J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dunowska, M.
Right arrow Articles by DeMartini, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dunowska, M.
Right arrow Articles by DeMartini, J. C.
Agricola
Right arrow Articles by Dunowska, M.
Right arrow Articles by DeMartini, J. C.
Journal of General Virology (2001), 82, 2785-2790.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Ovine herpesvirus-2 glycoprotein B sequences from tissues of ruminant malignant catarrhal fever cases and healthy sheep are highly conserved

Magdalena Dunowska1, Geoffrey J. Letchworth2, James K. Collins3 and James C. DeMartini1

Department of Pathology, Colorado State University, Fort Collins, CO 80523, USA1
USDA, ARS, Arthropod-borne Animal Diseases Research Laboratory, Laramie, WY 82071-3965, USA2
Department of Veterinary Science and Microbiology, University of Arizona, Tucson, AZ 85721-0090, USA3

Author for correspondence: Magdalena Dunowska. Fax +1 970 491 0603. e-mail mdunowsk{at}lamar.colostate.edu


   Abstract
TOP
Abstract
Main text
References
 
Ovine herpesvirus-2 (OHV-2) infection has been associated with malignant catarrhal fever (MCF) in susceptible ruminants. In order to further investigate whether OHV-2 is an aetiological agent for sheep-associated (SA) MCF in cattle and bison, the entire sequences of OHV-2 glycoprotein B (gB) from different sources of viral DNA were compared. Target DNA was derived from tissues of bovine and bison cases of SA-MCF, from a lymphoblastoid cell line established from another bovine case of SA-MCF, and from a healthy sheep. The divergence between deduced amino acid sequences of OHV-2 gB ranged from 0·5 to 1·2%. The high degree of similarity between gB sequences from a healthy sheep and clinical cases of SA-MCF in cattle and bison suggests that OHV-2 is an ovine virus that is occasionally transmitted to other ruminant species, in which it can cause severe disease.


   Main text
TOP
Abstract
Main text
References
 
Malignant catarrhal fever (MCF) is an acute, generalized, often fatal disease of domestic and wild ruminants (Plowright, 1990Down ). Clinicopathological features of the disease include fever, lymphadenopathy, keratoconjunctivitis, lymphoid vasculitis, synovitis, dermatitis and severe inflammatory and degenerative lesions on all mucosal surfaces (Plowright, 1990Down ). There are at least two herpesviruses implicated in the aetiology of MCF. Wildebeest-associated or African MCF is caused by infection with alcelaphine herpesvirus-1 (AHV-1). AHV-1 is spread to susceptible ruminants from wildebeests, which are asymptomatic hosts for the virus. Sheep-associated MCF (SA-MCF) predominates in Europe and North America, where it is often found in cattle or bison in contact with sheep. The causative agent of SA-MCF has not yet been definitely identified, but PCR-based data strongly implicate ovine herpesvirus-2 (OHV-2) (Schultheiss et al., 2000Down ; Collins et al., 2000Down ). Sheep are presumed to be asymptomatic hosts for this virus, analogous to the situation observed wildebeest in Africa (Crawford et al., 1999Down ; Schultheiss et al., 1998Down ; Li et al., 1998Down ). However, unlike AHV-1, OHV-2 has never been isolated in cell culture. Although on some occasions it was possible to experimentally induce SA-MCF in susceptible deer or cattle placed in close contact with carrier sheep over a period of several months, attempts to experimentally transmit disease to susceptible ruminants using tissues from asymptomatically infected sheep have been unsuccessful (Imai et al., 2001Down ; Plowright, 1990Down ).

Based on the genomic sequence data (Ensser et al., 1997Down ), AHV-1 belongs to the subfamily Gammaherpesvirinae within the family Herpesviridae. In contrast, very little sequence information is available for OHV-2. This includes 483 bp of open reading frame 9 (ORF9) (DNA polymerase) (Rovnak et al., 1998Down ) and 549 bp of ORF75 (tegument protein) (Bridgen & Reid, 1991Down ). Primers derived from the ORF75 sequence are currently used for PCR diagnosis of OHV-2 infection (Collins et al., 2000Down ; Crawford et al., 1999Down ; Muller-Doblies et al., 1998Down ).

Previous studies showed that OHV-2 sequences from sheep, deer, cattle and bison are closely related (Li et al., 2001Down ). However, this analysis was based on only about 6% (177 bp) of ORF9, and thus may not reflect the true relationship between herpesviruses examined in that study. In this report, we present the comparison of the entire sequence of glycoprotein B (gB, encoded by ORF8) from different sources of viral DNA, including tissues from three animals with SA-MCF and one animal (sheep) presumed to be a reservoir for the virus. Glycoprotein B is one of the most conserved herpesvirus glycoproteins (Pereira, 1994Down ). It plays a role in virus entry and spread between cells. The gB sequence has been used for estimating phylogeny between herpesviruses, and it is predictive of the more accurate phylogenetic relationships based on the analysis of several conserved genes (McGeoch et al., 1995Down ; Goltz et al., 1994Down ; Karlin et al., 1994Down ; McGeoch & Cook, 1994Down ).

The entire ORF8 sequence was amplified using primers ORF8.F(-116) (GGGCCTTTATCTAACGTATGAGA) and ORF8.R(+91) (TCACAATGCAAACACTTAYGAGTAA), where the numbers in parenthesis relate to the position of the 5' end of the primer relative to the gB sequence. These primers were designed based on the partial OHV-2 sequence from ORF6 to ORF9 which had been determined in our laboratory (unpublished data). DNA isolated from four different sources of viral DNA was used as target DNA (Table 1Down). All four DNA samples were positive for OHV-2 DNA by ORF75 PCR. This result was confirmed by Southern hybridization with a digoxigenin-labelled probe, the identity of which had been confirmed by sequencing. None of the samples was positive for bovine lymphotropic herpesvirus when tested by PCR as described by Rovnak et al. (1998)Down . Thus, it is most likely that amplified gB sequences were derived from the same herpesvirus that was also detected with ORF75 OHV-2 primers.


View this table:
[in this window]
[in a new window]
 
Table 1. Origin of samples used for DNA isolation

 
The amplification reactions were carried out in a total volume of 25 µl. Each reaction consisted of 0·3 µM of each primer, 0·2 mM of dNTP (Sigma), 1·5 units of Expand High Fidelity DNA polymerase (Roche) in 1x Expand buffer (Roche) and approximately 1 µg of genomic DNA in a total volume of 25 µl. After initial denaturation (94 °C for 2 min), 10 cycles were performed (94 °C for 10 s, 60 °C for 30 s, 72 °C for 2 min), followed by 20 cycles with the same denaturation and annealing conditions, but with 5 s added to each successive elongation cycle, and a final elongation step (72 °C for 7 min). Assembly of PCR mixtures was performed in a dedicated hood, away from the room where DNA extraction and gel electrophoresis of ORF8 PCR products were performed. All PCR runs included negative controls (water), which were consistently negative. Thus, our results are unlikely to reflect laboratory contamination. Amplification resulted in PCR products of a predicted size (~2·8 kbp), which were gel-purified and cloned into the pGEM-T (Promega) cloning vector using standard molecular biology techniques (Sambrook et al., 1989Down ). Amplification of ORF8 from ovine blood (OHV-2.Ov) did not produce enough DNA for cloning. Therefore, ORF8 from OHV-2.Ov was cloned from the combined products of three PCR reactions that were performed separately at a later time, using the amplification conditions described above, except for a 50 °C annealing temperature. Sequencing of PCR products was performed by generating semi-nested deletion clones using the Erase-a-base kit (Promega), according to the manufacturer’s instructions. Two positive clones from each sample, containing inserts in opposite directions, were used as a target DNA for semi-nested deletions. Thus, both strands of each PCR product were sequenced. The consensus sequences were assembled from overlapping fragments of DNA and translated into predicted protein sequences using the DNAstar software package. Alignments were performed using Clustal W multiple alignment software (DNAstar).

All four OHV-2 gB sequences were closely related. The divergence ranged between 0·5 and 1·2% at the deduced amino acid sequence level and between 0·7 and 0·9% at the nucleotide sequence level. This corresponded to more than 98% similarity at both amino acid and nucleotide sequence levels. By comparison, 0·1 to 7·2% divergence was reported for gB sequences of 11 macaque rhadinovirus isolates from three different macaque species (Auerbach et al., 2000Down ), and the divergence between different human herpesvirus-1 (HHV-1) gB sequences available in GenBank ranges from 0·0 to 1·9% at the amino acid sequence level. Thus, our data showing less than 2% divergence between OHV-2 gB sequences strongly suggested that the sequences were derived from the same herpesvirus. The alignment of deduced amino acid sequences of OHV-2 and AHV-1 gB is shown in Fig. 1Down. All 11 cysteine residues were conserved between all OHV-2 gB sequences, and 10 of these sites were also present in AHV-1 gB. Similarly, all nine potential N-glycosylation sites (NXS or NXT) were conserved between OHV-2 and AHV-1 gB sequences, indicating structural similarities between AHV-1 and OHV-2 gB.



View larger version (105K):
[in this window]
[in a new window]
 
Fig. 1. Clustal W alignment of deduced amino acid gB sequences. The OHV-2 sequences were determined in this study. The AHV-1 sequence was obtained from GenBank (accession numbers are given in the legend to Fig. 2Down). Conserved cysteine residues are highlighted in grey, and potential N-glycosylation sites are highlighted in black. An asterisk indicates residues that are conserved between all six sequences; an arrow indicates sites at which at least one residue was different between OHV-2 sequences.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Phylogenetic analysis of gB sequences from four OHV-2 and representative alpha-, beta- and gammaherpesviruses. The phylogeny was generated by neighbour-joining from Clustal W alignments, with alpha- and betaherpesviruses serving as an outgroup. Bootstrap values of 100 repetitions are shown at each branch point. The scale bar represents number of substitutions per site. Accession numbers of sequences not determined in this study are as follows: ateline herpesvirus-3 (herpesvirus ateles, AtHV-3), NP_047982; bovine herpesvirus-1 (BHV-1), NP_045331; BHV-2, VGBEBH; BHV-4, S25530; equine herpesvirus-1 (EHV-1), D00401; EHV-4, AF030027; EHV-5, AAC05292; human herpesvirus-4 (HHV-4) NC_001345; EHV-2, NP_042604; alcelaphine herpesvirus-1 (AHV-1), T03107; HHV-8, AAC57085; saimiriine herpesvirus-2 (herpesvirus saimiri, HVS), NP_040210; HHV-7, AAB63200; murid herpesvirus-4 (MHV-4), NP_044848; murine cytomegalovirus (MCMV), VGBEMC; rhesus monkey rhadinovirus (RHV), AAC58686.

 
Phylogenetic analysis was performed to determine the relationship between OHV-2 gB sequences and other members of the family Herpesviridae. All analyses were performed using programs from the PHYLIP package (version 3.6 alpha, http://evolution.genetics.washington.edu/phylip.html). Distance matrices were calculated from the Clustal W alignment using the PROTDIST program. Phylogenetic trees were constructed based on the neighbour-joining method using the NEIGHBOR program. Bootstrap analysis was performed using SEQBOOT (100 repetitions) and CONSENSE. The topology of the computed tree agreed with that obtained by more extensive analysis, which included multiple herpesvirus genes (McGeoch et al., 2000Down ). OHV-2 sequences were very closely related and had the shortest evolutionary distance to the AHV-1 gB sequence (Fig. 2Up). The distance between OHV-2 and AHV-1 sequences (between 24·5 and 24·6% divergence) was typical of two closely related, but distinct herpesviruses. By comparison, gB sequences of closely related equine gammaherpesviruses types 2 and 5 (EHV-2 and EHV-5) are 43·3% divergent, gB sequences of ateline herpesvirus type 3 (AtHV-3) and herpesvirus saimiri (HVS) are 15·7% divergent, different gB sequences of equine herpesviruses 1 and 4 are between 11·1 and 11·5% divergent, and different HHV-1 and -2 gB sequences are between 13·4 and 14·2% divergent (GenBank accession numbers of sequences used for these calculations are as follows: AtHV-3, NP_047982; EHV-1, D00401, M36298, M86664, NC_001491; EHV-2, NP_042604; EHV-4, AF030027, M26171, NC_001844; EHV-5, AAC05292; HHV-1, AAA19496, AAA45774, AAA45778, AAA91805, AAF70301, AAG34116, AF097023, S65444, NC_001806, HS1ULR gB, X14112; HHV-2, U12172, U12173, U12174, U12175; HVS, NP_040210).

Herpesviruses appear to co-evolve with their host and thus diverge over time. This is particularly evident for alpha- and betaherpesviruses, but less clear for members of Gammaherpesvirinae (McGeoch et al., 2000Down ). Our results suggest that the healthy sheep and SA-MCF-affected cattle and bison were infected with the same herpesvirus. Thus, the presence or absence of clinical MCF may be determined by differences between host responses to the virus, rather than differences between infecting viruses.

The association between OHV-2 infection and SA-MCF has been demonstrated based on ORF75 PCR and blocking ELISA assays (Collins et al., 2000Down ; Muller-Doblies et al., 1998Down ; Li et al., 1994Down ). Since OHV-2 has never been isolated in cell culture, and only very limited genomic data are available, it is difficult to assess specificity and sensitivity of these assays. Primers used in ORF75 PCR do not react with AHV-1 (Li et al., 1994Down ). However, they may not react with all isolates of OHV-2, and furthermore, they may be able to cross-react with viruses similar to OHV-2. Recent discoveries of sequences homologous to OHV-2 and AHV-1 DNA polymerase gene in goats and deer suggest the existence of a number of closely related viruses (Li et al., 2000Down , 2001Down ). The blocking ELISA test is based on an American cell culture isolate of AHV-1 (Li et al., 1994Down , 2001Down ). While this test does not cross-react with other common sheep or bovine herpesviruses, it does not discriminate between AHV-1, OHV-2 and newly discovered MCF-like viruses in goats and deer. Thus, the establishment of more specific diagnostic reagents is needed in order to address the aetiological association between OHV-2, or related viruses, and SA-MCF. Close similarity between the four OHV-2 gB sequences examined in this study indicates that the three animals diagnosed with SA-MCF and one clinically healthy sheep were infected with the same virus and, therefore, supports the epidemiological association between OHV-2 and SA-MCF reported by others (Collins et al., 2000Down ).

Results of recent investigations among dairy cattle and bison herds in Colorado showed that, although OHV-2 infection was positively associated with the development of MCF, not all OHV-2-positive cattle and bison develop disease (Schultheiss et al., 1998Down , 2000Down ; Collins et al., 2000Down ). This may indicate that some co-factors are needed for development of disease. Also, as discussed above, it is possible that ORF75 PCR primers react with more than one strain of similar viruses, which may differ in their ability to cause disease. All gB sequences presented in this study, except for OHV-2.Ov, originated from animals that died as a result of SA-MCF. It would be of interest to compare OHV-2 from asymptomatic cattle with OHV-2 from clinically affected cattle.

It is intriguing that OHV-2 appears to fit an emerging pattern in which a mild or subclinical infection with a herpesvirus that is lethal for other animal species provides an advantage not only to the virus, but also to its host. Examples include the killing of competing ungulates by AHV-1, the killing of humans by herpes simiae virus of apes (Brown, 1997Down ), the killing of potentially competing Asian elephants by a herpesvirus of African elephants (Richman et al., 1999Down ) or the killing of predators (Raymond et al., 1997Down ; Glass et al., 1994Down ) and ungulates that compete for resources (Thawley et al., 1980Down ) by pseudorabies virus of swine. In this context, OHV-2 is a formidable weapon. It appears to have no effect on the sheep but efficiently eliminates more powerful competitors.

In conclusion, OHV-2 gB sequences from cattle, bison and sheep were very closely related. This supports the hypothesis that sheep are the source of infectious virus for other susceptible ruminants. However, further investigations are needed to further prove or disprove this hypothesis. Current work in our laboratory focuses on determination of the entire nucleotide sequence of OHV-2. Availability of genomic data should greatly facilitate further investigations into aetiology and pathogenicity of SA-MCF.


   Acknowledgments
 
This work was funded by USDA-CSRR-CPG grant number 99-35204-7723. We thank Dr Robert Callan, Colorado State University, for supplying blood samples for the establishment of LCL cultures and Dr Donal O’Toole, University of Wyoming, for providing tissue samples from MCF cases. We also thank Professor D. McGeoch for comments on the manuscript.


   Footnotes
 
Nucleotide sequences of OHV-2 gB obtained in this study have been submitted to GenBank under accession nos AF385439, AF385440, AF385441 and AF385442.


   References
TOP
Abstract
Main text
References
 
Auerbach, M. R., Czajak, S. C., Johnson, W. E., Desrosiers, R. C. & Alexander, L. (2000). Species specificity of macaque rhadinovirus glycoprotein B sequences. Journal of Virology 74, 584-590.[Abstract/Free Full Text]

Bridgen, A. & Reid, H. W. (1991). Derivation of a DNA clone corresponding to the viral agent of sheep-associated malignant catarrhal fever. Research in Veterinary Science 50, 38-44.[Medline]

Brown, D. W. (1997). Threat to humans from virus infections of non-human primates. Reviews in Medical Virology 7, 239-246.[Medline]

Collins, J. K., Bruns, C., Vermedahl, T. L., Schiebel, A. L., Jessen, M. T., Schultheiss, P. C., Anderson, G. M., Dinsmore, R. P., Callan, R. J. & DeMartini, J. C. (2000). Malignant catarrhal fever: polymerase chain reaction survey for ovine herpesvirus 2 and other persistent herpesvirus and retrovirus infections of dairy cattle and bison. Journal of Veterinary Diagnostic Investigation 12, 406-411.[Abstract/Free Full Text]

Crawford, T. B., Li, H. & O’Toole, D. (1999). Diagnosis of malignant catarrhal fever by PCR using formalin-fixed, paraffin-embedded tissues. Journal of Veterinary Diagnostic Investigation 11, 111-116.[Abstract/Free Full Text]

Ensser, A., Pflanz, R. & Fleckenstein, B. (1997). Primary structure of the alcelaphine herpesvirus 1 genome. Journal of Virology 71, 6517-6525.[Abstract]

Glass, C. M., McLean, R. G., Katz, J. B., Maehr, D. S., Cropp, C. B., Kirk, L. J., McKeirnan, A. J. & Evermann, J. F. (1994). Isolation of pseudorabies (Aujeszky’s disease) virus from a Florida panther. Journal of Wildlife Diseases 30, 180-184.[Abstract]

Goltz, M., Broll, H., Mankertz, A., Weigelt, W., Ludwig, H., Buhk, H. J. & Borchers, K. (1994). Glycoprotein B of bovine herpesvirus type 4: its phylogenetic relationship to gB equivalents of the herpesviruses. Virus Genes 9, 53-59.[Medline]

Imai, K., Nishimori, T., Horino, R., Kawashima, K., Murata, H., Tsunemitsu, H., Saito, T., Katsuragi, K. & Yaegashi, G. (2001). Experimental transmission of sheep-associated malignant catarrhal fever from sheep to Japanese deer (Cervus nippon) and cattle. Veterinary Microbiology 79, 83-90.[Medline]

Karlin, S., Mocarski, E. S. & Schachtel, G. A. (1994). Molecular evolution of herpesviruses: genomic and protein sequence comparisons. Journal of Virology 68, 1886-1902.[Abstract/Free Full Text]

Li, H., Shen, D. T., Knowles, D. P., Gorham, J. R. & Crawford, T. B. (1994). Competitive inhibition enzyme-linked immunosorbent assay for antibody in sheep and other ruminants to a conserved epitope of malignant catarrhal fever virus. Journal of Clinical Microbiology 32, 1674-1679.[Abstract/Free Full Text]

Li, H., Snowder, G., O’Toole, D. & Crawford, T. B. (1998). Transmission of ovine herpesvirus 2 in lambs. Journal of Clinical Microbiology 36, 223-226.[Abstract/Free Full Text]

Li, H., Dyer, N., Keller, J. & Crawford, T. B. (2000). Newly recognized herpesvirus causing malignant catarrhal fever in white-tailed deer (Odocoileus virginianus). Journal of Clinical Microbiology 38, 1313-1318.[Abstract/Free Full Text]

Li, H., Keller, J., Knowles, D. P. & Crawford, T. B. (2001). Recognition of another member of the malignant catarrhal fever virus group: an endemic gammaherpesvirus in domestic goats. Journal of General Virology 82, 227-232.[Abstract/Free Full Text]

McGeoch, D. J. & Cook, S. (1994). Molecular phylogeny of the alphaherpesvirinae subfamily and a proposed evolutionary timescale. Journal of Molecular Biology 238, 9-22.[Medline]

McGeoch, D. J., Cook, S., Dolan, A., Jamieson, F. E. & Telford, E. A. (1995). Molecular phylogeny and evolutionary timescale for the family of mammalian herpesviruses. Journal of Molecular Biology 247, 443-458.[Medline]

McGeoch, D. J., Dolan, A. & Ralph, A. C. (2000). Toward a comprehensive phylogeny for mammalian and avian herpesviruses. Journal of Virology 74, 10401-10406.[Abstract/Free Full Text]

Muller-Doblies, U. U., Li, H., Hauser, B., Adler, H. & Ackermann, M. (1998). Field validation of laboratory tests for clinical diagnosis of sheep-associated malignant catarrhal fever. Journal of Clinical Microbiology 36, 2970-2972.[Abstract/Free Full Text]

Pereira, L. (1994). Function of glycoprotein B homologues of the family herpesviridae. Infectious Agents and Disease 3, 9-28.[Medline]

Plowright, W. (1990). Malignant catarrhal fever virus. In Virus Infections of Ruminants , pp. 123-150. Edited by Z. Dinter & B. Morein. Amsterdam:Elsevier.

Raymond, J. T., Gillespie, R. G., Woodruff, M. & Janovitz, E. B. (1997). Pseudorabies in captive coyotes. Journal of Wildlife Diseases 33, 916-918.[Abstract]

Richman, L. K., Montali, R. J., Garber, R. L., Kennedy, M. A., Lehnhardt, J., Hildebrandt, T., Schmitt, D., Hardy, D., Alcendor, D. J. & Hayward, G. S. (1999). Novel endotheliotropic herpesviruses fatal for Asian and African elephants. Science 283, 1171-1176.[Abstract/Free Full Text]

Rovnak, J., Quackenbush, S. L., Reyes, R. A., Baines, J. D., Parrish, C. R. & Casey, J. W. (1998). Detection of a novel bovine lymphotropic herpesvirus. Journal of Virology 72, 4237-4242.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schultheiss, P. C., Collins, J. K., Austgen, L. E. & DeMartini, J. C. (1998). Malignant catarrhal fever in bison, acute and chronic cases. Journal of Veterinary Diagnostic Investigation 10, 255-262.[Abstract/Free Full Text]

Schultheiss, P. C., Collins, J. K., Spraker, T. R. & DeMartini, J. C. (2000). Epizootic malignant catarrhal fever in three bison herds: differences from cattle and association with ovine herpesvirus-2. Journal of Veterinary Diagnostic Investigation 12, 497-502.[Abstract/Free Full Text]

Thawley, D. G., Wright, J. C. & Solorzano, R. F. (1980). Epidemiologic monitoring following an episode of pseudorabies involving swine, sheep, and cattle. Journal of the American Veterinary Medical Association 176, 1001-1003.[Medline]

Received 11 June 2001; accepted 9 August 2001.


This article has been cited by other articles:


Home page
J Wildl DisHome page
V. Benetka, R. Krametter-Froetscher, W. Baumgartner, and K. Moestl
Investigation of the Role of Austrian Ruminant Wildlife in the Epidemiology of Malignant Catarrhal Fever Viruses
J. Wildl. Dis., April 1, 2009; 45(2): 508 - 511.
[Abstract] [Full Text] [PDF]


Home page
J Wildl DisHome page
M. E. Pinkerton, J. F. X. Wellehan Jr., A. J. Johnson, A. L. Childress, S. D. Fitzgerald, and M. J. Kinsel
COLUMBID HERPESVIRUS-1 IN TWO COOPER'S HAWKS (ACCIPITER COOPERII) WITH FATAL INCLUSION BODY DISEASE
J. Wildl. Dis., July 1, 2008; 44(3): 622 - 628.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. S. Taus, D. R. Herndon, D. L. Traul, J. P. Stewart, M. Ackermann, H. Li, D. P. Knowles, G. S. Lewis, and K. A. Brayton
Comparison of ovine herpesvirus 2 genomes isolated from domestic sheep (Ovis aries) and a clinically affected cow (Bos bovis)
J. Gen. Virol., January 1, 2007; 88(1): 40 - 45.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dunowska, M.
Right arrow Articles by DeMartini, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dunowska, M.
Right arrow Articles by DeMartini, J. C.
Agricola
Right arrow Articles by Dunowska, M.
Right arrow Articles by DeMartini, J. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS