|
|
||||||||
Animal: DNA Viruses |
Department of Pathology, Colorado State University, Fort Collins, CO 80523, USA1
USDA, ARS, Arthropod-borne Animal Diseases Research Laboratory, Laramie, WY 82071-3965, USA2
Department of Veterinary Science and Microbiology, University of Arizona, Tucson, AZ 85721-0090, USA3
Author for correspondence: Magdalena Dunowska. Fax +1 970 491 0603. e-mail mdunowsk{at}lamar.colostate.edu
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
Based on the genomic sequence data (Ensser et al., 1997
), AHV-1 belongs to the subfamily Gammaherpesvirinae within the family Herpesviridae. In contrast, very little sequence information is available for OHV-2. This includes 483 bp of open reading frame 9 (ORF9) (DNA polymerase) (Rovnak et al., 1998
) and 549 bp of ORF75 (tegument protein) (Bridgen & Reid, 1991
). Primers derived from the ORF75 sequence are currently used for PCR diagnosis of OHV-2 infection (Collins et al., 2000
; Crawford et al., 1999
; Muller-Doblies et al., 1998
).
Previous studies showed that OHV-2 sequences from sheep, deer, cattle and bison are closely related (Li et al., 2001
). However, this analysis was based on only about 6% (177 bp) of ORF9, and thus may not reflect the true relationship between herpesviruses examined in that study. In this report, we present the comparison of the entire sequence of glycoprotein B (gB, encoded by ORF8) from different sources of viral DNA, including tissues from three animals with SA-MCF and one animal (sheep) presumed to be a reservoir for the virus. Glycoprotein B is one of the most conserved herpesvirus glycoproteins (Pereira, 1994
). It plays a role in virus entry and spread between cells. The gB sequence has been used for estimating phylogeny between herpesviruses, and it is predictive of the more accurate phylogenetic relationships based on the analysis of several conserved genes (McGeoch et al., 1995
; Goltz et al., 1994
; Karlin et al., 1994
; McGeoch & Cook, 1994
).
The entire ORF8 sequence was amplified using primers ORF8.F(-116) (GGGCCTTTATCTAACGTATGAGA) and ORF8.R(+91) (TCACAATGCAAACACTTAYGAGTAA), where the numbers in parenthesis relate to the position of the 5' end of the primer relative to the gB sequence. These primers were designed based on the partial OHV-2 sequence from ORF6 to ORF9 which had been determined in our laboratory (unpublished data). DNA isolated from four different sources of viral DNA was used as target DNA (Table 1
). All four DNA samples were positive for OHV-2 DNA by ORF75 PCR. This result was confirmed by Southern hybridization with a digoxigenin-labelled probe, the identity of which had been confirmed by sequencing. None of the samples was positive for bovine lymphotropic herpesvirus when tested by PCR as described by Rovnak et al. (1998)
. Thus, it is most likely that amplified gB sequences were derived from the same herpesvirus that was also detected with ORF75 OHV-2 primers.
|
2·8 kbp), which were gel-purified and cloned into the pGEM-T (Promega) cloning vector using standard molecular biology techniques (Sambrook et al., 1989
All four OHV-2 gB sequences were closely related. The divergence ranged between 0·5 and 1·2% at the deduced amino acid sequence level and between 0·7 and 0·9% at the nucleotide sequence level. This corresponded to more than 98% similarity at both amino acid and nucleotide sequence levels. By comparison, 0·1 to 7·2% divergence was reported for gB sequences of 11 macaque rhadinovirus isolates from three different macaque species (Auerbach et al., 2000
), and the divergence between different human herpesvirus-1 (HHV-1) gB sequences available in GenBank ranges from 0·0 to 1·9% at the amino acid sequence level. Thus, our data showing less than 2% divergence between OHV-2 gB sequences strongly suggested that the sequences were derived from the same herpesvirus. The alignment of deduced amino acid sequences of OHV-2 and AHV-1 gB is shown in Fig. 1
. All 11 cysteine residues were conserved between all OHV-2 gB sequences, and 10 of these sites were also present in AHV-1 gB. Similarly, all nine potential N-glycosylation sites (NXS or NXT) were conserved between OHV-2 and AHV-1 gB sequences, indicating structural similarities between AHV-1 and OHV-2 gB.
|
|
Herpesviruses appear to co-evolve with their host and thus diverge over time. This is particularly evident for alpha- and betaherpesviruses, but less clear for members of Gammaherpesvirinae (McGeoch et al., 2000
). Our results suggest that the healthy sheep and SA-MCF-affected cattle and bison were infected with the same herpesvirus. Thus, the presence or absence of clinical MCF may be determined by differences between host responses to the virus, rather than differences between infecting viruses.
The association between OHV-2 infection and SA-MCF has been demonstrated based on ORF75 PCR and blocking ELISA assays (Collins et al., 2000
; Muller-Doblies et al., 1998
; Li et al., 1994
). Since OHV-2 has never been isolated in cell culture, and only very limited genomic data are available, it is difficult to assess specificity and sensitivity of these assays. Primers used in ORF75 PCR do not react with AHV-1 (Li et al., 1994
). However, they may not react with all isolates of OHV-2, and furthermore, they may be able to cross-react with viruses similar to OHV-2. Recent discoveries of sequences homologous to OHV-2 and AHV-1 DNA polymerase gene in goats and deer suggest the existence of a number of closely related viruses (Li et al., 2000
, 2001
). The blocking ELISA test is based on an American cell culture isolate of AHV-1 (Li et al., 1994
, 2001
). While this test does not cross-react with other common sheep or bovine herpesviruses, it does not discriminate between AHV-1, OHV-2 and newly discovered MCF-like viruses in goats and deer. Thus, the establishment of more specific diagnostic reagents is needed in order to address the aetiological association between OHV-2, or related viruses, and SA-MCF. Close similarity between the four OHV-2 gB sequences examined in this study indicates that the three animals diagnosed with SA-MCF and one clinically healthy sheep were infected with the same virus and, therefore, supports the epidemiological association between OHV-2 and SA-MCF reported by others (Collins et al., 2000
).
Results of recent investigations among dairy cattle and bison herds in Colorado showed that, although OHV-2 infection was positively associated with the development of MCF, not all OHV-2-positive cattle and bison develop disease (Schultheiss et al., 1998
, 2000
; Collins et al., 2000
). This may indicate that some co-factors are needed for development of disease. Also, as discussed above, it is possible that ORF75 PCR primers react with more than one strain of similar viruses, which may differ in their ability to cause disease. All gB sequences presented in this study, except for OHV-2.Ov, originated from animals that died as a result of SA-MCF. It would be of interest to compare OHV-2 from asymptomatic cattle with OHV-2 from clinically affected cattle.
It is intriguing that OHV-2 appears to fit an emerging pattern in which a mild or subclinical infection with a herpesvirus that is lethal for other animal species provides an advantage not only to the virus, but also to its host. Examples include the killing of competing ungulates by AHV-1, the killing of humans by herpes simiae virus of apes (Brown, 1997
), the killing of potentially competing Asian elephants by a herpesvirus of African elephants (Richman et al., 1999
) or the killing of predators (Raymond et al., 1997
; Glass et al., 1994
) and ungulates that compete for resources (Thawley et al., 1980
) by pseudorabies virus of swine. In this context, OHV-2 is a formidable weapon. It appears to have no effect on the sheep but efficiently eliminates more powerful competitors.
In conclusion, OHV-2 gB sequences from cattle, bison and sheep were very closely related. This supports the hypothesis that sheep are the source of infectious virus for other susceptible ruminants. However, further investigations are needed to further prove or disprove this hypothesis. Current work in our laboratory focuses on determination of the entire nucleotide sequence of OHV-2. Availability of genomic data should greatly facilitate further investigations into aetiology and pathogenicity of SA-MCF.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bridgen, A. & Reid, H. W. (1991). Derivation of a DNA clone corresponding to the viral agent of sheep-associated malignant catarrhal fever. Research in Veterinary Science 50, 38-44.[Medline]
Brown, D. W. (1997). Threat to humans from virus infections of non-human primates. Reviews in Medical Virology 7, 239-246.[Medline]
Collins, J. K., Bruns, C., Vermedahl, T. L., Schiebel, A. L., Jessen, M. T., Schultheiss, P. C., Anderson, G. M., Dinsmore, R. P., Callan, R. J. & DeMartini, J. C. (2000). Malignant catarrhal fever: polymerase chain reaction survey for ovine herpesvirus 2 and other persistent herpesvirus and retrovirus infections of dairy cattle and bison. Journal of Veterinary Diagnostic Investigation 12, 406-411.
Crawford, T. B., Li, H. & OToole, D. (1999). Diagnosis of malignant catarrhal fever by PCR using formalin-fixed, paraffin-embedded tissues. Journal of Veterinary Diagnostic Investigation 11, 111-116.
Ensser, A., Pflanz, R. & Fleckenstein, B. (1997). Primary structure of the alcelaphine herpesvirus 1 genome. Journal of Virology 71, 6517-6525.[Abstract]
Glass, C. M., McLean, R. G., Katz, J. B., Maehr, D. S., Cropp, C. B., Kirk, L. J., McKeirnan, A. J. & Evermann, J. F. (1994). Isolation of pseudorabies (Aujeszkys disease) virus from a Florida panther. Journal of Wildlife Diseases 30, 180-184.[Abstract]
Goltz, M., Broll, H., Mankertz, A., Weigelt, W., Ludwig, H., Buhk, H. J. & Borchers, K. (1994). Glycoprotein B of bovine herpesvirus type 4: its phylogenetic relationship to gB equivalents of the herpesviruses. Virus Genes 9, 53-59.[Medline]
Imai, K., Nishimori, T., Horino, R., Kawashima, K., Murata, H., Tsunemitsu, H., Saito, T., Katsuragi, K. & Yaegashi, G. (2001). Experimental transmission of sheep-associated malignant catarrhal fever from sheep to Japanese deer (Cervus nippon) and cattle. Veterinary Microbiology 79, 83-90.[Medline]
Karlin, S., Mocarski, E. S. & Schachtel, G. A. (1994). Molecular evolution of herpesviruses: genomic and protein sequence comparisons. Journal of Virology 68, 1886-1902.
Li, H., Shen, D. T., Knowles, D. P., Gorham, J. R. & Crawford, T. B. (1994). Competitive inhibition enzyme-linked immunosorbent assay for antibody in sheep and other ruminants to a conserved epitope of malignant catarrhal fever virus. Journal of Clinical Microbiology 32, 1674-1679.
Li, H., Snowder, G., OToole, D. & Crawford, T. B. (1998). Transmission of ovine herpesvirus 2 in lambs. Journal of Clinical Microbiology 36, 223-226.
Li, H., Dyer, N., Keller, J. & Crawford, T. B. (2000). Newly recognized herpesvirus causing malignant catarrhal fever in white-tailed deer (Odocoileus virginianus). Journal of Clinical Microbiology 38, 1313-1318.
Li, H., Keller, J., Knowles, D. P. & Crawford, T. B. (2001). Recognition of another member of the malignant catarrhal fever virus group: an endemic gammaherpesvirus in domestic goats. Journal of General Virology 82, 227-232.
McGeoch, D. J. & Cook, S. (1994). Molecular phylogeny of the alphaherpesvirinae subfamily and a proposed evolutionary timescale. Journal of Molecular Biology 238, 9-22.[Medline]
McGeoch, D. J., Cook, S., Dolan, A., Jamieson, F. E. & Telford, E. A. (1995). Molecular phylogeny and evolutionary timescale for the family of mammalian herpesviruses. Journal of Molecular Biology 247, 443-458.[Medline]
McGeoch, D. J., Dolan, A. & Ralph, A. C. (2000). Toward a comprehensive phylogeny for mammalian and avian herpesviruses. Journal of Virology 74, 10401-10406.
Muller-Doblies, U. U., Li, H., Hauser, B., Adler, H. & Ackermann, M. (1998). Field validation of laboratory tests for clinical diagnosis of sheep-associated malignant catarrhal fever. Journal of Clinical Microbiology 36, 2970-2972.
Pereira, L. (1994). Function of glycoprotein B homologues of the family herpesviridae. Infectious Agents and Disease 3, 9-28.[Medline]
Plowright, W. (1990). Malignant catarrhal fever virus. In Virus Infections of Ruminants , pp. 123-150. Edited by Z. Dinter & B. Morein. Amsterdam:Elsevier.
Raymond, J. T., Gillespie, R. G., Woodruff, M. & Janovitz, E. B. (1997). Pseudorabies in captive coyotes. Journal of Wildlife Diseases 33, 916-918.[Abstract]
Richman, L. K., Montali, R. J., Garber, R. L., Kennedy, M. A., Lehnhardt, J., Hildebrandt, T., Schmitt, D., Hardy, D., Alcendor, D. J. & Hayward, G. S. (1999). Novel endotheliotropic herpesviruses fatal for Asian and African elephants. Science 283, 1171-1176.
Rovnak, J., Quackenbush, S. L., Reyes, R. A., Baines, J. D., Parrish, C. R. & Casey, J. W. (1998). Detection of a novel bovine lymphotropic herpesvirus. Journal of Virology 72, 4237-4242.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schultheiss, P. C., Collins, J. K., Austgen, L. E. & DeMartini, J. C. (1998). Malignant catarrhal fever in bison, acute and chronic cases. Journal of Veterinary Diagnostic Investigation 10, 255-262.
Schultheiss, P. C., Collins, J. K., Spraker, T. R. & DeMartini, J. C. (2000). Epizootic malignant catarrhal fever in three bison herds: differences from cattle and association with ovine herpesvirus-2. Journal of Veterinary Diagnostic Investigation 12, 497-502.
Thawley, D. G., Wright, J. C. & Solorzano, R. F. (1980). Epidemiologic monitoring following an episode of pseudorabies involving swine, sheep, and cattle. Journal of the American Veterinary Medical Association 176, 1001-1003.[Medline]
Received 11 June 2001;
accepted 9 August 2001.
This article has been cited by other articles:
![]() |
V. Benetka, R. Krametter-Froetscher, W. Baumgartner, and K. Moestl Investigation of the Role of Austrian Ruminant Wildlife in the Epidemiology of Malignant Catarrhal Fever Viruses J. Wildl. Dis., April 1, 2009; 45(2): 508 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Pinkerton, J. F. X. Wellehan Jr., A. J. Johnson, A. L. Childress, S. D. Fitzgerald, and M. J. Kinsel COLUMBID HERPESVIRUS-1 IN TWO COOPER'S HAWKS (ACCIPITER COOPERII) WITH FATAL INCLUSION BODY DISEASE J. Wildl. Dis., July 1, 2008; 44(3): 622 - 628. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Taus, D. R. Herndon, D. L. Traul, J. P. Stewart, M. Ackermann, H. Li, D. P. Knowles, G. S. Lewis, and K. A. Brayton Comparison of ovine herpesvirus 2 genomes isolated from domestic sheep (Ovis aries) and a clinically affected cow (Bos bovis) J. Gen. Virol., January 1, 2007; 88(1): 40 - 45. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |