|
|
||||||||
Animal: RNA Viruses |
Laboratoire de Virologie et Pathogénèse Virale, CNRS UMR-5537, Faculté de Médecine RTH Laennec de Lyon, 7 rue Guillaume Paradin, 69372 Lyon Cedex 08, France1
Unité de Pathogénie des Infections à Lentivirus, INSERM U-372, Campus de Luminy, Marseille, France2
Author for correspondence: Pierre Boulanger. Fax +33 4 7877 8751. e-mail Pierre.Boulanger{at}laennec.univ-lyon1.fr
| Abstract |
|---|
|
|
|---|
p6-Gag and Vif proteins were co-encapsidated into intracellular VLP. Encapsidation of Vif occurred at significantly higher copy numbers in extracellular VLP formed from N-myristoylated, budding-competent GagPol precursors harbouring an inactive PR domain or in chimaeric VLP composed of Gag and GagPol precursors compared with the Vif content of Pr55Gag VLP. Vif encapsidation efficiency did not seem to correlate directly with VLP morphology, since these chimaeric VLP were comparable in size and shape to Pr55Gag VLP. Vif apparently inhibited PR-mediated Pr55Gag processing in vitro, with preferential protection of cleavage sites at the MACA and CANC junctions. Vif was resistant to PR action in vitro under conditions that allowed full Gag processing, and no direct interaction between Vif and PR was detected in vivo or in vitro. This suggested that inhibition by Vif of PR-mediated Gag processing resulted from interaction of Vif with the Gag substrate and not with the enzyme. Likewise, the higher efficiency of Vif encapsidation by GagPol precursor compared with Pr55Gag was probably not mediated by direct binding of Vif to the GagPol-embedded PR domain, but more likely resulted from a particular conformation of the Gag structural domains of the GagPol precursor. | Introduction |
|---|
|
|
|---|
Likewise, the cell-species restriction for vif-defective virus had originally led to the conclusion that cellular factors(s) could complement in trans the absence of vif functions. However, recent data suggest that Vif can counteract an inhibitory function present in non-permissive cell lines such as human T cells that interferes at late stages in the virus life cycle (Madani & Kabat, 1998
; Simon et al., 1998a
, b
). Thus, Hck, a tyrosine kinase of the Src family, has been shown to be able to inhibit the production and infectivity of vif-deleted virus, but not that of wild-type (WT) virus. The negative effect of Hck on HIV-1 replication is overcome by Vif (Hassaïne et al., 2001
). Vif has also been shown to interact with cytoskeleton elements (Karczewski & Strebel, 1996
) and to inhibit the proteolytic activity of HIV-1 protease (PR) in vitro and in bacteria, a function assigned to its N-terminal domain (Baraz et al., 1998
; Friedler et al., 1999
; Kotler et al., 1997
; Potash et al., 1998
).
Vif has been found to co-localize with Gag protein in human T cells (Simon et al., 1997
, 1999
) and to be associated with HIV-1 particles (Borman et al., 1995
; Goncalves et al., 1995
) as a genuine constitutive element of the virus core (Liu et al., 1995
). In good agreement with these data, co-precipitation experiments performed with HIV-infected H9 cell lysates suggested that a specific GagVif interaction occurred in human cells in vivo and that the NC domain was an essential determinant for the binding of Gag to Vif (Bouyac et al., 1997b
). Likewise, in insect cells that expressed both HIV-1 Gag precursor (Pr55Gag) and Vif protein, significant amounts of Vif were found to be co-encapsidated with Pr55Gag into membrane-enveloped Gag particles budding at the plasma membrane (Huvent et al., 1998
). Major Vif-interacting sites in Gag were mapped to two regions: (i) the C-terminal domain of Pr55Gag, spanning the second zinc finger of the NC domain, the spacer peptide (sp) 1 and the sp1p6 junction as far as the N-terminal proline-rich motif of the p6 domain (Huvent et al., 1998
); and (ii) the MACA junction (Bouyac et al., 1997b
). In Vif, the basic C-terminal domain and a discrete central region within residues 68100 were identified as major Gag-binding sites (Huvent et al., 1998
). Interestingly, mutations affecting the C-terminal domain of Vif and the central Gag-binding sites resulted in a vif- phenotype of HIV-1 virions produced by human cells (Bouyac et al., 1997b
).
Conflicting reports have concluded that Vif is associated with (Liu et al., 1995
; Y. Sun, J. Van Velkinburg and C. Aiken, personal communication) or is absent from (Dettenhofer & Yu, 1999
) highly purified HIV-1 virions and that the presence of Vif within the virion correlates with the level of the protein within the infected cells, rather than relating to specific viral incorporation of Vif (Simon et al., 1998c
). However, Vif has been shown to increase the stability of the virus core (Öhagen & Gabuzda, 2000
), suggesting that some core component could be a target for Vif function. Consistent with this, Vif has been characterized as an RNA-binding protein (Dettenhofer et al., 2000
; Zhang et al., 2000
) that might be involved in intracellular trafficking and packaging of HIV-1 genomic RNA (Zhang et al., 2000
).
The aim of the present study was to investigate further the mechanism of interaction of Vif with Gag and GagPol precursors and their co-encapsidation into retrovirus-like particles (VLP). We found that Vif, expressed as a recombinant protein in insect cells, was efficiently co-encapsidated with non-N-myristoylated, budding-defective, p6-deleted Gag precursor into intracytoplasmic VLP, suggesting that the presence of the p6 domain, the addressing of Gag to the plasma membrane and VLP budding were not required for Vif encapsidation. We also found that Vif was encapsidated with significantly higher efficiency into extracellular VLP formed from N-myristoylated GagPol precursor harbouring an inactive PR domain compared with Pr55Gag or into chimaeric VLP composed of two different precursor species, Gag and GagPol. Vif exerted an inhibitory effect on Gag proteolytic processing, mainly shown by protection of the cleavage sites at the MACA and CANC junctions. However, no direct interaction between Vif and PR could be detected in vivo by electron microscopy or in vitro in co-precipitation assays, and Vif showed complete resistance to PR action in vitro. Although a transient interaction of Vif with PR could not be excluded, this suggests that the Vif-mediated inhibition of Gag processing resulted from direct binding of Vif to the Gag substrate. Moreover, our data suggest that the enhancement of Vif encapsidation efficiency by GagPol precursor was not mediated by p6* or the GagPol-embedded PR domain, but resulted from a more favourable conformation of the Gag domain when expressed as a GagPol precursor.
| Methods |
|---|
|
|
|---|
Insect cells, recombinant baculoviruses and virus infections.
Gag and GagPol clones.
The Gag precursors used consisted of full-length Pr55Gag (WT precursor of 55 kDa), C-terminal deletion mutants (amber; amb) Gag-amb462 (p6 C-terminal moiety deleted), Gag-amb438 (p6 deleted), Gag-amb426 (p6+sp1 deleted) and the L-to-P substitution mutant GagL268P (Fig. 1
). They were expressed as N-myristoylated (myr+), budding-competent, or non-N-myristoylated (myr-), budding-defective recombinant proteins. N-myristoylated GagPol precursors consisted of Gag(FS)p6*Pol and Gagp6Pol. Gag(FS)p6*Pol (originally named AcH7fs; Hughes et al., 1993
) is a frameshift mutant with constitutively frameshifted translation of the gagpol mRNA. In Gagp6Pol, the PR domain was fused to the C-terminal p6 domain (Royer et al., 1997
). Both GagPol precursors were PR-defective, by the double substitution GR86
EF in the PR domain of Gag(FS)p6*Pol (Göttlinger et al., 1989
; Hughes et al., 1993
), or by the PR active-site mutation D25
G in Gagp6Pol (Royer et al., 1997
).
|
Protease (PR).
PR was expressed in baculovirus-infected cells in three polyhedrin-tagged versions, active PR58-107 (full-length), inactive PR58-D33G (full-length, catalytic-site mutant) and inactive PR58-77 (C-terminally truncated mutant) (Fig. 1
). They all carried the N-terminal 58 amino acid residues from the baculovirus polyhedrin sequence at their N termini (Royer et al., 1997
).
Control vector.
MR15 was an empty baculovirus vector used as a negative control in single or double infections. MR15 harboured an out-of-phase PR sequence in the locus of the deleted polyhedrin gene.
Isotopic labelling and immunoprecipitation.
Sf9 cells were infected simultaneously with equal m.o.i. of two recombinant baculoviruses (10 p.f.u. per cell), one expressing Vif, the other expressing the PR58-D33G or PR58-77 mutant protease. Cells were labelled (Redivue PRO-MIX, Amersham Pharmacia Biotech; 37 TBq/mmol; 5·3 MBq/ml of methionine-free medium) at 16 h after infection (p.i.). At 48 h p.i., cells were harvested and lysed and cell lysates were clarified and used for co-immunoprecipitation using anti-polyhedrin, anti-PR or anti-Vif rabbit antibodies. Immune precipitates were collected by selection on Protein ASepharose CL-4B affinity gel (Sigma) as described previously (Karayan et al., 1994
). Proteins retained on the affinity gel were analysed by SDSPAGE and autoradiography, or blotted and analysed with anti-Vif (diluted 1:3000) and anti-PR (1:2000) antibodies. To avoid the masking of the Vif band (23 kDa) on blots by the undesirable reaction of the secondary anti-rabbit IgG with the IgG light chain (22 kDa) present in the immunoprecipitate, the alkaline phosphatase (or peroxidase) conjugate used was a monoclonal anti-rabbit IgG (
-chain specific, clone RG-96, Sigma; diluted 1:5000) and the portion of the membranes where the IgG heavy chains had blotted was excised prior to antibody reaction.
Bacterial clones and bacterially expressed recombinant proteins
Recombinant protease.
Recombinant HIV-1 PR107 was an active protease form of 107 residues containing 7 residues from the p6* domain at its N terminus plus the methionine initiator (Valverde et al., 1992
). Both PR107 and its inactive version PRD33G (mutated at the catalytic site) were expressed in bacterial cells (E. coli strain MC1061) using the inducible araB promoter (Valverde et al., 1992
).
Nucleocapsid (NC) protein.
The cDNA of NCp15 (NCp7+p6 domain) was obtained by PCR amplification of the corresponding HIV-1Lai gag sequence, and cloned into the pKK233-3 vector (Amersham Pharmacia Biotech) according to conventional methods. Recombinant NCp15, starting at Met-378, was overproduced in E. coli strain JM105 by induction with IPTG, as described below.
Recombinant Vif.
The pD10Vif bacterial expression plasmid, carrying the vif gene from the HIV-1 proviral clone pHXB2, was obtained from D. Gabuzda (Yang et al., 1996
). In plasmid pD10Vif, a 6xHis tag was fused to the Vif N terminus lacking the initiation methionine codon (MRGSHHHHHHGSVif). Vif protein was purified essentially according to the method of Yang et al. (1996)
. The plasmid was transformed into E. coli MC1061 and expression of Vif was induced by addition of 0·5 mM IPTG to exponential-phase bacterial cultures (OD600=0·60·8). After induction for 4 h at 37 °C, the bacterial cells were lysed in 6 M guanidineHCl, 0·1 M sodium phosphate, pH 8·0, at room temperature with overnight stirring. Insoluble cell debris was removed by centrifugation at 15000 r.p.m. in an SS-34 rotor for 30 min and the supernatant was loaded onto a NiNTAagarose column (Qiagen). The column was washed extensively with lysis buffer and eluted sequentially with the same solution at decreasing pH (pH 6·5, 6·0, 5·8, 5·5 and 5·0). The Vif-containing fractions that eluted at pH 5·5 were pooled, diluted to 200 µg/ml and dialysed successively against 50 mM MOPSNaOH, pH 6·5, containing 150 mM NaCl and 3·0, 1·5, 0·75, 0·42, 0·21 and 0 M guanidineHCl. The protein was then concentrated with a Centriprep-10 concentrator (Amicon) and insoluble aggregates were removed by centrifugation at 100000 g for 30 min at 4 °C. The soluble fraction was adjusted to 10% glycerol and stored in aliquots at -70 °C.
Glutathione-S-transferase (GST)-fused Vif.
The construction of GSTVif from the NL4.3 strain of HIV-1 has been described elsewhere (Bouyac et al., 1997b
).
GST-fused protease.
The protease was inactivated (PR*) by mutagenesis (D25G substitution) by a two-step recombinant PCR method with the following primers: PR-7-GAV-EcoRI-(s), PR-PQI-EcoRI-(s), PR-D25G-(s/as), PR-Stop-LNF-NotI-(as) (see below). GSTPR*-7, containing 7 residues from p6* at its N terminus, as in PR107, and GSTPR* (99 residues) were obtained by digestion of the PCR products with EcoRI/NotI and cloning into the pGEX-5X2 expression vector. The cloning oligonucleotides used were: PR-7-GAV-EcoRI-(s), 5' AAAGGAATTCTTGGAACTGTATCCTTTAACTTC 3'; PR-PQI-EcoRI-(s), 5' AAAGGAATTCCTCAGATCACTCTTTGGCAACG 3'; PR-D25G-(s/as), 5' GCTCTATTAGGTACAGGAGCAG 3' and 5' CTGCTCCTGTACCTAATAGAGC 3'; and PR-Stop-LNF-NotI-(as), 5' TCACGATGCGGCCGCCTAAAAATTTAAAGTGCAACCAATC 3'.
Expression and purification of GST-fusion proteins.
E. coli Top10 cells (Invitrogen), transformed with fusion protein-expression plasmids, were grown at 30 °C and protein expression was induced by IPTG, as described above. The bacteria were lysed by sonication (3x30 s) on ice and the lysate was incubated for 30 min at 4 °C in the presence of 1% Triton X-100 with shaking. Insoluble material was pelleted for 30 min at 14000 g and the supernatant was incubated overnight at 4 °C with 20 µl 50% (v/v) glutathione (GSH)agarose beads (Sigma) per ml of lysate. After three successive washes with 1 M NaCl and PBS, the GST-fusion proteins immobilized on GSHagarose beads were quantified by SDSPAGE. The beads were stored at 4 °C in the presence of a protease inhibitor cocktail (1 mg/ml aprotinin, 1 mg/ml leupeptin, 2 mg/ml pepstatin and 1 mg/ml antipain) for further analysis.
In vitro transcriptiontranslation.
For in vitro protein synthesis, appropriate genes were amplified by PCR with 5'-oligonucleotides that contained the T3 RNA polymerase promoter upstream of the initiation position and 3'-oligonucleotides that contained a stop codon. Amplified DNAs were subjected to in vitro transcriptiontranslation using the TNT coupled wheat germ extract system (Promega) as recommended by the manufacturer. Proteins were translated in the presence of [35S]methionine (37 TBq/mmol; Amersham Pharmacia Biotech), analysed by SDSPAGE and quantified by autoradiography and phosphorimager analysis. The oligonucleotides used for protein in vitro translation were 5' GTTATTAACCCTCACTAAAGGGAAGATTATGGAAAACAGATGGCAGGTGATG 3', referred to as T3 Vif-1-(s), and 5' ATTCTGCTATGTTGACAC 3', referred to as Vif-stop-192-(as).
GST-pull down assays.
Binding reactions were performed overnight at 4 °C in TBST binding buffer containing 50 mM TrisHCl, pH 7·0, 0·2% Tween 20 and appropriate concentrations of NaCl (150350 mM) in the presence of BSA (200 µg/ml) in a total volume of 300 µl. GSHagarose beads bound to GST-fusion protein were incubated overnight with either 8 µl in vitro-translated 35S-labelled proteins or 200 µl cytoplasmic extract and then washed extensively in TBST buffer. Samples were resuspended in 25 µl SDS sample buffer and bound proteins were analysed by SDSPAGE and autoradiography or Western blotting (Huvent et al., 1998
).
VLP analysis.
Membrane-enveloped VLP formed from N-myristoylated Gag or GagPol polyproteins and released by extracellular budding were analysed by ultracentrifugation in sucroseD2O gradients (Liu et al., 1995
) after proteolytic digestion with subtilisin, aimed at hydrolysing soluble or membrane-bound Vif protein, which would not be truly Gag-encapsidated and could contaminate the VLP fractions (Goncalves et al., 1995
; Huvent et al., 1998
; Simon et al., 1997
). Linear gradients (10 ml total volume, 3050% w/v) were centrifuged for 18 h at 28000 r.p.m. in a Beckman SW41 rotor. The 50% sucrose solution was made in D2O buffered to pH 7·2 with NaOH and the 30% sucrose solution was made in 10 mM TrisHCl, pH 7·2, 150 mM NaCl, 5·7 mM disodium EDTA. Aliquots of 0·4 ml were collected from the bottom and proteins were analysed by SDSPAGE and immunoblotting.
EM and immunoelectron microscopy (IEM).
For conventional EM, baculovirus-infected Sf9 cells were harvested at 40 h p.i., pelleted, fixed with 2·5% glutaraldehyde in 0·1 M phosphate buffer, pH 7·5, post-fixed with osmium tetroxide (2% in H2O) and treated with 0·5% tannic acid solution in H2O. The specimens were dehydrated and embedded in Epon (Epon-812). Sections were stained with 2·6% alkaline lead citrate and 0·5% uranyl acetate in 50% ethanol and post-stained with 0·5% uranyl acetate solution in H2O. For IEM and antibodyimmunogold labelling (Gay et al., 1998
; Huvent et al., 1998
), cell specimens were embedded in hydrophilic metacrylic resin (Lowicryl K4M; Chemische Werke Lowi) and sections were reacted with anti-CAp24 and anti-MAp17 mouse MAbs and anti-Vif rabbit antibody, both diluted 1:100 in Tris-buffered saline (TBS) overnight at 4 °C. For double labelling, the reaction with gold-labelled secondary antibody was carried out at room temperature for 1 h, using anti-mouse IgG labelled with 5 nm colloidal gold particles and 10 nm gold-tagged anti-rabbit IgG (EM-GAM5 and EM-GAM10, respectively; BioCell Research Lab) diluted 1:100 in TBS. For single labelling, 5 nm gold-labelled secondary antibody was used. Sections were post-stained with 0·5% uranyl acetate. Specimens were examined under a Hitachi-H7100 electron microscope.
PR activity in vitro on Pr55Gag and Vif substrates
Recombinant Gag substrate.
Proteolytic processing of Gag was assayed using the soluble, assembly-defective, non-N-myristoylated full-length polyprotein mutant of 55 kDa, Gag-G2A (Chazal et al., 1995
), as the protein substrate of viral PR. Sf9 cells were infected with Gag-G2A-expressing baculovirus and infection was allowed to proceed for 48 h. Cells were pelleted, resuspended in hypotonic buffer (10 mM TrisHCl, pH 7·0, 1 mM disodium EDTA) containing a cocktail of protease inhibitors (Complete protease inhibitor cocktail tablets; Boehringer) at 1 tablet for 50 ml and lysed in a tight-pestle Dounce homogenizer. The cell lysate was clarified by centrifugation at 12000 g for 20 min. Soluble Gag-G2A polyprotein was recovered in the cytosolic fraction and stored frozen at a total protein concentration of 0·40·5 mg/ml. As Gag-G2A represented 510% of the cytosolic protein (Royer et al., 1992
), the cytosolic fraction was used as protease substrate without further purification (Valverde et al., 1992
).
Recombinant PR.
Bacterially expressed protease PR107 and its mutant PRD33G were isolated as described previously (Valverde et al., 1992
) with minor modifications. Briefly, bacterial cells (E. coli MC1061, 5 ml aliquots) taken at an OD600 of 0·5 were treated with L-arabinose at 20% for 4 h to induce PR expression and lysed in 0·1 ml 50 mM TrisHCl, pH 7·0, containing 1 mM DTT, 0·01% lysozyme and the complete protease inhibitor cocktail described above. After standing on ice for 10 min, the samples were treated with 0·1% NP40 and DNase I at a final concentration of 1 mg/ml in the presence of 10 mM MgCl2. The lysates were clarified by centrifugation at 12000 g for 20 min and the supernatant was used as the source of PR. The amount of PR was estimated by Coomassie blue staining of SDSpolyacrylamide gels by comparison with a range of titrated lysozyme samples. In some experiments, recombinant, affinity-purified PR (expressed in E. coli; Bachem AG) was also used.
Standard PR assays.
In standard reactions, 5 µl aliquots of Sf9 cytosolic fraction containing Gag-G2A substrate (0·51·0 pmol) were mixed with 10 µl aliquots of PR sample (0·050·01 pmol PR107) and 5 µl buffer containing 50 mM MOPSNaOH, pH 6·5, 150 mM NaCl and increasing amounts of recombinant Vif protein, ranging from 4 to 40 pmol (0·11·0 µg) per sample. Digestion was conducted for 1 h at 37 °C and the enzymatic reaction was stopped by addition of 20 µl SDSPAGE sample buffer. In negative-control samples, the inactive PR mutant PRD33G was used in place of PR107 or PR107 was used in the presence of the inhibitor Saquinavir (Bragman, 1996
). Saquinavir was kindly supplied by F. Mammano (INSERM-Hôpital Bichat, Paris) and used at concentrations ranging from 0 to 2·0 mM.
PR assays using nascent Gag and Vif substrates.
In typical reactions, 2·5 µl [35S]methionine-labelled Pr55Gag or Vif protein, obtained by in vitro translation as described above, was brought to a final volume of 35 µl with 50 mM TrisHCl, pH 6·8, 150 mM NaCl, 1 mM disodium EDTA, 10% glycerol. An aliquot of 1 µl of bacterially expressed, purified HIV-1 PR (H 1256; Bachem) at a concentration of 540 ng/µl was added to the mixture and digestion was allowed to proceed at 37 °C for 4 h. Digestion was stopped by heating in SDSPAGE loading buffer and samples were analysed by SDSPAGE and autoradiography.
Immunoblot analysis and antibodies.
Proteins were analysed by SDSPAGE and immunoblotted, as described previously (Huvent et al., 1998
). Anti-HIV-1 MA protein rabbit polyclonal antibody (laboratory-made; Huvent et al., 1998
) was raised in a rabbit by injection of GST-fused, bacterially expressed and affinity chromatography-purified MAp17. Mouse MAbs against MAp17 (Epiclone 5003) and against CAp24 (Epiclone 5001) were obtained from Cylex Inc. and a MAb against HIV-1 reverse transcriptase was obtained from IntraCell. Mouse MAb HH3 directed against NCp7 was obtained from R. Benarous (Tanchou et al., 1994
). Anti-p6 rat MAb M35/2F8 was kindly provided by M. G. Sarngadharan (Veronese et al., 1987
; Carrière et al., 1995
) and the rabbit anti-Vif serum was provided by D. Gabuzda. Anti-HIV-1 PR and anti-polyhedrin rabbit sera were both laboratory-made (Royer et al., 1997
). Phosphatase-labelled anti-rabbit, -mouse and -rat IgG conjugates were purchased from Sigma and horseradish peroxidase-labelled conjugates were purchased from Boehringer. For luminograms, chemiluminescent peroxidase substrate Supersignal (Pierce) was used. For immunological quantification of Gag and Vif proteins, blots were reacted with 125I-labelled anti-rabbit or anti-mouse whole IgG antibody (Amersham Pharmacia Biotech; 6·9 mCi/mg; 3 µCi per blot) and exposed to radiographic film (Hyperfilm-
max, Amersham Pharmacia Biotech). Autoradiographs were scanned at 610 nm using an automatic densitometer (REP-EDC, Helena Laboratories) or protein bands were excised from blots and radioactivity was measured in a scintillation counter (Beckman LS-6500) as described previously (Huvent et al., 1998
).
| Results |
|---|
|
|
|---|
|
These EM data thus confirmed that the VifGag interaction could occur intracellularly, as suggested previously (Bouyac et al., 1997a
; Huvent et al., 1998
). The observation that co-encapsidation of Vif and the myristoylation-defective, C-terminal deletion mutant Gag-amb438myr- could take place within the cytoplasm implied that the interaction between Gag and Vif did not depend upon the presence of the p6 domain in the Gag precursor. It also implied that Vif and Gag co-packaging did not result simply from the addressing of Gag and Vif to the cell surface, their co-localization at the plasma membrane and the extracellular budding of Gag particles.
Co-encapsidation of Vif with Gag or GagPol precursors into extracellular VLP
Before maturation, HIV-1 particles are composed transiently of two Gag precursor species, the Gag polyprotein of 55 kDa (Pr55Gag) and the GagPol polyprotein of 160 kDa (Pr160GagPol), the latter precursor containing the p6* and PR domains upstream of the RTIN domain (Fig. 1
). Since direct interactions between Vif-derived peptides and viral PR (Friedler et al., 1999
) have been reported, we investigated the possible influence of PR on Vif encapsidation efficiency in an assay in which PR was provided as an inactivated, constitutive domain of the GagPol precursor. Vif was co-expressed with a single Gag (WT Pr55Gag) or GagPol precursor species and their VLP Vif contents were compared by quantitative immunoblot analysis of VLP isolated by velocity gradient ultracentrifugation (Huvent et al., 1998
) and estimated semi-quantitatively by IEM analysis of budding VLP in EM sections (Carrière et al., 1995
). As shown in Fig. 3
(a
, b
) and Table 1
, Gag(FS)p6*Pol, a budding-competent, N-myristoylated GagPol precursor containing a mutant PR, encapsidated 6-fold more copies of Vif per Gag molecule than did Pr55Gag. This was confirmed by IEM analysis of VLP (Fig. 4
). Sections of VLP composed of Gag(FS)p6*Pol were labelled with Vif antibody at significantly higher levels than VLP formed from Pr55Gag: the mean number of Vif-associated gold grains per VLP was found to be 17·52 (SEM=2·69; SD=13·26; n=93) for Gag(FS)p6*Pol (Fig. 4b
) versus 2·62 (SEM=0·60; SD=2·60; n=72) for Pr55Gag (Fig. 4a
). The background anti-Vif labelling of Pr55Gag VLP assembled in the absence of Vif expression was 0·13 grains per VLP (SEM=0·08; SD=0·56; n=176). The difference was therefore significant at the P=0·05 confidence level.
|
|
|
|
Morphology of VLP and Vif encapsidation
It has been reported recently that Vif was packaged at significantly higher levels in HIV-1 particles composed of Gag CA deletion mutants with aberrant morphology (Sova et al., 2001
). This was confirmed by our own observation that GagL268Pmyr+ encapsidated 10-fold more Vif per Gag molecule than did Pr55Gag (Table 1
). GagL268Pmyr+ is a CA substitution mutant that self-assembles with low efficiency and releases large, membrane-enveloped Gag particles (Hong & Boulanger, 1993
). We then analysed the influence of VLP morphology on Vif encapsidation using chimaeric VLP composed of two Gag precursor species, as occurs in immature virus particles. Co-expression of N-myristoylated Gag(FS)p6*Pol (or Gagp6Pol) and p6-deleted GagPr47 (or Gag-amb438myr+, our
p6 equivalent of Pr47) in insect cells has been found to result in chimaeric VLP that appear to be more homogeneous in size and shape under the EM than VLP formed from single Gag(FS)p6*Pol molecules (Hughes et al., 1993
) or Gagp6Pol (Royer et al., 1997
). The same effect was observed in co-expression of Gag(FS)p6*Pol with Gag-amb426myr+ (Fig. 4
; Table 2
). Gag(FS)p6*Pol molecules assembled into VLP with a diameter 2-fold larger (mean 242 nm) than that of WT Pr55Gag VLP (125 nm). Moreover, their heterogeneity and lack of sphericity, as estimated respectively by the value of the SD of the mean diameter and the ratio of their minimum to maximum diameters (d:D), were significantly greater than those of WT VLP (Table 2
). By contrast, the morphology of chimaeric VLP composed of Gag-amb426myr++Gagp6Pol or of Gag-amb426myr++Gag(FS)p6*Pol (with or without Vif) was similar to that of WT Pr55Gag VLP (Fig. 4c
, d
; Table 2
).
Gag-amb426myr+, which lacks p6 and the sp1 spacer peptide between the NC and p6 domains, has been shown to be defective in Vif packaging, with a 5- to 10-fold reduction of the Vif content of VLP formed from Gag-amb426myr+ compared with WT Pr55Gag VLP (Huvent et al., 1998
; Table 1
). Thus, when assayed in triple-infection experiments involving GagPol and Gag-amb426myr+, packaging of Vif into chimaeric VLP would essentially depend upon the GagPol precursor species. Sf9 cells were thus infected simultaneously with three recombinant baculoviruses expressing Vif, Gag-amb426myr+ and Gag(FS)p6*Pol (or Gagp6Pol) and the expression of the three recombinant proteins was verified in situ by IF microscopy and by SDSPAGE analysis and immunoblotting of Sf9 cell lysates (not shown). The VLP released from the co-infected cells were isolated in velocity gradients and assayed for Vif and Gag content (Table 1
). The results showed that Vif was encapsidated at significantly higher levels in chimaeric VLP than in VLP constituted of the single Pr55Gag species (Table 1
; Fig. 3
, compare a and d), although the VLP showed similar size and morphology under the EM (Table 2
; Fig. 4
, compare a with c and d). Interestingly, the number of copies of Vif was larger in mixed VLP containing the natural Gag(FS)p6*Pol precursor than in mixed VLP containing the Gagp6Pol fusion construct, 5- and 3-fold, respectively, over the Pr55Gag VLP content (Table 1
). These data suggested that Vif encapsidation into Gag particles was not a simple consequence of an aberrant morphology of these particles, but would favour the hypothesis of a conformational role of the GagPol precursor in VifGag interaction and co-encapsidation, e.g. dimerization induced or/and stabilized by the PRPol domains. However, since a direct interaction between Vif and PR could not be excluded at this stage, the next experiments were designed to address this point.
Absence of detectable VifPR interaction in vivo and in vitro
The possible direct interaction between Vif and PR was examined in vivo under the EM on sections of Sf9 cells co-infected by a baculovirus expressing Vif and a high-expresser of polyhedrin-tagged, inactive PR* (PR58-D33G or PR58-77; Fig. 1
). No pattern of co-localization of the PR* and Vif protein inclusions was visible in the cytoplasm and nucleus of Sf9 cells in EM and IEM (not shown). In co-immunoprecipitation assays of Sf9 cell lysates, neither of the individual proteins, Vif or PR*, was found to co-precipitate with the other with any of the specific antibodies used, anti-PR, anti-polyhedrin or anti-Vif (not shown). Likewise in vitro, in GST-pull down assays, no significant amount of Vif protein was found to bind GSTPR* (inactivated by a D
G substitution at its catalytic site) using full-length Vif or its isolated N-terminal or C-terminal moieties. In reverse experiments using GSTVif, no detectable PR* was pelleted from PR58-D33G- or PR58-77-expressing Sf9 lysates (not shown). Moreover, pull down of active recombinant PR (commercially available from Bachem) by GSTVif was also unsuccessful (not shown).
Altogether, these data apparently argued against a stable interaction between Vif and the viral PR, although a transient interaction between Vif and PR, which would account for the Vif-mediated inhibition of PR activity (Kotler et al., 1997
;Potash et al., 1998
), could not be excluded. Similarly, PR-mediated proteolytic degradation of Vif within maturing virus particles could explain its absence or quasi-absence from mature virions, as reported previously (Dettenhofer & Yu, 1999
). To test this hypothesis, in vitro-translated nascent Vif and Gag proteins were incubated with chromatographically purified, recombinant HIV-1 PR (Bachem) and cleavage products were analysed by SDSPAGE and autoradiography. As shown in Fig. 5(a
), PR was capable of processing Pr55Gag precursor, as shown by the occurrence of a major p24 protein species. In contrast, Vif appeared to be totally resistant to viral PR in vitro, at least under conditions that allowed efficient cleavage of Pr55Gag.
|
|
Non-N-myristoylated Gag precursors of various lengths (Gag-amb462, Gag-amb438 and Gag-amb426), carrying amber stop codons at different positions in the C-terminal p6 or sp1 domain (Fig. 1
), were incubated with PR in the presence or absence of Vif. The same anti-MA-reacting P41 band appeared to be attenuated in the presence of Vif in all Gag mutant patterns (Fig. 6
), indicating that P41 corresponded to the N-terminal moiety of the Gag precursor. This also suggested that the absence of p6 and p6+sp1 domains apparently did not modify the negative influence of Vif on PR-mediated cleavage of the upstream sites bounding the sp2 domain.
The proteolytic pattern of Gag in immunoblots using anti-p6 antibody confirmed the negative effect of Vif on PR-mediated Gag processing: almost complete extinction of the P17.5 signal was observed in the presence of Vif, suggesting inhibition of cleavage at the CAsp2 junction (Fig. 5d
; compare lanes 4 and 5). It also showed a simultaneous decrease in the intensity of the cleavage product P39, which implied protection of the cleavage site at the MACA junction. The negative effect on Gag processing of 40 pmol Vif mimicked the anti-PR activity of Saquinavir at 1·7 mM (Fig. 5d
, lanes 5 and 6).
| Discussion |
|---|
|
|
|---|
p6 mutant Gag-amb438myr-, confirming previous results on direct GagVif interaction (Bouyac et al., 1997b
GagVif co-encapsidation into budding VLP released by Gag+Vif-co-expressing cells was also assayed using budding-competent, N-myristoylated Gag and GagPol precursors. Vif was found to be encapsidated into extracellular VLP with significantly higher efficiency when co-expressed with GagPol precursors harbouring an inactive PR domain compared with Pr55Gag. Furthermore, Vif was encapsidated at higher levels into chimaeric VLP composed of GagPol precursor and p6+sp1-deleted Gag-amb426myr+ compared with single Pr55Gag VLP (Fig. 3
; Table 1
). The chimaeric VLP showed mean size, sphericity and homogeneity in shape similar to those of Pr55Gag VLP (Fig. 4
; Table 2
), which seemed to exclude the possibility that Vif encapsidation efficiency was simply related to the morphology of VLP, as hypothesized recently (Sova et al., 2001
), or to the amount of cytoplasmic material or plasma membrane enclosed in VLP. This rather suggested that Vif had some affinity for a downstream domain(s) of the GagPol precursor and/or that the presence of the PRPol domains at the Gag C terminus positively affected the binding of Vif to the upstream regions of Pr55Gag identified previously (Bouyac et al., 1997b
; Huvent et al., 1998
). Co-encapsidation of Vif with a naturally frameshifted GagPol precursor containing the p6* domain, compared with a GagPol fusion construct containing the p6 domain in place of p6*, suggested that the effect on Vif encapsidation was not due directly to p6* but to further downstream sequences. Since we were unable to detect any significant interaction in vivo or in vitro between Vif and PR, direct participation of the PR domain of GagPol precursor in Vif packaging was unlikely. Although some binding of Vif to regions of the Pol domain could not be totally excluded, the results of our encapsidation assays suggested that the conformation of the Gag domain was more favourable to GagVif interaction in the GagPol precursor than in Pr55Gag.
Vif was also analysed with respect to its possible influence on the proteolytic activity of PR in vitro, using soluble Pr55Gag precursor as the substrate. We found that Vif was totally resistant to PR action in vitro (Fig. 5a
), but exerted an inhibitory effect on PR-mediated Gag processing (Figs 5b
d
and 6
). Although some subtle mechanism of PR inactivation by Vif could not be excluded, the data suggested that Vif-mediated inhibition of Gag processing resulted from binding of Vif to the Gag substrate rather than to the PR enzyme. The proteolytic pattern suggested preferential protection by Vif of two major cleavage sites, at the MACA and CANC junctions (Figs 5
and 6
). Interestingly, these two junction regions were revealed previously as the preferential binding sites of Vif (Bouyac et al., 1997b
; Huvent et al., 1998
). The peptide bond at the sp2NC junction is cleaved at the highest rate by the viral PR (Pettit et al., 1994
). In addition, sp2 is not only essential for sequential processing of Pr55Gag (Pettit et al., 1994
), but is also a major determinant of Gag particle assembly (Campbell & Vogt, 1997
; Gay et al., 1998
; Gross et al., 2000
). This suggested that Vif preferentially inhibited the cleavage of peptide bonds integrity of which is crucial for temporal regulation and correct assembly of HIV-1 virions.
We therefore hypothesize that Vif could regulate negatively the proteolytic activity of PR by interacting with the Gag/GagPol substrate in the cytoplasm of infected cells, as suggested previously (Bouyac et al., 1997b
; Huvent et al., 1998
). This interaction would be transient and would maintain the integrity of the Gag and GagPol molecules during their addressing to the plasma membrane and their assembly into immature particles. At later stages of assembly, a majority of Vif molecules would be excluded from the particles, as suggested recently (Sova et al., 2001
). The molecular mechanism of Vif exclusion is still unknown, but it could occur via a conformational change of Gag, probably resulting from Gag proteolysis, that lowered its affinity for Vif, or/and by exchange of Vif with a viral or cellular ligand(s) acting as a competitor(s) for Gag binding. Two lines of evidence support this Vif ligand-switching hypothesis. (i) Vif interacts with the cytoplasmic side of the plasma membrane, an association mediated by intrinsic membrane components and the C-terminal domain of Vif (Goncalves et al., 1994
, 1995
; Simon et al., 1997
). (ii) The affinity of Vif for RNA decreased in the presence of Gag precursors, while the latter still bound RNA, suggesting a displacement and exchange of RNA-bound proteins during genome packaging (Zhang et al., 2000
).
It must be considered that our results might apply only to insect cells, which could lack some crucial mammalian cell factors. It is noteworthy that, in our system of baculovirus infection, we probably favoured incorporation of Vif into VLP for at least two reasons: (i) the Gag and GagPol precursors were not cleaved, since the GagPol constructs were defective in PR activity, and (ii) insect cells lack certain cellular factors such as some tyrosine kinases of the Src family that may retain Vif at the cell membrane (Hassaïne et al., 2001
). Further analyses are needed to reunite the multiple functions assigned to Vif. Several of them, e.g. the role of Vif in RNA folding and packaging and its role in virus core morphology and stability (Höglund et al., 1994
; Öhagen & Gabuzda, 2000
) and in regulation of Gag/GagPol processing during capsid assembly, would be compatible with a function as a viral chaperone in virus morphogenesis and genome encapsidation.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Borman, A. M., Quillent, C., Charneau, P., Dauguet, C. & Clavel, F. (1995). Human immunodeficiency virus type 1 Vif- mutant particles from restrictive cells: role of Vif in correct particle assembly and infectivity. Journal of Virology 69, 2058-2067.[Abstract]
Bouyac, M., Rey, F., Nascimbeni, M., Courcoul, M., Sire, J., Blanc, D., Clavel, F., Vigne, R. & Spire, B. (1997a). Phenotypically Vif- human immunodeficiency virus type 1 is produced by chronically infected restrictive cells. Journal of Virology 71, 2473-2477.[Abstract]
Bouyac, M., Courcoul, M., Bertoia, G., Baudat, Y., Gabuzda, D., Blanc, D., Chazal, N., Boulanger, P., Sire, J., Vigne, R. & Spire, B. (1997b). Human immunodeficiency virus type 1 Vif protein binds to the Pr55Gag precursor. Journal of Virology 71, 9358-9365.[Abstract]
Bragman, K. (1996). Saquinavir: an HIV proteinase inhibitor. Advances in Experimental Medicine and Biology 394, 305-317.[Medline]
Camaur, D. & Trono, D. (1996). Characterization of human immunodeficiency virus type 1 Vif particle incorporation. Journal of Virology 70, 6106-6111.[Abstract]
Campbell, S. & Vogt, V. M. (1997). In vitro assembly of virus-like particles with Rous sarcoma virus Gag deletion mutants: identification of the p10 domain as a morphological determinant in the formation of spherical particles. Journal of Virology 71, 4425-4435.[Abstract]
Carrière, C., Gay, B., Chazal, N., Morin, N. & Boulanger, P. (1995). Sequence requirements for encapsidation of deletion mutants and chimeras of human immunodeficiency virus type 1 Gag precursor into retrovirus-like particles. Journal of Virology 69, 2366-2377.[Abstract]
Chazal, N., Carrière, C., Gay, B. & Boulanger, P. (1994). Phenotypic characterization of insertion mutants of the human immunodeficiency virus type 1 Gag precursor expressed in recombinant baculovirus-infected cells. Journal of Virology 68, 111-122.
Chazal, N., Gay, B., Carrière, C., Tournier, J. & Boulanger, P. (1995). Human immunodeficiency virus type 1 MA deletion mutants expressed in baculovirus-infected cells: cis and trans effects on the Gag precursor assembly pathway. Journal of Virology 69, 365-375.[Abstract]
Cohen, E. A., Subbramanian, R. A. & Göttlinger, H. G. (1996). Role of auxiliary proteins in retroviral morphogenesis. Current Topics in Microbiology and Immunology 214, 219-235.[Medline]
Courcoul, M., Patience, C., Rey, F., Blanc, D., Harmache, A., Sire, J., Vigne, R. & Spire, B. (1995). Peripheral blood mononuclear cells produce normal amounts of defective Vif- human immunodeficiency virus type 1 particles which are restricted for the preretrotranscription steps. Journal of Virology 69, 2068-2074.[Abstract]
Dettenhofer, M. & Yu, X.-F. (1999). Highly purified human immunodeficiency virus type 1 reveals a virtual absence of Vif in virions. Journal of Virology 73, 1460-1467.
Dettenhofer, M., Cen, S., Carlson, B. A., Kleiman, L. & Yu, X.-F. (2000). Association of human immunodeficiency virus type 1 Vif with RNA and its role in reverse transcription. Journal of Virology 74, 8938-8945.
Fouchier, R. A. M., Simon, J. H. M., Jaffe, A. B. & Malim, M. H. (1996). Human immunodeficiency virus type 1 Vif does not influence expression or virion incorporation of gag-, pol-, and env-encoded proteins. Journal of Virology 70, 8263-8269.[Abstract]
Friedler, A., Blumenzweig, I., Baraz, L., Steinitz, M., Kotler, M. & Gilon, C. (1999). Peptides derived from HIV-1 Vif: a non-substrate based novel type of HIV-1 protease inhibitors. Journal of Molecular Biology 287, 93-101.[Medline]
Gabuzda, D. H., Lawrence, K., Langhoff, E., Terwilliger, E., Dorfman, T., Haseltine, W. A. & Sodroski, J. (1992). Role of Vif in replication of human immunodeficiency virus type 1 in CD4+ T lymphocytes. Journal of Virology 66, 6489-6495.
Gabuzda, D. H., Li, H., Lawrence, K., Vasir, B. S., Crawford, K. & Langhoff, E. (1994). Essential role of vif in establishing productive HIV-1 infection in peripheral blood T lymphocytes and monocytes/macrophages. Journal of Acquired Immunodeficiency Syndromes 7, 908-915.
Gay, B., Tournier, J., Chazal, N., Carrière, C. & Boulanger, P. (1998). Morphopoietic determinants of HIV Gag particles assembled in baculovirus-infected cells. Virology 247, 160-169.[Medline]
Goncalves, J., Jallepalli, P. & Gabuzda, D. H. (1994). Subcellular localization of the Vif protein of human immunodeficiency virus type 1. Journal of Virology 68, 704-712.
Goncalves, J., Shi, B., Yang, X. & Gabuzda, D. (1995). Biological activity of human immunodeficiency virus type 1 Vif requires membrane targeting by C-terminal basic domains. Journal of Virology 69, 7196-7204.[Abstract]
Goncalves, J., Korin, Y., Zack, J. & Gabuzda, D. (1996). Role of Vif in human immunodeficiency virus type 1 reverse transcription. Journal of Virology 70, 8701-8709.[Abstract]
Göttlinger, H. G., Sodroski, J. G. & Haseltine, W. A. (1989). Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of human immunodeficiency virus type 1. Proceedings of the National Academy of Sciences, USA 86, 5781-5785.
Gross, I., Hohenberg, H., Wilk, T., Wiegers, K., Grättinger, M., Müller, B., Fuller, S. & Kräusslich, H.-G. (2000). A conformational switch controlling HIV-1 morphogenesis. EMBO Journal 19, 103-113.[Medline]
Hassaïne, G., Courcoul, M., Bessou, G., Barthalay, Y., Picard, C., Olive, D., Collette, Y., Vigne, R. & Decroly, E. (2001). The tyrosine kinase Hck is an inhibitor of HIV-1 replication counteracted by the viral Vif protein. Journal of Biological Chemistry 276, 16885-16893.
Henderson, L. E., Bowers, M. A., Sowder, R. C.II, Serabyn, S. A., Johnson, D. G., Bess, J. W.Jr, Arthur, L. O., Bryant, D. K. & Fenselau, C. (1992). Gag proteins of the highly replicative MN strain of human immunodeficiency virus type 1: posttranslational modifications, proteolytic processing, and complete amino acid sequences. Journal of Virology 66, 1856-1865.
Höglund, S., Öhagen, A., Lawrence, K. & Gabuzda, D. (1994). Role of vif during packaging of the core of HIV-1. Virology 201, 349-355.[Medline]
Hong, S. S. & Boulanger, P. (1993). Assembly-defective point mutants of human immunodeficiency virus type 1 Gag precursor phenotypically expressed in recombinant baculovirus-infected cells. Journal of Virology 67, 2787-2798.
Hughes, B. P., Booth, T. F., Belyaev, A. S., McIlroy, D., Jowett, J. & Roy, P. (1993). Morphogenic capabilities of human immunodeficiency virus type 1 gag and gag-pol proteins in insect cells. Virology 193, 242-255.[Medline]
Huvent, I., Hong, S. S., Fournier, C., Gay, B., Tournier, J., Carrière, C., Courcoul, M., Vigne, R., Spire, B. & Boulanger, P. (1998). Interaction and co-encapsidation of human immunodeficiency virus type 1 Gag and Vif recombinant proteins. Journal of General Virology 79, 1069-1081.[Abstract]
Karayan, L., Gay, B., Gerfaux, J. & Boulanger, P. A. (1994). Oligomerization of recombinant penton base of adenovirus type 2 and its assembly with fiber in baculovirus-infected cells. Virology 202, 782-795.[Medline]
Karczewski, M. K. & Strebel, K. (1996). Cytoskeleton association and virion incorporation of the human immunodeficiency virus type 1 Vif protein. Journal of Virology 70, 494-507.[Abstract]
Kotler, M., Simm, M., Zhao, Y. S., Sova, P., Chao, W., Ohnona, S.-F., Roller, R., Krachmarov, C., Potash, M. J. & Volsky, D. J. (1997). Human immunodeficiency virus type 1 (HIV-1) protein Vif inhibits the activity of HIV-1 protease in bacteria and in vitro. Journal of Virology 71, 5774-5781.[Abstract]
Layne, S. P., Merges, M. J., Dembo, M., Spouge, J. L., Conley, S. R., Moore, J. P., Raina, J. L., Renz, H., Gelderblom, H. R. & Nara, P. L. (1992). Factors underlying spontaneous inactivation and susceptibility to neutralization of human immunodeficiency virus. Virology 189, 695-714.[Medline]
Liu, H., Wu, X., Newman, M., Shaw, G. M., Hahn, B. H. & Kappes, J. C. (1995). The Vif protein of human and simian immunodeficiency viruses is packaged into virions and associates with viral core structures. Journal of Virology 69, 7630-7638.[Abstract]
Madani, N. & Kabat, D. (1998). An endogenous inhibitor of human immunodeficiency virus in human lymphocytes is overcome by the viral Vif protein. Journal of Virology 72, 10251-10255.
Mervis, R. J., Ahmad, N., Lillehoj, E. P., Raum, M. G., Salazar, F. H. R., Chan, H. W. & Venkatesan, S. (1988). The gag gene products of human immunodeficiency virus type 1: alignment within the gag open reading frame, identification of posttranslational modifications, and evidence for alternative Gag precursors. Journal of Virology 62, 3993-4002.
Oberste, M. S. & Gonda, M. A. (1992). Conservation of amino acid sequence motifs in lentivirus Vif proteins. Virus Genes 6, 95-102.[Medline]
Ochsenbauer, C., Wilk, T. & Bosch, V. (1997). Analysis of vif-defective human immunodeficiency virus type 1 (HIV-1) virions synthesized in non-permissive T lymphoid cells stably infected with selectable HIV-1. Journal of General Virology 78, 627-635.[Abstract]
Öhagen, A. & Gabuzda, D. (2000). Role of Vif in stability of the human immunodeficiency virus type 1 core. Journal of Virology 74, 11055-11066.
Pettit, S. C., Moody, M. D., Wehbie, R. S., Kaplan, A. H., Nantermet, P. V., Klein, C. A. & Swanstrom, R. (1994). The p2 domain of human immunodeficiency virus type 1 Gag regulates sequential proteolytic processing and is required to produce fully infectious virions. Journal of Virology 68, 8017-8027.
Potash, M. J., Bentsman, G., Muir, T., Krachmarov, C., Sova, P. & Volsky, D. J. (1998). Peptide inhibitors of HIV-1 protease and viral infection of peripheral blood lymphocytes based on HIV-1 Vif. Proceedings of the National Academy of Sciences, USA 95, 13865-13868.
Royer, M., Cerutti, M., Gay, B., Hong, S. S., Devauchelle, G. & Boulanger, P. (1991). Functional domains of HIV-1 gag-polyprotein expressed in baculovirus-infected cells. Virology 184, 417-422.[Medline]
Royer, M., Hong, S. S., Gay, B., Cerutti, M. & Boulanger, P. (1992). Expression and extracellular release of human immunodeficiency virus type 1 Gag precursors by recombinant baculovirus-infected cells. Journal of Virology 66, 3230-3235.
Royer, M., Bardy, M., Gay, B., Tournier, J. & Boulanger, P. (1997). Proteolytic activity in vivo and encapsidation of recombinant human immunodeficiency virus type 1 proteinase expressed in baculovirus-infected cells. Journal of General Virology 78, 131-142.[Abstract]
Simm, M., Shahabuddin, M., Chao, W., Allan, J. S. & Volsky, D. J. (1995). Aberrant Gag protein composition of a human immunodeficiency virus type 1 vif mutant produced in primary lymphocytes. Journal of Virology 69, 4582-4586.[Abstract]
Simon, J. H. M., Fouchier, R. A. M., Southerling, T. E., Guerra, C. B., Grant, C. K. & Malim, M. H. (1997). The Vif and Gag proteins of human immunodeficiency virus type 1 colocalize in infected human T cells. Journal of Virology 71, 5259-5267.[Abstract]
Simon, J. H. M., Gaddis, N. C., Fouchier, R. A. M. & Malim, M. H. (1998a). Evidence for a newly discovered cellular anti-HIV-1 phenotype. Nature Medicine 4, 1397-1400.[Medline]
Simon, J. H. M., Miller, D. L., Fouchier, R. A. M., Soares, M. A., Peden, K. W. & Malim, M. H. (1998b). The regulation of primate immunodeficiency virus infectivity by Vif is cell species restricted: a role for Vif in determining virus host range and cross-species transmission. EMBO Journal 17, 1259-1267.[Medline]
Simon, J. H. M., Miller, D. L., Fouchier, R. A. M. & Malim, M. H. (1998c). Virion incorporation of human immunodeficiency virus type 1 Vif is determined by intracellular expression levels and may not be necessary for function. Virology 248, 182-187.[Medline]
Simon, J. H. M., Carpenter, E. A., Fouchier, R. A. M. & Malim, M. H. (1999). Vif and the p55Gag polyprotein of human immunodeficiency virus type 1 are present in colocalizing membrane-free cytoplasmic complexes. Journal of Virology 73, 2667-2674.
Sova, P. & Volsky, D. J. (1993). Efficiency of viral DNA synthesis during infection of permissive and nonpermissive cells with vif-negative human immunodeficiency virus type 1. Journal of Virology 67, 6322-6326.
Sova, P., van Ranst, M., Gupta, P., Balachandran, R., Chao, W., Itescu, S., McKinley, G. & Volsky, D. J. (1995). Conservation of an intact human immunodeficiency virus type 1 vif gene in vitro and in vivo. Journal of Virology 69, 2557-2564.[Abstract]
Sova, P., Volsky, D. J., Wang, L. & Chao, W. (2001). Vif is largely absent from human immunodeficiency virus type 1 mature virions and associates mainly with viral particles containing unprocessed Gag. Journal of Virology 75, 5504-5517.
Spire, B., Sire, J., Zachar, V., Rey, F., Barré-Sinoussi, F., Galibert, F., Hampe, A. & Chermann, J. C. (1989). Nucleotide sequence of HIV1-NDK: a highly cytopathic strain of the human immunodeficiency virus. Gene 81, 275-284.[Medline]
Tanchou, V., Delaunay, T., de Rocquigny, H., Bodeus, M., Darlix, J. L., Roques, B. & Benarous, R. (1994). Monoclonal antibody-mediated inhibition of RNA binding and annealing activities of HIV type 1 nucleocapsid protein. AIDS Research and Human Retroviruses 10, 983-993.[Medline]
Trono, D. (1995). HIV accessory proteins: leading roles for the supporting cast. Cell 82, 189-192.[Medline]
Valverde, V., Lemay, P., Masson, J.-M., Gay, B. & Boulanger, P. (1992). Autoprocessing of the human immunodeficiency virus type 1 protease precursor expressed in Escherichia coli from a synthetic gene. Journal of General Virology 73, 639-651.
Veronese, F. D. M., Rahman, R., Copeland, T. D., Oroszlan, S., Gallo, R. C. & Sarngadharan, M. G. (1987). Immunological and chemical analysis of p6, the carboxyl-terminal fragment of HIV P15. AIDS Research and Human Retroviruses 3, 253-264.[Medline]
von Schwedler, U., Song, J., Aiken, C. & Trono, D. (1993). Vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells. Journal of Virology 67, 4945-4955.
Wieland, U., Hartmann, J., Suhr, H., Salzberger, B., Eggers, H. J. & Kühn, J. E. (1994). In vivo genetic variability of the HIV-1 vif gene. Virology 203, 43-51.[Medline]
Wilk, T., Gross, I., Gowen, B. E., Rutten, T., de Haas, F., Welker, R., Kräusslich, H.-G., Boulanger, P. & Fuller, S. D. (2001). Organization of immature human immunodeficiency virus type 1. Journal of Virology 75, 759-771.
Yang, X., Goncalves, J. & Gabuzda, D. (1996). Phosphorylation of Vif and its role in HIV-1 replication. Journal of Biological Chemistry 271, 10121-10129.
Yang, S., Sun, Y. & Zhang, H. (2001). The multimerization of human immunodeficiency virus type 1 Vif protein: a requirement for Vif function in the viral life cycle. Journal of Biological Chemistry 276, 4889-4893.
Zhang, H., Pomerantz, R. J., Dornadula, G. & Sun, Y. (2000). Human immunodeficiency virus type 1 Vif protein is an integral component of an mRNP complex of viral RNA and could be involved in the viral RNA folding and packaging process. Journal of Virology 74, 8252-8261.
Received 22 May 2001;
accepted 2 August 2001.
This article has been cited by other articles:
![]() |
S. Henriet, G. Mercenne, S. Bernacchi, J.-C. Paillart, and R. Marquet Tumultuous Relationship between the Human Immunodeficiency Virus Type 1 Viral Infectivity Factor (Vif) and the Human APOBEC-3G and APOBEC-3F Restriction Factors Microbiol. Mol. Biol. Rev., June 1, 2009; 73(2): 211 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ludwig, A. Leiherer, and R. Wagner Importance of Protease Cleavage Sites within and Flanking Human Immunodeficiency Virus Type 1 Transframe Protein p6* for Spatiotemporal Regulation of Protease Activation J. Virol., May 1, 2008; 82(9): 4573 - 4584. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Henriet, L. Sinck, G. Bec, R. J. Gorelick, R. Marquet, and J.-C. Paillart Vif is a RNA chaperone that could temporally regulate RNA dimerization and the early steps of HIV-1 reverse transcription Nucleic Acids Res., August 1, 2007; 35(15): 5141 - 5153. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Abram and M. A. Parniak Virion Instability of Human Immunodeficiency Virus Type 1 Reverse Transcriptase (RT) Mutated in the Protease Cleavage Site between RT p51 and the RT RNase H Domain J. Virol., September 15, 2005; 79(18): 11952 - 11961. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Akari, M. Fujita, S. Kao, M. A. Khan, M. Shehu-Xhilaga, A. Adachi, and K. Strebel High Level Expression of Human Immunodeficiency Virus Type-1 Vif Inhibits Viral Infectivity by Modulating Proteolytic Processing of the Gag Precursor at the p2/Nucleocapsid Processing Site J. Biol. Chem., March 26, 2004; 279(13): 12355 - 12362. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Baraz, M. Hutoran, I. Blumenzweig, M. Katzenellenbogen, A. Friedler, C. Gilon, M. Steinitz, and M. Kotler Human immunodeficiency virus type 1 Vif binds the viral protease by interaction with its N-terminal region J. Gen. Virol., September 1, 2002; 83(9): 2225 - 2230. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goncalves, F. Silva, A. Freitas-Vieira, M. Santa-Marta, R. Malho, X. Yang, D. Gabuzda, and C. Barbas III Functional Neutralization of HIV-1 Vif Protein by Intracellular Immunization Inhibits Reverse Transcription and Viral Replication J. Biol. Chem., August 23, 2002; 277(35): 32036 - 32045. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Khan, H. Akari, S. Kao, C. Aberham, D. Davis, A. Buckler-White, and K. Strebel Intravirion Processing of the Human Immunodeficiency Virus Type 1 Vif Protein by the Viral Protease May Be Correlated with Vif Function J. Virol., August 12, 2002; 76(18): 9112 - 9123. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |