|
|
||||||||
Animal: DNA Viruses |
Departamento de Biotecnología INIA, Ctra La Coruña km 7·5, E-28040 Madrid, Spain1
Author for correspondence: Rafael Blasco. Fax +34 91 357 22 93. e-mail blasco{at}inia.es
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Vaccinia virus intracellular mature virus (IMV) particles are assembled in specialized areas of the cytoplasm located close to the cell nucleus. A portion of the IMV are wrapped by vesicles derived from the trans-Golgi network (TGN), acquiring a double membrane, to form what are called intracellular enveloped viruses (IEV) (Hiller & Weber, 1985
; Schmelz et al., 1994
). The egress of virions to the extracellular space is attained by fusion of the IEV outer membrane with the plasma membrane. Virus particles released to the medium, termed extracellular enveloped virus (EEV), contain an additional membrane with respect to IMV.
A number of observations indicate that the process of acquisition of the virus envelope is required for the exit of virions from the cell and therefore for virus transmission. Mutations that impede virus envelopment result in a block in EEV formation and virus transmission (Blasco & Moss, 1991
; Rodriguez & Smith, 1990
). For example, deletion of the F13L gene, encoding the major protein of the EEV envelope, results in a virus that forms normal amounts of IMV, but dramatically reduced amounts of EEV (Blasco & Moss, 1991
, 1992
). It is important to note that, even under these circumstances, IMV are not able to reach the extracellular space, since no significant amounts of IMV were found in the medium. Also, treatment with N1-isonicotinoyl-N2-3-methyl-4-chlorobenzoylhydrazine (IMCBH), a drug that blocks virus envelopment, blocks virus release completely (Hiller et al., 1981
; Kato et al., 1969
; Payne & Kristenson, 1979
).
One aspect that has received attention recently is the intracellular transport of virus structures assembled at late times during infection. Fully assembled IMV particles must be transported from the assembly areas into areas containing the wrapping vesicles and IEV must subsequently be transported towards the cell periphery, where they fuse with the plasma membrane. Mechanisms accounting for some of these movements have been described. Recent studies indicate that the microtubule cytoskeleton is involved in IMV assembly and is required for IEV formation (Ploubidou et al., 2000
) and for the transport of IMV to the sites of wrapping (Sanderson et al., 2000
).
The most prominent feature of IEV transport is the induction of actin tails by IEV particles, which give rise to engrossed microvilli at the cell surface with virus particles at the tip. These were recognized some time ago by electron microscopy (Stokes, 1976
) and immunofluorescence (Hiller et al., 1979
) and are the only well-characterized mechanism for the transport of enveloped virions. Actin tails are formed by nucleation of actin close to the cytosolic side of the outer IEV membrane (Cudmore et al., 1995
, 1996
, 1997
; Way, 1998
), a process that is dependent on the phosphorylation of viral protein A36R (Frischknecht et al., 1999a
, b
).
We present here a characterization of the dynamics of enveloped virus movement within the infected cell and provide evidence for mechanisms of IEV transport that are different from the induction of actin tails.
| Methods |
|---|
|
|
|---|
Cells, plasmids and virus.
Construction of W-rsGFP.
W-rsGFP, a vaccinia virus recombinant expressing an enhanced version of the GFP gene, rsGFP (Quantum Biotechnologies), was constructed by inserting the rsGFP gene into the vaccinia virus (WR strain) genome downstream of the F13L gene. Briefly, three DNA fragments containing the F13L gene, the rsGFP gene and recombination flanking sequences were amplified by PCR. Plasmid pRB21 was used as a template to amplify the F13L gene and left flanking sequence with oligonucleotides HF1510 (5' GGACATGCTTATGTACGTAGAAGAAAAA 3') and pRB21-1870 (5' CATTTATATTCCAAAAAAAAAAAAATA 3'). The right flank of the vaccinia virus F13L gene was amplified from pRB21 by using the primers pRB21 1914 (5' TAAATAAATAATTTTTATGGATCGG 3') and HF3400 (5' CGTTCTAAAGCTAGTGCTATATCTCCC 3'). The rsGFP gene was amplified by PCR from plasmid pQBI25 with oligonucleotides 5' AATATAAATGGCTAGCAAAGGAGAAGAA 3' and 5' TTTTTAACGATTTACTAGTGGATCCTCAGTTGTA 3'. Overlapping ends were included in the oligonucleotides to facilitate the assembly of the PCR fragments. Insertion into the vaccinia virus genome (vRB12) was accomplished as described previously (Lorenzo & Blasco, 1998
). W-rsGFP was isolated from progeny virus by three rounds of plaque purification on BSC-1 cells (Earl & Moss, 1991
), during which plaques were screened for GFP fluorescence (Lorenzo & Blasco, 1998
). The resulting virus, W-rsGFP, contained the F13L gene and the rsGFP gene downstream of a strong synthetic early/late promoter.
Construction of W-P37g and I-P37g.
A vaccinia virus recombinant expressing the GFP gene fused to the C terminus of the F13L gene (W-P37g) was constructed as follows: two overlapping DNA fragments were amplified by PCR from W-rsGFP viral DNA. One of the fragments, containing the P37 coding sequence, was amplified by using the oligonucleotides HF1510 (5' GGACATGCTTATGTACGTAGAAGAAAAA 3') and P37/rsGFPL (5' CATTGCTATCTTAAGACTCTTTGAATGTG 3'). The second fragment, including the rsGFP sequence, was amplified with primers P37/rsGFPR (5' GATAGCAATGGCTAGCAAAGGAGAAGAA 3') and HF3400 (5' CGTTCTAAAGCTAGTGCTATATCTCCC 3'). The overlap between the flanks eliminated the stop codon at the end of the P37 gene and provided in-frame fusion with the rsGFP gene. The isolation of W-P37g from vRB12 virus by transfection of these PCR fragments was carried out as described above. The recombinant virus W-P37g contained the rsGFP gene fused to the P37 coding sequence and the chimeric gene is therefore under the control of the natural F13L promoter.
Recombinant virus I-P37g was constructed by transferring the fused P37GFP gene in W-P37g to the IHD-J background. The chimeric gene and flanks were amplified by PCR from W-P37g DNA as a single fragment by using primers HF1510 (5' GGACATGCTTATGTACGTAGAAGAAAAA 3') and HF3400 (5' CGTTCTAAAGCTAGTGCTATATCTCCC 3'). This PCR fragment was then inserted into a P37-deletion mutant derived from IHD-J (vRB10) (Blasco & Moss, 1991
). Virus I-P37g was isolated by selecting large virus plaques following protocols described previously (Blasco & Moss, 1995
).
Construction of W-gA33R.
For the construction of the recombinant virus W-gA33R, DNA from vaccinia virus WR was used as a template to amplify the A33R coding sequence with oligonucleotides A33HIa (5' TAAATAAGCTTTATTATCATGATGACAC 3'; HindIII site underlined) and A33HIb (5' GCGATTTCAAGCTTAATGTACAAAAATA 3'; HindIII site underlined). The PCR product was digested with HindIII and cloned into plasmid pRBrsGFP, which had been digested previously with HindIII, resulting in pRB-gA33R. This plasmid was then used to insert the fused gene into virus vRB12, using procedures described previously (Blasco & Moss, 1995
). The recombinant virus isolated, W-gA33R, contains, in addition to the natural A33R gene, the rsGFP gene fused to the A33R coding sequence, downstream of a strong synthetic early/late promoter.
Construction of W-B5Rg.
For the construction of the recombinant vaccinia virus W-B5Rg, the C terminus of the B5R gene was amplified by PCR from vaccinia virus WR genomic DNA using primers B5R-H (5' CTAACGAAGCTTTTGATCCAGTGGATGA 3'; HindIII site underlined) and B5R-N (5' TTTAACGGCTAGCTATTGACGGTAGCAAT 3'; NheI site underlined). The PCR product was digested with HindIII and NheI and inserted into the HindIII/NheI site upstream of the rsGFP gene in plasmid pFus (B. Perdiguero and R. Blasco, unpublished), which contains the rsGFP gene and the pac gene (puromycin acetyltransferase), a selectable marker in vaccinia virus that confers puromycin resistance (Sanchez-Puig & Blasco, 2000
). Primer B5R-N eliminated the stop codon at the end of the B5R gene and provided in-frame fusion with the rsGFP gene. The resulting plasmid (pFus-B5R) was used to transfect cells infected with vaccinia virus WR to construct virus recombinant W-B5Rg following procedures described previously (Earl & Moss, 1991
; Sanchez-Puig & Blasco, 2000
). This recombinant virus contained the rsGFP gene fused to the B5R coding sequence and the chimeric gene is under the control of the natural B5R promoter. Since W-B5Rg is the result of a single recombination event, and could produce the parental WR virus by intramolecular recombination, puromycin selection was applied during amplification of the virus stocks.
Western blotting.
Western blots of infected cell lysates were carried out using BSC-1 cells grown in 6-well plates and harvested 24 h after infection. The cells were pelleted and lysed in 50 µl lysis buffer as described previously (Herrera et al., 1998
). Proteins were electrophoresed in 12% SDSpolyacrylamide gels and transferred to nitrocellulose membranes by electroblotting. After transfer, the membranes were incubated overnight at 4 °C in blocking buffer (PBS containing 0·05% Tween 20 and 5% non-fat dry milk). The membranes were then incubated with monoclonal antibody anti-P37 (diluted 1:50) or monoclonal antibody anti-GFP (diluted 1:5000) (Clontech) for 1 h at room temperature in PBS supplemented with 0·05% Tween 20 and 1% non-fat dry milk. After extensive washing with PBS0·05% Tween 20, the membranes were incubated for 1 h at room temperature with rat or mouse anti-IgG antibody (diluted 1:3000) conjugated with horseradish peroxidase (Amersham) in PBS0·05% Tween 20 containing 1% non-fat dry milk. After washing, membranes were incubated for 1 min with a 1:1 mixture of solution A [2·5 mM luminol (Sigma), 0·4 mM p-coumaric acid (Sigma), 100 mM TrisHCl, pH 8·5] and solution B (0·018% H2O2, 100 mM TrisHCl, pH 8·5) and exposed to X-ray film.
Fluorescence microscopy.
BHK-21 cells grown to 70% confluence on round coverslips were infected with viruses at a multiplicity of 5 p.f.u. per cell. At 7 h post-infection (p.i.), the medium was removed and the cells were washed twice with PBS and fixed by the addition of ice-cold 4% paraformaldehyde for 12 min at room temperature. All subsequent incubations were carried out at room temperature. When permeabilization was desired, the fixed cells were incubated in PBS containing 0·1% Triton X-100 for 15 min. After washing with PBS, cells were incubated for 5 min with PBS containing 0·1 M glycine and then with primary antibodies diluted in PBS20% foetal calf serum for 30 min. Rat monoclonal antibodies 15B6 (anti-P37) and 19C2 (anti-B5R) were made available by G. Hiller (Boehringer Mannheim, Germany). Rabbit polyclonal anti-A33R antiserum was provided by M. Way (European Molecular Biology Laboratory). After washing for 5 min in PBS, the cells were incubated for 30 min with rabbit anti-mouse IgG conjugated with TRITC (Dako) diluted 1:200. Some preparations were incubated with 0·02 mg/ml TRITC-conjugated wheat germ agglutinin (WGA) (Sigma), 2 µg/ml bisbenzimide Hoechst or 1 unit/ml Alexa594phalloidin (Molecular Probes) for 30 min at room temperature.
Time-lapse microscopy.
Cells were grown on round coverslips that were mounted at the bottom of sealed ludin chambers (Life Imaging Services, Olten, Switzerland). The chamber was mounted in a metal case containing an internal electric resistor with electronic temperature control. All experiments were performed at 37 °C. Where applicable, drugs were included in the cell culture medium at the following final concentrations: 10 µg/ml IMCBH, 10 µM nocodazole, 10 mM 2,3-butanedione monoxime (BDM). Cells were observed with a Nikon Diaphot or Nikon Eclipse T300 inverted microscope equipped with fluorescence. Digital images were captured with a SBIG ST-7 cooled CCD camera at resolutions of 765x510 or 384x256 pixels. In general, digital images were acquired at 6·8 s intervals after 7 h p.i. For high-speed video microscopy, images were acquired with a Hamamatsu C5985 CCD camera and captured from the composite video signal to a Sony DCR-TR7000E digital video camera and subsequently transferred to a computer using an IEEE-1394 card. Finally, distances were measured on digital images by using the PC version of the HIH image software (Scion; http://www.scioncorp.com).
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
In a recent report (Ward & Moss, 2001
), GFP fused to the cytoplasmic tail of protein B5R was used to label the virus envelope. We found that a similar GFPB5R fusion had a distribution that deviated from that of the wild-type B5R protein, although virus-like structures were clearly labelled (Fig. 1
). One interpretation of our results is that fusion of the cytosolic domain of B5R with GFP may to some degree affect the intracellular distribution of the fusion protein or its incorporation into the EEV envelope. In any event, it seems likely that both the B5R and F13L GFP fusions are useful for visualizing enveloped virions. The results shown here, obtained with the F13LGFP fusion, are in good agreement with those described for the B5RGFP-expressing virus.
The only well-described IEV transport mechanism is the induction of actin tails that propel the virus out of the cell and into neighbouring cells. However, some virus mutants that do not induce actin tails are able to produce virus that reaches the extracellular space (Herrera et al., 1998
; Mathew et al., 1998
; Wolffe et al., 1997
), implying that alternative mechanisms for IEV transport must exist. In this report, we have shown IEV movements that suggest the existence of at least one additional mechanism. In particular, fast, saltatory movements were demonstrated, that are clearly distinguishable from those driven by actin tails. That these fast movements could be dependent on microtubules is supported by the following observations: (i) virion speeds were 5- to 50-fold higher than those of virions propelled by actin tails (Cudmore et al., 1995
) and were compatible with those provided by microtubule-dependent organelle movements (Lippincott-Schwartz et al., 2000
), (ii) movements of virions were saltatory and followed approximately straight trajectories, suggesting that they were moving along pre-existing longitudinal structures and (iii) the microtubule-depolymerizing agent nocodazole, but not the myosin inhibitor BDM, blocked these movements.
Our results, however, do not rule out a potential role for myosin motors in IEV transport. It has been clearly established that the actin and microtubule cytoskeletons cooperate in organelle transport in a variety of situations (Goode et al., 2000
; Rogers & Gelfand, 2000
). For example, secretory vesicles move by both microtubule- and microfilament-based motors. It is possible that the slower IEV movements that persist in the absence of microtubules are due not only to the induction of actin tails but also to the action of myosin motors.
The fast IEV movements observed displayed speeds of up to 3 µm/s. In addition, a variety of slower movements were recorded that may be accounted for by actin tails and additional mechanisms. It is notable that even the slow movements described here are at least 100-fold faster than the calculated rate of IEV diffusion (Sodeik, 2000
), reinforcing the idea of the existence of active transport mechanisms for virus particles.
The fast IEV movements detected in infected cells are reminiscent of normal Golgi-to-plasma membrane vesicular transport (Lippincott-Schwartz et al., 2000
). Post-Golgi carriers are generated as tubules that extend from the Golgi complex (Hirschberg et al., 1998
). Vesicle transport from the TGN to the plasma membrane is dependent on microtubules and has been reported to have maximum speeds of 0·20·4 µm/s (Kreitzer et al., 2000
), 0·7 µm/s (Toomre et al., 1999
), 1 µm/s (Wacker et al., 1997
) or 2·7 µm/s (Hirschberg et al., 1998
). We have observed several features, such as tubules extending from the Golgi and virions reversing direction, that are also seen in the generation of normal post-Golgi carriers (Hirschberg et al., 1998
; Kreitzer et al., 2000
; Wacker et al., 1997
). Whether IEV behave functionally like normal cellular post-Golgi carriers remains an open question. It is conceivable that virus infection could modify microtubule-dependent transport mechanisms to facilitate IEV transport. Interestingly, several virus-encoded proteins are associated with microtubules during infection (Ploubidou et al., 2000
), raising the possibility that these or other virus-encoded proteins could be involved in the modulation of microtubule-dependent IEV transport.
Ploubidou et al. (2000)
have recently reported a study of the effect of vaccinia virus infection on the microtubule network. These authors note that, late during infection (512 h p.i.), the microtubule cytoskeleton is disorganized, giving rise to several types of aberrant organizations in which the microtubules are randomly orientated or form bundles or rings around the cell nucleus. It is unclear how modifications of the microtubule network may affect virus movements. We have consistently observed that fast virion movements do not occur only in the Golgi-to-plasma membrane direction, or only in the reverse direction, but occur in all directions. It is likely that the apparent lack of defined directionality of these movements may be related to the disorganization of the centrosome at late times of infection. In any event, our results support the notion that non-continuous, recurrent and reverse virion movements make IEV transport a surprisingly inefficient process.
At present, it is not known whether the different mechanisms for the transport of IEV fulfil different functions in the spread of virus in the tissue. For instance, transport of virions by actin tails correlates with plaque size but not with EEV formation, suggesting that the primary function of these virions is the direct cell-to-cell transmission of virus (Cudmore et al., 1995
; Sanderson et al., 1998
). Conversely, IEV transport by a different mechanism, such as the one depicted here, could produce enveloped virions free in the extracellular medium that would be optimal for long-range virus spread. Alternatively, different mechanisms could be involved in consecutive steps in the transport of enveloped virions from the Golgi area to the cell periphery, to the proximity of the plasma membrane and finally into the extracellular space.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Blasco, R. & Moss, B. (1992). Role of cell-associated enveloped vaccinia virus in cell-to-cell virus spread. Journal of Virology 66, 4170-4179.
Blasco, R. & Moss, B. (1995). Selection of recombinant vaccinia viruses on the basis of plaque formation. Gene 158, 157-162.[Medline]
Cudmore, S., Cossart, P., Griffiths, G. & Way, M. (1995). Actin-based motility of vaccinia virus. Nature 378, 636-638.[Medline]
Cudmore, S., Reckmann, I., Griffiths, G. & Way, M. (1996). Vaccinia virus: a model system for actinmembrane interactions. Journal of Cell Science 109, 1739-1747.[Abstract]
Cudmore, S., Reckmann, I. & Way, M. (1997). Viral manipulations of the actin cytoskeleton. Trends in Microbiology 5, 142-148.[Medline]
Earl, P. & Moss, B. (1991). Expression of proteins in mammalian cells using vaccinia viral vectors. In Current Protocols in Molecular Biology, section IV, units 16.1516.19. Edited by F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith & K. Struhl. New York: Wiley.
Frischknecht, F., Cudmore, S., Moreau, V., Reckmann, I., Rottger, S. & Way, M. (1999a). Tyrosine phosphorylation is required for actin-based motility of vaccinia but not Listeria or Shigella. Current Biology 9, 89-92.[Medline]
Frischknecht, F., Moreau, V., Rottger, S., Gonfloni, S., Reckmann, I., Superti-Furga, G. & Way, M. (1999b). Actin-based motility of vaccinia virus mimics receptor tyrosine kinase signalling. Nature 401, 926-929.[Medline]
Goode, B. L., Drubin, D. G. & Barnes, G. (2000). Functional cooperation between the microtubule and actin cytoskeletons. Current Opinion in Cell Biology 12, 63-71.[Medline]
Herrera, E., del Mar Lorenzo, M., Blasco, R. & Isaacs, S. N. (1998). Functional analysis of vaccinia virus B5R protein: essential role in virus envelopment is independent of a large portion of the extracellular domain. Journal of Virology 72, 294-302.
Higuchi, H. & Takemori, S. (1989). Butanedione monoxime suppresses contraction and ATPase activity of rabbit skeletal muscle. Journal of Biochemistry 105, 638-643.
Hiller, G. & Weber, K. (1985). Golgi-derived membranes that contain an acylated viral polypeptide are used for vaccinia virus envelopment. Journal of Virology 55, 651-659.
Hiller, G., Weber, K., Schneider, L., Parajsz, C. & Jungwirth, C. (1979). Interaction of assembled progeny pox viruses with the cellular cytoskeleton. Virology 98, 142-153.[Medline]
Hiller, G., Eibl, H. & Weber, K. (1981). Characterization of intracellular and extracellular vaccinia virus variants: N1-isonicotinoyl-N2-3-methyl-4-chlorobenzoylhydrazine interferes with cytoplasmic virus dissemination and release. Journal of Virology 39, 903-913.
Hirschberg, K., Miller, C. M., Ellenberg, J., Presley, J. F., Siggia, E. D., Phair, R. D. & Lippincott-Schwartz, J. (1998). Kinetic analysis of secretory protein traffic and characterization of golgi to plasma membrane transport intermediates in living cells. Journal of Cell Biology 143, 1485-1503.
Kato, N., Eggers, H. J. & Rolly, H. (1969). Inhibition of release of vaccinia virus by N1-isonicotinoyl-N2-3-methyl-4-chlorobenzoylhydrazine. Journal of Experimental Medicine 129, 795-808.[Abstract]
Kreitzer, G., Marmorstein, A., Okamoto, P., Vallee, R. & Rodriguez-Boulan, E. (2000). Kinesin and dynamin are required for post-Golgi transport of a plasma-membrane protein. Nature Cell Biology 2, 125-127.[Medline]
Lippincott-Schwartz, J., Roberts, T. H. & Hirschberg, K. (2000). Secretory protein trafficking and organelle dynamics in living cells. Annual Review of Cell and Developmental Biology 16, 557-589.[Medline]
Lorenzo, M. M. & Blasco, R. (1998). PCR-based method for the introduction of mutations in genes cloned and expressed in vaccinia virus. Biotechniques 24, 308-313.[Medline]
Lorenzo, M. M., Galindo, I., Griffiths, G. & Blasco, R. (2000). Intracellular localization of vaccinia virus extracellular enveloped virus envelope proteins individually expressed using a Semliki Forest virus replicon. Journal of Virology 74, 10535-10550.
McKillop, D. F., Fortune, N. S., Ranatunga, K. W. & Geeves, M. A. (1994). The influence of 2,3-butanedione 2-monoxime (BDM) on the interaction between actin and myosin in solution and in skinned muscle fibres. Journal of Muscle Research and Cell Motility 15, 309-318.[Medline]
Mathew, E., Sanderson, C. M., Hollinshead, M. & Smith, G. L. (1998). The extracellular domain of vaccinia virus protein B5R affects plaque phenotype, extracellular enveloped virus release, and intracellular actin tail formation. Journal of Virology 72, 2429-2438.
Moss, B. (1996). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2637-2671. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Payne, L. G. & Kristenson, K. (1979). Mechanism of vaccinia virus release and its specific inhibition by N1-isonicotinoyl-N2-3-methyl-4-chlorobenzoylhydrazine. Journal of Virology 32, 614-622.
Ploubidou, A., Moreau, V., Ashman, K., Reckmann, I., Gonzalez, C. & Way, M. (2000). Vaccinia virus infection disrupts microtubule organization and centrosome function. EMBO Journal 19, 3932-3944.[Medline]
Rodriguez, J. F. & Smith, G. L. (1990). IPTG-dependent vaccinia virus: identification of a virus protein enabling virion envelopment by Golgi membrane and egress. Nucleic Acids Research 18, 5347-5351.
Rogers, S. L. & Gelfand, V. I. (2000). Membrane trafficking, organelle transport, and the cytoskeleton. Current Opinion in Cell Biology 12, 57-62.[Medline]
Sanchez-Puig, J. M. & Blasco, R. (2000). Puromycin resistance (pac) gene as a selectable marker in vaccinia virus. Gene 257, 57-65.[Medline]
Sanderson, C. M., Frischknecht, F., Way, M., Hollinshead, M. & Smith, G. L. (1998). Roles of vaccinia virus EEV-specific proteins in intracellular actin tail formation and low pH-induced cellcell fusion. Journal of General Virology 79, 1415-1425.[Abstract]
Sanderson, C. M., Hollinshead, M. & Smith, G. L. (2000). The vaccinia virus A27L protein is needed for the microtubule-dependent transport of intracellular mature virus particles. Journal of General Virology 81, 47-58.
Schmelz, M., Sodeik, B., Ericsson, M., Wolffe, E. J., Shida, H., Hiller, G. & Griffiths, G. (1994). Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans Golgi network. Journal of Virology 68, 130-147.
Sodeik, B. (2000). Mechanisms of viral transport in the cytoplasm. Trends in Microbiology 8, 465-472.[Medline]
Stokes, G. V. (1976). High-voltage electron microscope study of the release of vaccinia virus from whole cells. Journal of Virology 18, 636-643.
Toomre, D., Keller, P., White, J., Olivo, J. C. & Simons, K. (1999). Dual-color visualization of trans-Golgi network to plasma membrane traffic along microtubules in living cells. Journal of Cell Science 112, 21-33.[Abstract]
Wacker, I., Kaether, C., Kromer, A., Migala, A., Almers, W. & Gerdes, H. H. (1997). Microtubule-dependent transport of secretory vesicles visualized in real time with a GFP-tagged secretory protein. Journal of Cell Science 110, 1453-1463.[Abstract]
Ward, B. M. & Moss, B. (2001). Visualization of intracellular movement of vaccinia virus virions containing a green fluorescent proteinB5R membrane protein chimera. Journal of Virology 75, 4802-4813.
Way, M. (1998). Interaction of vaccinia virus with the actin cytoskeleton. Folia Microbiologica 43, 305-310.[Medline]
Wolffe, E. J., Katz, E., Weisberg, A. & Moss, B. (1997). The A34R glycoprotein gene is required for induction of specialized actin-containing microvilli and efficient cell-to-cell transmission of vaccinia virus. Journal of Virology 71, 3904-3915.[Abstract]
Received 27 April 2001;
accepted 9 July 2001.
This article has been cited by other articles:
![]() |
A. K. Earley, W. M. Chan, and B. M. Ward The Vaccinia Virus B5 Protein Requires A34 for Efficient Intracellular Trafficking from the Endoplasmic Reticulum to the Site of Wrapping and Incorporation into Progeny Virions J. Virol., March 1, 2008; 82(5): 2161 - 2169. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Honeychurch, G. Yang, R. Jordan, and D. E. Hruby The Vaccinia Virus F13L YPPL Motif Is Required for Efficient Release of Extracellular Enveloped Virus J. Virol., July 1, 2007; 81(13): 7310 - 7315. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Alzhanova and D. E. Hruby A trans-Golgi Network Resident Protein, golgin-97, Accumulates in Viral Factories and Incorporates into Virions during Poxvirus Infection J. Virol., December 1, 2006; 80(23): 11520 - 11527. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Perdiguero and R. Blasco Interaction between Vaccinia Virus Extracellular Virus Envelope A33 and B5 Glycoproteins. J. Virol., September 1, 2006; 80(17): 8763 - 8777. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Santos, S. Blanco, A. Sevilla, and P. A. Lazo Vaccinia Virus B1R Kinase Interacts with JIP1 and Modulates c-Jun-Dependent Signaling. J. Virol., August 1, 2006; 80(15): 7667 - 7675. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Munter, M. Way, and F. Frischknecht Signaling During Pathogen Infection Sci. Signal., May 16, 2006; 2006(335): re5 - re5. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. W. G. Luxton, J. I-H. Lee, S. Haverlock-Moyns, J. M. Schober, and G. A. Smith The Pseudorabies Virus VP1/2 Tegument Protein Is Required for Intracellular Capsid Transport J. Virol., January 1, 2006; 80(1): 201 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Roper Characterization of the Vaccinia Virus A35R Protein and Its Role in Virulence J. Virol., January 1, 2006; 80(1): 306 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Herrero-Martinez, K. L. Roberts, M. Hollinshead, and G. L. Smith Vaccinia virus intracellular enveloped virions move to the cell periphery on microtubules in the absence of the A36R protein J. Gen. Virol., November 1, 2005; 86(11): 2961 - 2968. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-L. Chiu, P. Szajner, B. Moss, and W. Chang Effects of a Temperature Sensitivity Mutation in the J1R Protein Component of a Complex Required for Vaccinia Virus Assembly J. Virol., July 1, 2005; 79(13): 8046 - 8056. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Ward Visualization and Characterization of the Intracellular Movement of Vaccinia Virus Intracellular Mature Virions J. Virol., April 15, 2005; 79(8): 4755 - 4763. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Sampaio, Y. Cavignac, Y.-D. Stierhof, and C. Sinzger Human Cytomegalovirus Labeled with Green Fluorescent Protein for Live Analysis of Intracellular Particle Movements J. Virol., March 1, 2005; 79(5): 2754 - 2767. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yonezawa, M. Cavrois, and W. C. Greene Studies of Ebola Virus Glycoprotein-Mediated Entry and Fusion by Using Pseudotyped Human Immunodeficiency Virus Type 1 Virions: Involvement of Cytoskeletal Proteins and Enhancement by Tumor Necrosis Factor Alpha J. Virol., January 15, 2005; 79(2): 918 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Muller, J. Daecke, O. T. Fackler, M. T. Dittmar, H. Zentgraf, and H.-G. Krausslich Construction and Characterization of a Fluorescently Labeled Infectious Human Immunodeficiency Virus Type 1 Derivative J. Virol., October 1, 2004; 78(19): 10803 - 10813. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Newsome, N. Scaplehorn, and M. Way Src Mediates a Switch from Microtubule- to Actin-Based Motility of Vaccinia Virus Science, October 1, 2004; 306(5693): 124 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. G. Senkevich, B. M. Ward, and B. Moss Vaccinia Virus Entry into Cells Is Dependent on a Virion Surface Protein Encoded by the A28L Gene J. Virol., March 1, 2004; 78(5): 2357 - 2366. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Ward and B. Moss Vaccinia Virus A36R Membrane Protein Provides a Direct Link between Intracellular Enveloped Virions and the Microtubule Motor Kinesin J. Virol., March 1, 2004; 78(5): 2486 - 2493. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Carter, G. Rodger, B. J. Murphy, M. Law, O. Krauss, M. Hollinshead, and G. L. Smith Vaccinia virus cores are transported on microtubules J. Gen. Virol., September 1, 2003; 84(9): 2443 - 2458. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mercer and P. Traktman Investigation of Structural and Functional Motifs within the Vaccinia Virus A14 Phosphoprotein, an Essential Component of the Virion Membrane J. Virol., August 15, 2003; 77(16): 8857 - 8871. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Petit, M.-L. Giron, J. Tobaly-Tapiero, P. Bittoun, E. Real, Y. Jacob, N. Tordo, H. de The, and A. Saib Targeting of incoming retroviral Gag to the centrosome involves a direct interaction with the dynein light chain 8 J. Cell Sci., August 15, 2003; 116(16): 3433 - 3442. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Ward, A. S. Weisberg, and B. Moss Mapping and Functional Analysis of Interaction Sites within the Cytoplasmic Domains of the Vaccinia Virus A33R and A36R Envelope Proteins J. Virol., April 1, 2003; 77(7): 4113 - 4126. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Szajner, H. Jaffe, A. S. Weisberg, and B. Moss Vaccinia Virus G7L Protein Interacts with the A30L Protein and Is Required for Association of Viral Membranes with Dense Viroplasm To Form Immature Virions J. Virol., March 15, 2003; 77(6): 3418 - 3429. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Smith, A. Vanderplasschen, and M. Law The formation and function of extracellular enveloped vaccinia virus J. Gen. Virol., December 1, 2002; 83(12): 2915 - 2931. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. McKelvey, S. C. Andrews, S. E. Miller, C. A. Ray, and D. J. Pickup Identification of the Orthopoxvirus p4c Gene, Which Encodes a Structural Protein That Directs Intracellular Mature Virus Particles into A-Type Inclusions J. Virol., October 11, 2002; 76(22): 11216 - 11225. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Katz, E. Wolffe, and B. Moss Identification of Second-Site Mutations That Enhance Release and Spread of Vaccinia Virus J. Virol., October 11, 2002; 76(22): 11637 - 11644. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Krauss, R. Hollinshead, M. Hollinshead, and G. L. Smith An investigation of incorporation of cellular antigens into vaccinia virus particles J. Gen. Virol., October 1, 2002; 83(10): 2347 - 2359. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-L. Chiu and W. Chang Vaccinia Virus J1R Protein: a Viral Membrane Protein That Is Essential for Virion Morphogenesis J. Virol., August 28, 2002; 76(19): 9575 - 9587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Husain and B. Moss Similarities in the Induction of Post-Golgi Vesicles by the Vaccinia Virus F13L Protein and Phospholipase D J. Virol., June 27, 2002; 76(15): 7777 - 7789. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |