J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Costa-Mattioli, M.
Right arrow Articles by Cristina, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Costa-Mattioli, M.
Right arrow Articles by Cristina, J.
Agricola
Right arrow Articles by Costa-Mattioli, M.
Right arrow Articles by Cristina, J.
Journal of General Virology (2001), 82, 2647-2652.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Genetic variability of hepatitis A virus in South America reveals heterogeneity and co-circulation during epidemic outbreaks

Mauro Costa-Mattioli1,2, Virginie Ferre1, Serge Monpoeho1, Laura Garcia2, Rodney Colina2,3, Sylviane Billaudel1, Ines Vega4, Raul Perez-Bercoff5 and Juan Cristina2

Laboratorie de Virologie, Institut de Biologie, Centre Hospitalier Regional Universitaire de Nantes, Rue Quai Moncousu 9, 44093 Nantes, France1
Departamento de Técnicas Nucleares Aplicadas, Centro de Investigaciones Nucleares, Facultad de Ciencias, Universidad de la República, Iguá 4225, 11400 Montevideo, Uruguay2
Laboratorio de Biología Molecular, Asociación Española Primera de Socorros Mutuos, Boulevard Artigas 1465, 11200 Montevideo, Uruguay3
Instituto de Hematologia, Facultad de Medicina, Universidad Austral de Chile, Casilla 567, Valdivia, Chile4
Department of Cellular and Developmental Biology, University of Rome La Sapienza, Viale di Porta Tiburtina 28, 00185 Roma, Italy5

Author for correspondence: Juan Cristina. Fax +598 2 525 08 95. e-mail cristina{at}cin1.cin.edu.uy


   Abstract
TOP
Abstract
Main text
References
 
Genetic analysis of selected genome regions of hepatitis A virus (HAV) suggested that distinct genotypes of HAV could be found in different geographical regions. In order to gain insight into the genetic variability and mode of evolution of HAV in South America, an analysis was performed of sequence data obtained from the VP1 amino terminus and the VP1/2A region of HAV strains isolated over a short period of time in Uruguay, Argentina and Chile. Sequences obtained from 22 distinct HAV isolates were compared with published sequences from 21 different strains isolated all over the world. Phylogenetic analysis revealed that all strains isolated belong to a unique sub-genotype (IA). Strains isolated during an outbreak period showed a higher degree of heterogeneity than anticipated previously and the co-circulation of different isolates. The genetic variability among strains isolated in this region seems to be higher in comparison with strains isolated in other regions of the world.


   Main text
TOP
Abstract
Main text
References
 
Human hepatitis A virus (HAV) is a hepatotropic member of the family Picornaviridae (Melnick, 1982Down ; Matthews, 1982Down ). Despite its overall physical and epidemiological similarity to enteroviruses, the structural composition of HAV, its tissue tropism and genetic distance from other members of the family indicate that HAV is unique within this family (Ticehurst et al., 1988Down ; Palmenberg, 1989Down ; Wimmer & Murdin, 1991Down ). Early comparative studies of the nucleotide sequences of different HAV strains suggested that isolates of diverse origin were closely related (Ticehurst et al., 1989Down ). However, more recent nucleotide sequencing of variable genome regions, encoding the VP1 amino terminus and the putative VP1/2A junction of wild-type HAV strains present in human specimens from different regions of the world, has demonstrated substantial sequence heterogeneity (Robertson et al., 1991Down , 1992Down ; Taylor, 1997Down ). These studies have suggested that sequence relatedness can be correlated with the geographical area of virus isolation (Robertson et al., 1991Down ). Using this approach, seven distinct genotypes of HAV have been defined worldwide (Robertson et al., 1992Down ). In order to study the genetic variation of HAV strains circulating in South America, 10 IgM anti-HAV-positive serum samples from patients were collected at Pereira Rossell Hospital and Asociación Española Primera de Socorros Mutuos Hospital during an epidemic outbreak that occurred in Montevideo (Uruguay) from September 1999 to February 2000. Over the same period of time, eight stool samples from Chilean patients were collected at Hospital Regional in Valdivia and four stool samples from Argentinian patients were collected at Hospital San Juan de Dios in Buenos Aires. For diagnostic screening of HAV, we used a real time RT–PCR assay based on a conserved region of the 5' non-coding region. The primers sequences were as follows: forward primer HAV1 (5' TTTCCGGAGCCCCTCTTG 3'), reverse primers HAV2 (5' AAAGGGAAATTTAGCCTATAGCC 3') and HAV3 (5' AAAGGGAAAATTTAGCCTATAGCC 3') and HAV-probe (5' FAM–ACTTGATACCTCACCGCCGTTTGCCT–TAMRA 3'; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxy-N,N,N',N'-tetramethylrhodamine).

Primers HAV2 and HAV3 differed by a single nucleotide that represents a deletion carried by some HAV strains (position 102, underlined in primer HAV3). An equimolecular mixture of the two primers was used in order to target all HAV strains encountered with the same efficiency. Twenty µl of the reaction mixture was added to PCR tubes containing 5 µl RNA from serum or stool samples. HAV RNA was reverse-transcribed into cDNA (40 min at 45 °C) and a 77 bp fragment was amplified by PCR (15 s at 94 °C and 1 min at 60 °C) for 45 cycles on an ABI Prism 7700 (Perkin Elmer). Samples testing positive in the RT–PCR screening were used in order to analyse the VP1 amino-terminal and/or the VP1/2A regions of the genome. We used an RT–PCR method based on primers described previously (Robertson et al., 1989Down , 1992Down ). PCR products were purified and sequenced directly using a Big Dye DNA sequencing kit (Perkin Elmer) on a 373 DNA Sequencer apparatus (Perkin Elmer). Using this approach, 147 nt sequences in the VP1 amino terminus and 168 nt sequences in the VP1/2A region were obtained for all 22 South American isolates.

In order to determine the degree of genetic variability and the heterogeneity of the South American strains, evolutionary analysis was done by alignment of the VP1 amino-terminal region of 22 HAV strains recovered from the three different South American countries with three strains reported previously from Brazil and 21 other strains from different genotypes and geographical origins. The origins of the sequences and the strains used are listed in Table 1Down. Sequences were aligned using the CLUSTAL W program (Thompson et al., 1994Down ). A matrix of distances for Kimura’s two-parameter model was then generated (Felsenstein, 1993Down ) and used to compute neighbour-joining phylogenetic trees. Their reliability was assessed by bootstrap resampling (1000 pseudo-replicas). These methods were implemented with software from the MEGA program (Kumar et al., 1994Down ).


View this table:
[in this window]
[in a new window]
 
Table 1. Origin of HAV strains

 
The results of these studies are shown in Fig. 1(a)Down. As can be seen, the majority of the strains included in this study, which are known to be genotype IA, clustered together. Strains belonging to other HAV genotypes clustered separately. All South American strains clustered inside the IA cluster, showing that all the South American strains included in this study, which to our knowledge is the most extensive genetic study in the region, belong to a unique sub-genotype. Nevertheless, genetic heterogeneity was observed inside the main IA cluster, since the South American strains (even those isolated in the same country) appeared on separate branches. Interestingly, in contrast to what has been reported previously for strains isolated in the USA and China (Robertson et al., 1992Down ), no geographically related cluster was found for the South American strains in this sub-genotype (see Fig. 1aDown).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic tree analysis of VP1 amino terminus (a) and VP1/2A sequences (b) of HAV strains isolated in South America using Kimura’s two-parameter model. Genotypes are shown in parentheses for strains reported previously (see Table 1Up for geographical location and year of isolation and accession numbers). Numbers at the branches show bootstrap percentages obtained after 1000 replications of bootstrap sampling. Bars show distances.

 
In order to confirm these findings, sequences corresponding to the VP1/2A region were obtained from the same 22 individual HAV strains recovered from the South American patients (see Table 1Up). Again, these sequences were aligned with sequences from different genotypes and geographical origins and phylogenetic trees were created as described previously. The results of these studies are shown in Fig. 1(b)Up.

As can be seen in the figure, all the South American strains also clustered together in this region with all known IA strains. Strains belonging to other genotypes also clustered separately in this case. Nevertheless, genetic heterogeneity was also observed inside cluster IA among South American strains for this region of the genome and no geographically related cluster was found.

In order to study whether the phylogenetic relationships observed among the strains were appropriate using Kimura’s two-parameter model (Felsenstein, 1993Down ), we performed the same studies described above using the model of Tamura & Nei (1993)Down . The results of these studies are shown in Fig. 2Down.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Phylogenetic tree analysis of the VP1 amino terminus (a) and VP1/2A sequences (b) of HAV strains isolated in South America using the Tamura–Nei model. Genotypes are shown in parentheses for strains reported previously. For further details see the legend to Fig. 1Up.

 
It can be seen from Fig. 2Up that the same results were obtained using Kimura’s two-parameter model and the Tamura–Nei model (Figs 1Up and 2Up). Furthermore, the studies were repeated using the model of Jukes & Cantor (1969)Down (data not shown) and, again, the same results were obtained.

The results of this study suggest that the population of HAV that is circulating endemically in South America belongs to just one sub-genotype (IA). All of the 25 HAV strains isolated in four different South American countries belong this sub-genotype (Figs 1Up and 2Up; Table 1Up). This is in contrast to what is observed in other regions of the world were HAV is endemic, like South Africa, where co-circulation of two different genotypes was observed (Taylor, 1997Down ). Moreover, in other regions of the world, like Europe and Japan, a more complex pattern is observed, since HAV isolates are derived from multiple genotypes, probably representing viruses imported from other regions (Robertson et al., 1992Down ; Apaire-Marchais et al., 1995Down ; Bruisten et al., 2001Down ). Genetic analysis of strains can therefore provide valuable information with regard to the source of the virus in both sporadic and epidemic infection (Apaire-Marchais et al., 1995Down ; Normann et al., 1995Down ; Kedda et al., 1995Down ).

The bootstrap values obtained in the phylogenetic trees allowed us to differentiate among the different genotypes and sub-types (Figs 1Up and 2Up). Nevertheless, bootstrap values within genotype IA did not allow us to establish definite relationships among strains situated in that cluster. However, the South American strains, isolated over a short period of time, even in the same country, were found not to be identical, and consequently more than one isolate was present and co-circulating in the same outbreak (Figs 1Up and 2Up). This was also unexpected, since the available data from other regions have shown that all isolates from the same outbreak were identical (Taylor, 1997Down ) or the majority of the cases were infected with the same strain (Robertson et al., 2000Down ). Moreover, strains isolated in North America (USA) show a very close genetic relationship among themselves and come from a country with low endemic rate for HAV, suggesting that they represent an almost exclusive endemic transmission of a predominant group of strains that continues to circulate in that region (Robertson et al., 1992Down ; see also Fig. 2Up). In contrast to this view, our results suggest that strains isolated in South America, which came from a region with a medium to high endemic pattern of HAV (Robertson et al., 1992Down ), have a higher degree of genetic variability.

In order to gain insight into the genetic variability of the VP1 amino terminus and the VP1/2A junction regions studied, the sequences of South American strains were compared to the corresponding sequences of strain HM-175 (Cohen et al., 1987Down ) (not shown). The percentage identity obtained for the VP1 amino terminus ranged from 87·1 to 91·2%, whereas the VP1/2A junction identity ranged from 88 to 92·3%. The sequences of both regions of the South American strains were then translated to amino acids and compared again with corresponding amino acid sequences from strain HM-175. This study revealed that there were more first- and second-base changes (7·1 and 14·3%, respectively) within the VP1 amino terminus (some of which resulted in non-homologous amino acid changes) than were found in the VP1/2A junction (6·7 and 10%). These results suggest that the VP1 amino terminus region of strains circulating in South America is slightly more variable than the VP1/2A junction region. This was also unexpected, since data reported previously from other regions of the world showed the VP1/2A region to be more variable (Robertson et al., 1991Down , 1992Down ; Robertson & Nainan, 1997Down ). This might be due, at least in part, to the fact that few strains isolated in South America were available when these studies were performed.

Recent studies suggest a changing epidemiological pattern in HAV infection throughout South America, which may result in more clinical cases in teenagers and adults and a greater potential for outbreaks (Tapia-Conyer et al., 1999Down ; Tanaka, 2000Down ). Whether this changing pattern is related to a higher genetic variability of HAV than previously expected, changes in hygiene conditions or a combination of these and other factors remains to be established.

Taking into account that partial sequencing of selected genome regions has been employed, a definitive picture of the biological meaning of these and other possible changes in the whole of the genome will emerge from more in-depth studies. Phylogenetic studies can provide important information for the design and evaluation of appropriate and suitable HAV vaccine candidate strain(s) for the South American region.


   Acknowledgments
 
J.C., S.B. and R.P.-B. gratefully acknowledge financial support from the Commission of the European Communities through contract no. IC18-CT98-0378 (DG12-CEOR). We would like to thank Héctor Romero and Héctor Musto, Laboratorio de Evolución y Organización del Genoma, Sección Bioquímica, Facultad de Ciencias, Montevideo, Uruguay, for help in the phylogenetic studies and helpful discussions. We also thank Dr Enrique Lessa, Laboratorio de Evolución, Facultad de Ciencias, Montevideo, Uruguay, for critical reading of the manuscript. We would also like to thank Drs Susana Fazzio and María Victoria González, Hospital Pereira Rossell, Montevideo, Uruguay, for help in collection of HAV specimens. We thank Dra Enriquetta Bertrán, Departamento de Epidemiología, Servicio de Salud, Valdivia, Chile, and Alejandro Castelo, Univeridad de Quilmes, Buenos Aires, Argentina, for help in collection of HAV specimens.


   Footnotes
 
The EMBL accession numbers of the sequences reported in this work are AJ406305–AJ406323, AJ306367–AJ306387 and AJ309219–AJ309234.


   References
TOP
Abstract
Main text
References
 
Apaire-Marchais, V., Robertson, B. H., Aubineau-Ferre, V., Le Roux, M. G., Leveque, F., Schwartzbrod, L. & Billaudel, S. (1995). Direct sequencing of hepatitis A virus strains isolated during an epidemic in France. Applied and Environmental Microbiology 61, 3977-3980.[Abstract]

Bruisten, S. M., Van Steenbergen, J. E., Pijl, A. S., Niesters, H. G. M., Van Doornum, G. J. J. & Coutinho, R. A. (2001). Molecular epidemiology of hepatitis A virus in Amsterdam, the Netherlands. Journal of Medical Virology 63, 88-95.[Medline]

Cohen, J. I., Ticehurst, J. R., Purcell, R. H., Buckler-White, A. & Baroudy, B. M. (1987). Complete nucleotide sequence of wild-type hepatitis A virus: comparison with different strains of hepatitis A virus and other picornaviruses. Journal of Virology 61, 50-59.[Abstract/Free Full Text]

Felsenstein, J. (1993). Phylogeny inference package, version 3.5. Department of Genetics, University of Washington, Seattle, USA.

Jukes, T. H. & Cantor, C. R. (1969). Evolution of protein molecules. In Mammalian Protein Metabolism , pp. 121-132. Edited by H. N. Munro. New York:Academic Press.

Kedda, M. A., Kew, M. C., Cohn, R. J., Field, S. P., Schwyzer, R., Song, E. & Fernandes-Costa, F. (1995). An outbreak of hepatitis A among South African patients with haemophilia: evidence implicating contaminated factor VIII concentrate as the source. Hepatology 22, 1363-1367.[Medline]

Khanna, B., Spelbring, J. E., Innis, B. L. & Robertson, B. H. (1992). Characterization of a genetic variant of human hepatitis A virus. Journal of Medical Virology 36, 118-124.[Medline]

Kumar, S, Tamura, K. & Nei, M. (1994). MEGA: molecular evolutionary genetic analysis software for microcomputers. Computer Applications in the Biosciences 10, 189-191.[Abstract/Free Full Text]

Matthews, R. E. F. (editor) (1982). Classification and nomenclature of viruses. Fourth Report of the International Committee on Taxonomy of Viruses. Intervirology 17, 1–199.[Medline]

Melnick, J. L. (1982). Classification of hepatitis A virus as enterovirus type 72 and of hepatitis B virus as hepadnavirus type 1. Intervirology 18, 105-106.[Medline]

Normann, A., Pfisterer-Hunt, M., Schade, S., Graff, J., Chaves, R. L., Crovari, P., Icardi, G. & Flehmig, B. (1995). Molecular epidemiology of an outbreak of hepatitis A in Italy. Journal of Medical Virology 47, 467-471.[Medline]

Palmenberg, A. C. (1989). Sequence alignments of picornaviral capsid proteins. In Molecular Aspects of Picornaviral Infection and Detection. Edited by B. L. Semler & E. Ehenfeld. Washington, DC: American Society for Microbiology.

Robertson, B. H. & Nainan, O. V. (1997). Genetic and antigenic variants of hepatitis A virus. In Viral Hepatitis and Liver Diseases , pp. 14-18. Edited by M. Rizzetto, R. H. Purcell & G. Verme. Torino:Edizioni Minerva Medica.

Robertson, B. H., Brown, V. K. & Khanna, B. (1989). Altered hepatitis A VP1 protein resulting from cell culture propagation of virus. Virus Research 13, 207-212.[Medline]

Robertson, B. H., Khanna, B., Nainan, O. V. & Margolis, H. S. (1991). Epidemiologic patterns of wild-type hepatitis A virus determined by genetic variation. Journal of Infectious Diseases 163, 286-292.[Medline]

Robertson, B. H., Jansen, R. W., Khanna, B., Totsuka, A., Nainan, O. V., Siegl, G., Widell, A., Margolis, H. S., Isomura, S., Ito, K., Ishizu, T., Moritsugu, Y. & Lemon, S. W. (1992). Genetic relatedness of hepatitis A virus strains recovered from different geographical regions. Journal of General Virology 73, 1365-1377.[Abstract/Free Full Text]

Robertson, B. H., Averhoff, F., Cromeans, T. L., Han, X., Khoprasert, B., Nainan, O. V., Rosenberg, J., Paikoff, L., DeBess, E., Shapiro, C. N. & Margolis, H. S. (2000). Genetic relatedness of hepatitis A virus isolates during a community-wide outbreak. Journal of Medical Virology 62, 144-150.[Medline]

Tamura, K. & Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10, 512-526.[Abstract]

Tanaka, J. (2000). Hepatitis A shifting epidemiology in Latin America. Vaccine 18 (Suppl. 1), S57–S60.

Tapia-Conyer, R., Santos, J. I., Cavalcanti, A. M., Urdaneta, E., Rivera, L., Manterola, A., Potin, M., Ruttiman, R. & Tanaka Kido, J. (1999). Hepatitis A in Latin America: a changing epidemiologic pattern. American Journal of Tropical Medicine and Hygiene 61, 825-829.[Abstract]

Taylor, M. B. (1997). Molecular epidemiology of South African strains of hepatitis A virus: 1982–1996. Journal of Medical Virology 51, 273-279.[Medline]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Ticehurst, J., Cohen, J. I. & Purcell, R. H. (1988). Analysis of molecular sequences demonstrates that hepatitis A virus (HAV) is a unique picornavirus. In Viral Hepatitis and Liver Disease , pp. 33-35. Edited by A. J. Zuckerman. New York:Alan R. Liss.

Ticehurst, J., Cohen, J. I., Feinstone, S. M., Purcell, R. H., Jansen, R. W. & Lemon, S. M. (1989). Replication of hepatitis A virus: new ideas from studies with cloned cDNA. In Molecular Aspects of Picornaviral Infection and Detection , pp. 27-50. Edited by B. L. Semler & E. Ehenfeld. Washington, DC:American Society for Microbiology.

Wimmer, E. & Murdin, A. (1991). Hepatitis A and the molecular biology of picornaviruses: a case for a new genus of the family Picornaviridae. In Viral Hepatitis and Liver Disease , pp. 1-41. Edited by F. B. Hollinger, S. M. Lemon & H. S. Margolis. Baltimore:Williams & Wilkins.

Received 23 April 2001; accepted 17 July 2001.


This article has been cited by other articles:


Home page
Clin. Microbiol. Rev.Home page
O. V. Nainan, G. Xia, G. Vaughan, and H. S. Margolis
Diagnosis of Hepatitis A Virus Infection: a Molecular Approach
Clin. Microbiol. Rev., January 1, 2006; 19(1): 63 - 79.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. Lu, K. Z. Ching, V. S. de Paula, T. Nakano, G. Siegl, M. Weitz, and B. H. Robertson
Characterization of the complete genomic sequence of genotype II hepatitis A virus (CF53/Berne isolate)
J. Gen. Virol., October 1, 2004; 85(10): 2943 - 2952.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Costa-Mattioli, A. D. Napoli, V. Ferre, S. Billaudel, R. Perez-Bercoff, and J. Cristina
Genetic variability of hepatitis A virus
J. Gen. Virol., December 1, 2003; 84(12): 3191 - 3201.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Sanchez, A. Bosch, and R. M. Pinto
Genome Variability and Capsid Structural Constraints of Hepatitis A Virus
J. Virol., December 6, 2002; 77(1): 452 - 459.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
G. Sanchez, R. M. Pinto, H. Vanaclocha, and A. Bosch
Molecular Characterization of Hepatitis A Virus Isolates from a Transcontinental Shellfish-Borne Outbreak
J. Clin. Microbiol., November 1, 2002; 40(11): 4148 - 4155.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Costa-Mattioli, J. Cristina, H. Romero, R. Perez-Bercof, D. Casane, R. Colina, L. Garcia, I. Vega, G. Glikman, V. Romanowsky, et al.
Molecular Evolution of Hepatitis A Virus: a New Classification Based on the Complete VP1 Protein
J. Virol., August 12, 2002; 76(18): 9516 - 9525.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Costa-Mattioli, M.
Right arrow Articles by Cristina, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Costa-Mattioli, M.
Right arrow Articles by Cristina, J.
Agricola
Right arrow Articles by Costa-Mattioli, M.
Right arrow Articles by Cristina, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS