1990Down ) are also generally consistent with this hypothesis. The enterovirus 5' UTR contains an internal ribosome entry site (IRES) that plays a major role in the control of virus replication and translation and possibly other virus functions; the IRES is considered to result from the formation of RNA secondary structures within the 5' UTR. The following observations, among others, appear to support this concept. Some natural or engineered mutations in the 5' UTR affect the translation activity of poliovirus RNA in vitro (Svitkin et al., 1985Down ; Pelletier et al., 1988Down ; Bienkowska-Szewczyk & Ehrenfeld, 1988Down ; Minor, 1992Down ) and the efficiency of virus replication (Racaniello & Meriam, 1986Down ; Kuge & Nomoto, 1987Down ; Johnson & Semler, 1988Down ; Trono et al., 1988aDown , bDown ). These findings undoubtedly point to an important functional significance of the picornavirus 5' UTR. The deviation of the Eo7-UMMC 5' UTR from that of the prototype Eo7 may have contributed to the phenotypic changes observed during the 2000 HFMD outbreak in peninsular Malaysia. However, the extent to which the changes in primary structure of the Eo7-UMMC 5' UTR may lead to changes in its secondary structure and influence pathogenesis and neurovirulence remain speculative. A study of the translation efficiency in vitro of infectious cDNA clone-derived recombinant viruses expressing the 5' UTR of Eo7-Wallace on the Eo7-UMMC genetic background and the pathogenic potential of the recombinant viruses in transgenic mice expressing the receptor for Eo7 (decay-accelerating factor, CD55) are ongoing.

To our knowledge, Eo7 infection has not previously been associated with HFMD. In the 2000 HFMD outbreak in peninsular Malaysia, Eo7 was isolated from both fatal and non-fatal cases (Lum et al., 2001Down ). Our analysis failed to find any evidence for the UMMC strain having originated through recombination of Eo7 with CA16, EV71 or another member of the species human enterovirus A. This finding is supported by the topology of the polyprotein-based phylogenetic tree, which showed clearly that Eo7-UMMC and Eo7-Wallace belong to the species human enterovirus B. Initial speculation for the unusual phenotypic manifestation of HFMD due to Eo7-UMMC was based on its close genetic similarity to CA9 (Table 3Up), an enterovirus known to give rise to vesicular eruptions (Melnick, 1996Down ). However, as shown in Table 3Up, the genome of Eo7-Wallace actually has slightly closer similarity than that of Eo7-UMMC to that of CA9. Thus, the molecular features of Eo7-UMMC that contribute to its unusual phenotype remain largely unknown. However, it is possible that changes in the 5' UTR may have contributed to its dermatotropism and neurovirulence.


   Acknowledgments
 
This project was funded by a research grant (IRPA 06-02-03-0528) from the Ministry of Science, Technology and the Environment of Malaysia (MOSTE). We thank Y. P. Chan, M. E. Lim, Dr David W. Smith and Brian Brestovac for their contributions in performing the sequencing reactions.


   Footnotes
 
The complete nucleotide sequences of Eo7 strains UMMC and Wallace have been deposited in GenBank under accession numbers AY036578 and AY036579, respectively.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Andersson, S. O., Bjorksten, B. & Burman, L. A. (1975). A comparative study of meningoencephalitis epidemics caused by echovirus type 7 and coxsackievirus type B5. Clinical and virological observations during two epidemics in northern Sweden. Scandinavian Journal of Infectious Diseases 7, 233-237.[Medline]

Bienkowska-Szewczyk, K. & Ehrenfeld, E. (1988). An internal 5'-noncoding region required for translation of poliovirus RNA in vitro. Journal of Virology 62, 3068-3072.[Abstract/Free Full Text]

Chang, K. H., Auvinen, P., Hyypiä, T. & Stanway, G. (1989). The nucleotide sequence of coxsackievirus A9; implications for receptor binding and enterovirus classification. Journal of General Virology 70, 3269-3280.[Abstract/Free Full Text]

Dougherty, R. M. (1964). Animal virus titration technique. In Techniques in Experimental Virology , pp. 169-224. Edited by R. J. C. Harris. London & New York:Academic Press..

Felsenstein, J. (1993). PHYLIP (Phylogeny Inference Package) version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle, WA, USA.

Higgins, D. G. & Sharp, P. M. (1989). Fast and sensitive multiple sequence alignments on a microcomputer. Computer Applications in the Biosciences 5, 151-153.[Abstract/Free Full Text]

Ho-Yen, D. O., Hardie, R., McClure, J., Cunningham, N. E. & Bell, E. J. (1989). Fatal outcome of echovirus 7 infection. Scandinavian Journal of Infectious Diseases 21, 459-461.[Medline]

Iizuka, N., Kuge, S. & Nomoto, A. (1987). Complete nucleotide sequence of the genome of coxsackievirus B1. Virology 156, 64-73.[Medline]

Inoue, T., Suzuki, T. & Sekiguchi, K. (1989). The complete nucleotide sequence of swine vesicular disease virus. Journal of General Virology 70, 919-934.[Abstract/Free Full Text]

Jenkins, O., Booth, J. D., Minor, P. D. & Almond, J. W. (1987). The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the Picornaviridae. Journal of General Virology 68, 1835-1848.[Abstract/Free Full Text]

Johnson, V. H. & Semler, B. L. (1988). Defined recombinants of poliovirus and coxsackievirus: sequence-specific deletions and functional substitutions in the 5'-noncoding regions of viral RNAs. Virology 162, 47-57.[Medline]

King, A. M. Q., Brown, F., Christian, P., Hovi, T., Hyypiä, T., Knowles, N. J., Lemon, S. J., Minor, P. D., Palmenberg, A. C., Skern, T. & Stanway, G. (2000). Family Picornaviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 657-678. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.

Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292.[Medline]

Kuge, S. & Nomoto, A. (1987). Construction of viable deletion and insertion mutants of the Sabin strain of type 1 poliovirus: function of the 5' noncoding sequence in viral replication. Journal of Virology 61, 1478-1487.[Abstract/Free Full Text]

Liu, C. C., Tseng, H. W., Wang, S. M., Wang, J. R. & Su, I. J. (2000). An outbreak of enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical manifestations. Journal of Clinical Virology 17, 23-30.[Medline]

Lum, L. C. S., Wong, K. T., Lam, S. K., Chua, K. B., Goh, A. Y. T., Lim, W. L., Ong, B. B., Paul, G., AbuBakar, S. & Lambert, M. (1998a). Fatal enterovirus 71 encephalomyelitis. Journal of Pediatrics 133, 795-798.[Medline]

Lum, L. C. S., Wong, K. T., Lam, S. K., Chua, K. B. & Goh, A. Y. T. (1998b). Neurogenic pulmonary oedema and enterovirus 71 encephalomyelitis. Lancet 352, 1391.

Lum, L. C. S., Chua, K. B., McMinn, P. C., Goh, A. Y. T., Muridan, R., Sarji, S. A., Hooi, P. S., Chua, B. H. & Lam, S. K. (2001). Echovirus 7-associated encephalomyelitis. Journal of Clinical Virology (in press).

Madhavan, H. N. & Sharma, K. B. (1969). Enteroviruses from cases of encephalitis in Pondicherry. Indian Journal of Medical Research 57, 1607-1610.[Medline]

Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of Molecular Biology 288, 911-940.[Medline]

Melnick, J. L. (1996). Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and newer enteroviruses. In Fields Virology , pp. 655-712. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Minor, P. D. (1992). The molecular biology of poliovaccines. Journal of General Virology 73, 3065-3077.[Abstract/Free Full Text]

Norder, H., Bjerregaard, L. & Magnius, L. O. (2001). Homotypic echoviruses share aminoterminal VP1 sequence homology applicable for typing. Journal of Medical Virology 63, 35-44.[Medline]

Oberste, M. S., Maher, K., Kilpatrick, D. R. & Pallansch, M. A. (1999a). Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. Journal of Virology 73, 1941-1948.[Abstract/Free Full Text]

Oberste, M. S., Maher, K., Kilpatrick, D. R., Flemister, M. R., Brown, B. A. & Pallansch, M. A. (1999b). Typing of human enteroviruses by partial sequencing of VP1. Journal of Clinical Microbiology 37, 1288-1293.[Abstract/Free Full Text]

Page, R. D. (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.[Free Full Text]

Pallansch, M. A., Kew, O. M., Semler, B. L., Omilianowski, D. R., Anderson, C. W., Wimmer, E. & Rueckert, R. R. (1984). Protein processing map of poliovirus. Journal of Virology 49, 873-880.[Abstract/Free Full Text]

Pelletier, J., Kaplan, G., Racaniello, V. R. & Sonenberg, N. (1988). Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region. Molecular and Cellular Biology 8, 1103-1112.[Abstract/Free Full Text]

Pilipenko, E. V., Blinov, V. M., Romanova, L. I., Sinyakov, A. N., Maslova, S. V. & Agol, V. I. (1989). Conserved structural domains in the 5'-untranslated region of picornaviral genomes: an analysis of the segment controlling translation and neurovirulence. Virology 168, 201-209.[Medline]

Pincus, S. E., Diamond, D. C., Emini, E. A. & Wimmer, E. (1986). Guanidine-selected mutants of poliovirus: mapping of point mutations to polypeptide 2C. Journal of Virology 57, 638-646.[Abstract/Free Full Text]

Pöyry, T., Kinnunen, L., Hyypiä, T., Brown, B., Horsnell, C., Hovi, T. & Stanway, G. (1996). Genetic and phylogenetic clustering of enteroviruses. Journal of General Virology 77, 1699-1717.[Abstract/Free Full Text]

Racaniello, V. R. & Meriam, C. (1986). Poliovirus temperature-sensitive mutants containing a single nucleotide deletion in the 5'-noncoding region of the viral RNA. Virology 155, 498-507.[Medline]

Ramos-Alvaraz, M. & Sabin, A. (1954). Characteristics of poliomyelitis and other enteric viruses recovered in tissue culture from healthy American children. Proceedings of the Society for Experimental Biology and Medicine 87, 655-661.

Seechurn, P., Knowles, N. J. & McCauley, J. W. (1990). The complete nucleotide sequence of a pathogenic swine vesicular disease virus. Virus Research 16, 255-274.[Medline]

Skinner, M. A., Racaniello, V. R., Dunn, G., Cooper, J., Minor, P. D. & Almond, J. W. (1989). New model for the secondary structure of the 5' non-coding RNA of poliovirus is supported by biochemical and genetic data that also show that RNA secondary structure is important in neurovirulence. Journal of Molecular Biology 207, 379-392.[Medline]

Svitkin, Y. V., Maslova, S. V. & Agol, V. I. (1985). The genomes of attenuated and virulent poliovirus strains differ in their in vitro translation efficiencies. Virology 147, 243-252.[Medline]

Tillett, D., Burns, B. P. & Neilan, B. A. (2000). Optimized rapid amplification of cDNA ends (RACE) for mapping bacterial mRNA transcripts. Biotechniques 28, 448-456.[Medline]

Trono, D., Andino, R. & Baltimore, D. (1988a). An RNA sequence of hundreds of nucleotides at the 5' end of poliovirus RNA is involved in allowing viral protein synthesis. Journal of Virology 62, 2291-2299.[Abstract/Free Full Text]

Trono, D., Pelletier, J., Sonenberg, N. & Baltimore, D. (1988b). Translation in mammalian cells of a gene linked to the poliovirus 5' noncoding region. Science 241, 445-448.[Abstract/Free Full Text]

Wreghitt, T. G., Sutehall, G. M., King, A. & Gandy, G. M. (1989). Fatal echovirus 7 infection during an outbreak in a special care baby unit. Journal of Infection 19, 229-236.[Medline]

Received 5 June 2001; accepted 6 August 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
E. C. M. Leitch, J. Bendig, M. Cabrerizo, J. Cardosa, T. Hyypia, O. E. Ivanova, A. Kelly, A. C. M. Kroes, A. Lukashev, A. MacAdam, et al.
Transmission Networks and Population Turnover of Echovirus 30
J. Virol., March 1, 2009; 83(5): 2109 - 2118.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. O. Weinzierl, D. Rudolf, D. Maurer, D. Wernet, H.-G. Rammensee, S. Stevanovic, and K. Klingel
Identification of HLA-A*01- and HLA-A*02-restricted CD8+ T-cell epitopes shared among group B enteroviruses
J. Gen. Virol., September 1, 2008; 89(9): 2090 - 2097.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Simmonds and J. Welch
Frequency and Dynamics of Recombination within Different Species of Human Enteroviruses
J. Virol., January 1, 2006; 80(1): 483 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. S. Oberste, K. Maher, S. M. Michele, G. Belliot, M. Uddin, and M. A. Pallansch
Enteroviruses 76, 89, 90 and 91 represent a novel group within the species Human enterovirus A
J. Gen. Virol., February 1, 2005; 86(2): 445 - 451.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. N. Lukashev, V. A. Lashkevich, G. A. Koroleva, J. Ilonen, and A. E. Hinkkanen
Recombination in uveitis-causing enterovirus strains
J. Gen. Virol., February 1, 2004; 85(2): 463 - 470.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. S. Oberste, K. Maher, and M. A. Pallansch
Evidence for Frequent Recombination within Species Human Enterovirus B Based on Complete Genomic Sequences of All Thirty-Seven Serotypes
J. Virol., January 15, 2004; 78(2): 855 - 867.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. N. Lukashev, V. A. Lashkevich, O. E. Ivanova, G. A. Koroleva, A. E. Hinkkanen, and J. Ilonen
Recombination in Circulating Enteroviruses
J. Virol., October 1, 2003; 77(19): 10423 - 10431.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chua, B. H.
Right arrow Articles by Chua, K. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chua, B. H.
Right arrow Articles by Chua, K. B.
Agricola
Right arrow Articles by Chua, B. H.
Right arrow Articles by Chua, K. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS