J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acharya, A.
Right arrow Articles by Gopinathan, K. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acharya, A.
Right arrow Articles by Gopinathan, K. P.
Agricola
Right arrow Articles by Acharya, A.
Right arrow Articles by Gopinathan, K. P.
Journal of General Virology (2001), 82, 2811-2819.
© 2001 Society for General Microbiology


Insect

Identification of an enhancer-like element in the polyhedrin gene upstream region of Bombyx mori nucleopolyhedrovirus

Asha Acharya1 and Karumathil P. Gopinathan1

Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India1

Author for correspondence: Karumathil Gopinathan. Fax +91 80 360 2697. e-mail kpg{at}mcbl.iisc.ernet.in


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
A series of deletions in the upstream region of the gene encoding polyhedrin (polh) of Bombyx mori nucleopolyhedrovirus (BmNPV) were generated in plasmid constructs and tested for transcription. In transient transfection assays in Bombyx mori-derived BmN cells with firefly luciferase as the reporter gene, a 293 bp fragment located 1·0 kb upstream with respect to the +1 ATG of polh showed 10-fold enhancement in expression from the minimal promoter. This increase in reporter activity was observed only when the fragment was positioned in cis with respect to the promoter and not in trans. The stimulation of reporter gene expression was independent of the orientation of the fragment and was due to increased transcription from the promoter. When placed upstream of another promoter, the viral very late gene p10 promoter, the enhancer brought about a 2-fold increase in expression. The region encompassing the enhancer was itself transcriptionally active, and transcripts corresponding to both of the encoded ORFs (N-terminal regions of ORF453 and ORF327, located in opposite orientations) were detected. Two AP1 sites (TGACTCG) in the 293 bp fragment did not appear to contribute to the enhancer function. Since repeat motifs, the hallmark of conventional enhancer sequences, were absent from this fragment, it is designated as an enhancer-like element. The influence of this region of the polh upstream sequence on expression from strong, very late viral promoters has not been reported previously.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The baculoviruses comprise a large family of occluded DNA viruses with covalently closed, circular, double-stranded genomes that primarily infect the holometabolous insects (Blissard & Rohrmann, 1990Down ; Hayakawa et al., 2000Down ). Among these, Autographa californica multinucleocapsid nucleopolyhedro virus (AcMNPV), a virus of the alfalfa looper, is by far the best studied at the molecular level and hence serves as the prototype baculovirus. Parallel investigations of several other baculoviruses, such as Bombyx mori nucleopolyhedrovirus (BmNPV), Lymantria dispar MNPV (LdMNPV) and Orgyia pseudotsugata MNPV (OpMNPV), have been carried out and their full genomic sequences have been reported (Ayres et al., 1994Down ; Gomi et al., 1999Down ; Kuzio et al., 1999Down ; Ahrens et al., 1997Down ). A distinctive feature of the baculovirus life cycle is the synthesis of two forms of infectious particles, which is temporally regulated via a cascade of gene expression pathways (Keddie et al., 1989Down ). The budded or extracellular virus is released from the cell between 8 and 12 h post-infection (p.i.) and requires viral DNA replication and synthesis of structural proteins. As the infection proceeds into the very late phase (20–72 h p.i.), the virions are occluded into large polyhedral bodies inside the nucleus. A 29 kDa polypeptide known as polyhedrin constitutes the major component of these occlusion bodies. Polyhedrin, despite being non-essential for virus propagation in vitro, is produced abundantly at late times. Other very late, non-essential genes like p10 are also expressed to very high levels. The occluded virion can survive adverse environmental conditions and has evolved to mediate horizontal transmission of the pathogen. The replacement of the gene encoding polyhedrin (polh) with a foreign gene of interest to generate recombinant viruses has formed the basis of the baculovirus-based overexpression systems. The analysis of regulation of expression from this promoter is therefore significant.

An interesting feature of the late and very late viral promoters is that transcription from these promoters is carried out by an RNA polymerase distinct from the host-cell polymerases, made up entirely of four virus-encoded subunits, LEF8, LEF9, LEF4 and p47 (Guarino et al., 1998Down ). The AcMNPV polh promoter has been studied extensively by using both deletion (Possee & Howard, 1987Down ) and linker-scan (Rankin et al., 1988Down ; Ooi et al., 1989Down ) mutational analysis. These studies identified a conserved TAAG core sequence that serves both as an integral promoter element and as the transcription start point. Besides the core sequence, linker-scan studies also demonstrated that the region between the core sequence and the translational initiation site greatly affects the steady-state level of polh transcript (Ooi et al., 1989Down ). However, in addition to these proximal promoter elements, polh transcription is also influenced by distal enhancer elements in AcMNPV. Interspersed throughout the length of the baculovirus genome are homologous repeat (hr) sequences that are composed of several (two to eight) ~30 bp imperfect palindromic sequences. Transient in vitro plasmid-based replication assays have shown that the hr sequences function as origins of viral DNA replication (Pearson et al., 1992Down ; Leisy & Rohrmann, 1993Down ). The hr sequences have also been shown to act as enhancers. For instance, the AcMNPV hr5 functions as a transcriptional enhancer of the delayed-early gene 39K (Guarino & Summers, 1986Down ) and the transactivator protein IE-1 is a component of the DNA–protein complexes in this hr5-mediated enhancer function (Guarino & Dong, 1994Down ). The AcMNPV hr1 enhances reporter expression from the polh promoter (Habib et al., 1996Down ). Likewise, the BmNPV hr3 acts as an enhancer for the B. mori cytoplasmic actin gene promoter in vitro, augmenting reporter expression in transfected cells by two orders of magnitude (Lu et al., 1997Down ). This was stimulated further more than 1000-fold on supplementation of transfected cells with the BmNPV transactivator protein IE-1.

In an attempt to characterize further the polh promoter of BmNPV, we have analysed the far-upstream region, beyond the core sequence element. A comparison of this region between the genomes of AcMNPV (Ayres et al., 1994Down ) and BmNPV (Gomi et al., 1999Down ) revealed an overall conservation of sequences as well as some marked differences. Starting with a reporter plasmid construct containing as much as 2·3 kb of the upstream region of the polh promoter, a series of deletions were generated. Using the minimal polh promoter construct harbouring the core sequence TAAG as the reference plasmid, our studies identified a 293 bp fragment located approximately 1·0 kb upstream of the promoter that enhanced transcription from the minimal polh promoter over 10-fold in a position- and orientation-independent fashion. This region, however, encoded the N-terminal segments of ORF453 and ORF327, located in opposite orientations, and both were actively transcribed.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Generation of plasmid constructs.
The recombinant plasmids generated in the study are presented in Fig. 1Down. A 2·3 kb XhoI–EcoRI fragment corresponding to the BmNPV genomic sequences of the polh upstream region was mobilized from the plasmid pBm030 (Maeda, 1989Down ) into pBS KS+. The reporter gene, firefly luciferase (luc; a 1·8 kb DNA fragment containing an 80 bp untranslated leader sequence as well as a polyadenylation signal at the 3' end) was cloned downstream of the promoter as a BamHI fragment to generate the construct pBmpolh. A minimal promoter construct, pBmMinpolh, containing 192 bp of the polh immediate 5' upstream sequences and encompassing the consensus core promoter motif TAAG, was made by subcloning the PCR-amplified SalI–EcoRI fragment of pBm030 in pBS KS+ and inserting luc downstream of the promoter. From the parental construct, pBmpolh, deletion of a 1·6 kb SalI fragment followed by self-ligation generated pBmpolh{Delta}S, while deletion of a 665 bp MluI fragment gave rise to the construct pBmpolh{Delta}M. A 1·2 kb SalI fragment and the 665 bp MluI fragment were mobilized separately into the SalI site in pBmMinpolh to generate pBmMinpolhS and pBmMinpolhM, respectively. The MluI fragment was cloned in both orientations with respect to the polh promoter (after blunt-ending both the vector and the insert with Klenow DNA polymerase) to provide pBmMinpolhM+/-.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1. Plasmid constructs generated in the study. The plasmid constructs generated that harbour different lengths of the BmNPV polh 5' upstream region are shown schematically. The reporter luciferase gene (luc), containing an 80 bp leader sequence at the 5' end and the polyadenylation signals at the 3' end, was placed immediately downstream of the polh promoter (cloning site at -3 nt with respect to +1 ATG of polyhedrin and 50 nt downstream of the TAAG transcription start site motif). Plasmid construction was carried out essentially as described in Sambrook et al. (1989)Down . For details of the individual plasmid constructs, see Methods. The 3' and 5' ends of the different constructs shown extend into the vector pBS KS+ sequences. The symbols + and - indicate the presence of the insert in one or other orientation, while * indicates the primer site used in generation of the PCR subclones of the 293 bp RsaI–MluI fragment. The 101 bp (R–*) fragment harboured two AP1 sites and the 198 bp (*–M) fragment harboured one AP1 site. Restriction sites indicated are: E, EcoRI; M, MluI; R, R' and R', RsaI; S, SalI; and X, XhoI.

 
Subclones of the 665 bp MluI fragment were made by partial digestion of this fragment with RsaI and cloning the digested fragments at the SalI site of pBmMinpolh after blunt-ending with Klenow DNA polymerase. The full fragment was represented in four subclones generated in this way, pBmMinpolhR92-, pBmMinpolhR9+, pBmMinpolhR3+ and pBmMinpolhR3-. pBmMinpolhR92- contained 188 and 114 bp fragments in inverse orientations while pBmMinpolhR9+ had only the 188 bp fragment in the proper orientation. Plasmids pBmMinpolhR3+ and pBmMinpolhR3- contained the 293 bp RsaI–MluI fragment cloned in both orientations. This fragment was split further into two fragments of 101 bp and 198 bp by PCR amplification (using primers P1a, 5' GCGTCGACGCTTGACTCGGG 3', and P1b, 5' GCGTCGACGTACATCCTCGTTT 3', for the 101 bp fragment and P2a, 5' GCGTCGACGCGTGCACATATC 3', and P2b, 5' GCGTCGACCCGAGTCAAGCGCAG 3', for the 198 bp fragment) and subcloned individually in pBmMinpolh to generate pBmMinpolhRP1 and pBmMinpolhRP2, respectively. In order to analyse the influence of the MluI fragment on transcription from other promoters, it was mobilized upstream of the AcMNPV p10 promoter in the plasmid construct pUW1 (Sriram et al., 1997Down ), generating pUW1M. Yet another plasmid construct, pTZSt, harbouring the 1·2 kb SalI fragment (encompassing ORF453, ORF327 and the N-terminal half of LEF-2) in pTZ18R, was generated in order to analyse its effect on expression from the polh promoter in trans (this construct is not shown in Fig. 1Up).

{blacksquare} Cell culture and transfections.
The B. mori-derived cell line BmN was maintained at 27 °C in TC-100 medium supplemented with 10% foetal bovine serum (Gibco BRL). Transfections with various plasmid DNA constructs were carried out in 6-well microtitre plates (106 cells per well in 2 ml medium). The cells were infected with wild-type BmNPV at an m.o.i. of 10 for all the transient transfections (Palhan et al., 1995Down ). The virus stocks were maintained and titres were determined according to standard protocols (O’Reilly et al., 1992Down ). The cells were transfected with plasmid constructs (2·5 µg covalently closed, circular DNA) using lipofectin (Gibco BRL) in serum-free medium for 8 h, followed by virus infection at an m.o.i. of 10 (Palhan et al., 1995Down ). The cells were incubated at 27 °C for 48 h, harvested and washed with PBS (10 mM KH2PO4, 2 mM Na2HPO4, 140 mM NaCl and 25 mM KCl). Luciferase activity in the cells was quantified (non-invasive assay) by using a luminometer (Palhan et al., 1995Down ; Sriram et al., 1997Down ).

{blacksquare} RNA isolation and slot-blot hybridization.
Total RNA was isolated from transfected cells by the guanidinium isothiocyanate method (Chomczynski & Sacchi, 1987Down ) and treated with RNase-free DNase. RNA slot-blot analysis was carried out with 5 µg total RNA in 50% formamide, 6% formaldehyde and 1x SSC (0·15 M NaCl and 0·1 M sodium citrate, pH 7·4), blotted on to a nylon membrane (Amersham) and probed using radiolabelled luc and tRNA probes. Hybridization was carried out at 42 °C in the presence of 50% formamide and the blots were washed at a final stringency of 0·1x SSC and 0·1% SDS at 65 °C for 30 min.

{blacksquare} RNase protection assays.
The transcription status of ORF453 and ORF327 was analysed by an RNase protection assay using corresponding antisense RNA probes. For ORF453, the plasmid pBmMinpolhR3+, encompassing the N-terminal region of the gene, was linearized by digestion with MluI and transcribed in vitro using T3 RNA polymerase in the presence of radiolabelled [{alpha}-32P]UTP. The 32P-labelled probe for ORF327 was generated similarly from plasmid pBmMinpolhR3-. The antisense riboprobes (1·5x105 c.p.m.) were co-precipitated with 20 µg total RNA, isolated from both uninfected and infected cells at various times p.i. in the presence of 200 mM NaCl and 20 µg carrier RNA using 2·5 vols ethanol. Following hybridization at 50 °C overnight in the presence of 50% formamide, an RNase digestion mixture containing RNase A (2 U) and RNase T1 (1 U) was added and the samples were precipitated in the presence of 10 µg yeast tRNA and 2·5 vols ethanol. The RNase-protected samples were analysed by electrophoresis on 8 M urea–6% acrylamide gels and visualized by autoradiography.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Analysis of the 5' flanking region of polh
We have analysed the effect of the 5' upstream region of polh on transcription from the polh promoter. The AcMNPV and BmNPV promoters function equally well in the host cells Sf21 and BmN on infection with AcMNPV and BmNPV, respectively (Palhan et al., 1995Down ; Sriram et al., 1997Down ). A comparison of the genomic regions up to 2·3 kb upstream of the polh promoter of AcMNPV and BmNPV is presented in Fig. 2Down. This region encompasses AcMNPV ORFs 4–7, of which Ac4, Ac5 and Ac6 show greater than 92% identity to BmNPV counterparts at the amino acid level. Ac6, commonly referred to as lef-2 (late gene expression factor-2), is essential for both viral DNA replication and late gene expression in AcMNPV, BmNPV and OpMNPV (Merrington et al., 1996Down ; Sriram & Gopinathan, 1998Down ; Ahrens & Rohrmann, 1995Down ; Sriram, 1998Down ). The functions of ORF453 (Ac4) and ORF327 (Ac5) remain unidentified in all the baculoviruses characterized so far. The major differences were in ORF603 (Ac7) and the bro-e gene of BmNPV (Fig. 2Down). ORF603, located immediately upstream of the polh promoter in AcMNPV, is absent from the BmNPV genome (Gomi et al., 1999Down ). This ORF is a non-essential gene in AcMNPV, since its disruption had no effect on virus infectivity or polyhedron production (Gearing & Possee, 1990Down ). The gene designated bro-e, present at about 2·0 kb upstream in BmNPV, is absent in AcMNPV and belongs to the highly repeated baculovirus-repeated ORF (bro) gene family (Kang et al., 1999Down ). There are five copies of bro (bro ae) in BmNPV, whereas AcMNPV encodes only a single copy (Ac2, a homologue of BmNPV bro-d) that is located elsewhere in its genome. The encoded products of bro genes have been shown to bind nucleic acids and are involved in nucleosome organization (Zemskov et al., 2000Down ). The presence of bro-e in the upstream region of polh of BmNPV compensates for the absence of ORF603 to locate hr1, which has an enhancer function (see the following section), at the same position with respect to the polh +1 ATG in both the viruses.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of the polh upstream regions of AcMNPV and BmNPV. The 2·3 kb polh upstream regions (98·2–100 map units) of BmNPV (a) and AcMNPV (b) are aligned. Major ORFs are represented as boxes at appropriate positions and their orientations are indicated by arrows. The locations of restriction sites and the polh +1 ATG are indicated. ORF453, ORF327, lef-2 and ORF603 correspond to AcMNPV ORFs 4, 5, 6 and 7, respectively. The overlap between ORF327 and lef-2 is indicated as a shaded region. The bro-e sequence at this location is exclusive to BmNPV, whereas ORF603 (Ac7) is absent in BmNPV.

 
A 293 bp fragment from the polh upstream region enhances expression
In order to achieve the high levels of expression observed from the AcMNPV promoter, the virus hr1 sequences located about 4 kb upstream of the polh+1 ATG site have been shown to function as an enhancer (Habib et al., 1996Down ). The BmNPV polh upstream region also harbours a similar hr sequence at the same distance (4·2 kb). In order to study the effect of cis elements other than the hr sequence from the polh upstream region, we generated a series of plasmid constructs harbouring luc as the reporter placed under the polh promoter covering different regions of the 5' upstream sequence, up to 2·3 kb (Fig. 1Up). The parental plasmid construct pBmpolh, harbouring the entire 2·3 kb 5' sequence of the BmNPV T3 strain (nt 126087–128413 on the BmNPV genome, GenBank accession no. L33180), was derived from the transfer vector pBm030 (Maeda, 1989Down ). The minimal polh promoter plasmid (pBmMinpolh), containing up to 192 nt upstream of the polh ATG, was used as the reference to study the influence of other regulatory elements. Reporter gene (luc) expression was 25-fold higher compared with the minimal promoter construct (Fig. 3Down) when the additional 2·1 kb was added (plasmid pBmpolh). Deletion of a 1·6 kb SalI fragment (nt 126625–128227) that removed the whole of ORF327, ORF453 and parts of the lef-2 and bro-e sequences (plasmid pBmpolh{Delta}S) reduced reporter expression to the same level as that of pBmMinpolh, suggesting the presence of a positive regulatory element in this region.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. Relative luciferase levels from varying lengths of the polh upstream region. Different plasmid constructs (2·5 µg DNA) were transfected into BmN cells by lipofection (Palhan et al., 1995Down ) and, after 8 h at 27 °C, the cells were infected with BmNPV (m.o.i. of 10). At 48 h p.i., the cells were harvested, washed in PBS and resuspended in luciferase assay buffer. For the luciferase assay (non-invasive method), 10% of the cell suspension was added to the assay buffer in the presence of 10 µM luciferin at pH 7·2 and light emission was monitored in a luminometer. (a) Activity expressed as relative light units per µg protein for various constructs of the polh promoter. (b) Expression levels of luciferase from the p10 promoter with (left) and without (right) the 665 bp enhancer fragment in cis. The luciferase activity levels are means of three independent transfection experiments.

 
This reduction in activity was not due to the deletion of lef-2, as the following studies show. When the 665 bp MluI fragment (nt 126799–127464) was deleted from pBmpolh to give construct pBmpolh{Delta}M (Fig. 1Up), despite the presence of intact lef-2, luciferase levels were comparable to those from the minimal promoter alone (Fig. 3Up). Furthermore, LEF-2 was provided in trans in all instances by virus infection following transfection. These results implied that the positive element present within the 1·6 kb SalI region was confined to the 665 bp MluI fragment. To confirm this, the 1·2 kb SalI fragment and 665 bp MluI fragment were reintroduced separately into the minimal polh promoter construct to generate pBmMinpolhS and pBmMinpolhM, respectively (Fig. 1Up). They showed equal stimulation in reporter gene activity from pBmMinpolh (Fig. 3Up). The extent of stimulation was similar with the MluI fragment inserted in either orientation (pBmMinpolhM+/-), suggesting that the DNA fragment behaved like an enhancer element. The extent of stimulation, however, was limited to 10-fold, compared with the 25-fold stimulation seen with pBmpolh (harbouring the entire 2·3 kb upstream sequence). Since the MluI fragment encompassed the complete ORF453 together with its 150 bp upstream region (with respect to its +1 ATG) as well as the N-terminal region of ORF327, the possibility of activation in trans by the corresponding encoded proteins could not be ruled out. To test this, plasmid pTZSt (harbouring the 1·2 kb SalI fragment with both the ORFs cloned in plasmid pTZ18R) was co-transfected together with minimal promoter or pBmpolh{Delta}M construct. No stimulation of the luciferase activity was seen (Fig. 3Up), ruling out trans-activation.

In order to narrow down the cis-acting element further, the 665 bp MluI region was partially digested with RsaI and the individual fragments were cloned into pBmMinpolh to generate four additional subclones, pBmMinpolhR9+, pBmMinpolhR92-, pBmMinpolhR3+ and pBmMinpolhR3- (Fig. 1Up). pBmMinpolhR9+ had a 188 bp RsaI–MluI fragment (nt 126800–126988 on the BmNPV genome) cloned in the right orientation whereas pBmMinpolhR92- carried the same 188 bp fragment as well as the 114 bp fragment (nt 126800–127102) in the inverse orientation. The 293 bp RsaI–MluI region (nt 127170–127463), encompassing the N-terminal regions of ORF453 and ORF327, was cloned in both orientations, giving pBmMinpolhR3+ and pBmMinpolhR3-. When the above constructs were transfected into BmN cells, pBmMinpolhR9+ and pBmMinpolhR92- failed to activate luc expression. On the other hand, both plasmids pBmMinpolhR3+ and pBmMinpolhR3- stimulated expression from the minimal polh promoter to the same extent as the parental construct pBmMinpolhM (Fig. 3Up). This activation was thus independent of the orientation of the insert, further substantiating the enhancer model.

Since the 293 bp fragment contained two AP1 sequence motifs, we examined whether the enhancing effect of this fragment on transcription from the polh promoter was due to the presence of these motifs. For this purpose, the 293 bp region was split into two fragments, of 101 bp (nt 127168–127269 on the BmNPV genome) and 198 bp (nt 127256–127464), with an overlap of 16 nt between them. The 101 bp fragment contained two AP1 sequence motifs (TGACTCG) separated by 40 nt, whereas the 198 bp fragment retained only one of the AP1 sites, at the extreme 5' end of the fragment. These two fragments were generated by PCR amplification from genomic DNA using appropriate primers and cloned individually into pBmMinpolh to give constructs pBmMinpolhRP1 and pBmMinpolhRP2 (harbouring the 101 and 198 bp fragments, respectively; Fig. 1Up). Neither of the constructs showed stimulation of luciferase expression over and above the minimal promoter construct. The minimal enhancer element could thus be narrowed down only to the 293 bp RsaI–MluI fragment presented in Fig. 4Down.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. Sequence of the enhancer-harbouring MluI–RsaI fragment. The nucleotide sequence is presented of a 293 bp fragment (nt 127464–127168) on the BmNPV genome that shows enhancer activity. Locations of ORF327 and ORF453, in opposite orientations, are indicated and the two AP1 sites identified are shown in bold. P1a, P1b, P2a and P2b indicate the locations and directions of the primers used to generate the constructs pBmMinpolhRP1 and pBmMinpolhRP2.

 
The increase in luc expression was due to enhanced transcription
In order to determine whether the increase observed in luciferase activity in the presence of the RsaI–MluI fragment was indeed due to an increase in luc transcript levels, the transcripts were quantified (Fig. 5Down). The levels of transcripts were normalized with respect to an endogenous transcript from the host cell (tRNA1Gly, levels of which do not change drastically following virus infection; Sharma et al., 1997Down ), as well as to the amounts of transfected DNA (Fig. 5dDown). A clear increase in the level of luc transcripts was detected in all the samples that were transfected with plasmids containing the enhancer in cis, compared with those lacking it or the minimal promoter construct.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Quantification of transcripts from the enhancer-containing plasmids. The reporter gene (luc) transcript from the transfected cells was quantified by RNA slot blots. Total RNA was isolated from BmN cells transfected with plasmid DNA (2·5 µg each) from pBmpolh (parental construct), pBmpolh{Delta}S, pBmMinpolh, pBmMinpolhR92- or the enhancer-harbouring constructs pBmMinpolhS, pBmMinpolhM+ and pBmMinpolhR3+, followed by BmNPV infection (m.o.i. of 10). The cells were harvested at 48 h p.i. and RNA samples (5 µg each) were blotted on to nylon membranes. Hybridization was carried out at 42 °C for 12 h using a radiolabelled luc probe generated by random priming of the 1·8 kb luc DNA by Klenow DNA polymerase in presence of [{alpha}-32P]dATP. The membranes were washed with 0·1x SSC and 0·1% SDS at 65 °C and subjected to autoradiography (a). Subsequently, the membranes were stripped and reprobed with labelled tRNA1Gly probe to normalize to endogenous transcript levels as a control for RNA loading (b). DNA was also extracted from the transfected samples and was probed with radiolabelled plasmid pBS KS+ DNA to normalize the levels of transfected DNA (c). (d) Quantification of RNA transcripts by densitometric scanning following autoradiography. The luc transcript levels were normalized to the levels of endogenous tRNA transcripts (a/b) to correct for any loading artefacts between the samples and these transcript levels were converted to levels per copy of the transfected plasmid DNA [(a/b)/c].

 
Transcription status of the enhancer fragment
In order to check whether the region containing the enhancer element (nt 127170–127463 on the BmNPV genome) was itself transcriptionally active, RNase protection assays were carried out using antisense riboprobes corresponding to the individual ORFs contained within this fragment. A 192 nt protected fragment corresponding to the ORF453 transcript, which followed a delayed expression pattern (the transcript first appearing at 36 h p.i. and peaking between 48 and 60 h p.i.), was clearly seen (Fig. 6aDown). The distal late transcription start site TAAG, mapping at -40 nt from the +1 ATG of ORF327, is common to lef-2 and ORF327 (Sriram & Gopinathan, 1998Down ). A 163 nt protected fragment of ORF327 was seen when the corresponding antisense probe was used (Fig. 6bDown). Thus, both ORF453 and ORF327 were transcribed in the course of virus infection.



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 6. RNase protection analysis of pBmMinpolhR3+/-. The transcriptional status of the enhancer-containing region in vivo was determined by RNase protection analysis. (a) Transcription of ORF453. Plasmid pBmMinpolhR3+ was linearized with MluI and transcribed in vitro in the presence of T3 RNA polymerase to generate an antisense riboprobe of 330 nt encompassing 145 bp of ORF453, starting from the ATG, and the rest of the upstream region. The labelled antisense riboprobe was hybridized at 50 °C in 50% formamide for 12 h with 20 µg total RNA isolated from uninfected (U) or BmNPV-infected cells at 12, 24, 36, 48, 60 and 72 h p.i. and digested with RNase A and RNase T1. The protected fragment of 192 nt corresponding to the ORF453 transcript is shown. (b) Transcriptional status of ORF327. RNA corresponding to ORF327 was detected by a labelled antisense riboprobe generated from pBmMinpolhR3-. The 32P-labelled probe was synthesized in vitro using T7 RNA polymerase from the linearized plasmid using [{alpha}-32P]UTP as the radioactive label and processed as described for (a). The 163 nt protected fragment detected from infected cells (I) at 60 h p.i. is shown. Lane U, RNA from uninfected cells. A sequencing ladder and an in vitro-synthesized 202 nt luc RNA (lane M) were used to size the protected fragment.

 
Activation from heterologous promoters
Since enhancer sequences are known to bring about activation of heterologous promoters as well, the effect of this enhance-like element on another very late gene promoter (p10 promoter) was analysed. The enhancer-containing MluI fragment was cloned upstream of the AcMNPV p10 promoter in the transfer vector pUW1, carrying the reporter gene luc (pUW1M). Expression from this construct showed only a 2-fold stimulation of luciferase activity (Fig. 3Up, right panel). However, expression from the p10 promoter itself (in the parental plasmid pUW1) was very high, almost 20 times that observed in the case of pBmpolh.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We have identified a region in the upstream flanking sequences of polh of BmNPV, encompassing ORF453 and ORF327, that enhances polh promoter-based expression. The 293 bp fragment was found to satisfy the following criteria for an enhancer element: (i) it augmented transgene expression directed by the polh promoter in a position- and orientation-independent manner, (ii) no stimulation of the polh promoter was observed in trans, (iii) increased expression of the reporter gene, concomitant with increased transcription levels, was observed and (iv) expression was stimulated without promoter specificity. The enhancement of transcriptional activity was only 10-fold, compared with the 1000-fold stimulation observed from the hr-based enhancers. The enhancer-harbouring fragments alone could not restore the minimal promoter activity back to that of the parental plasmid pBmpolh, suggesting that even the remaining regions upstream of polh are important in fostering maximal levels of transcription. No repeat elements characteristic of enhancer elements could be identified in the enhancer region analysed here. However, two AP1 sites (TGACTCG), separated from each other by 40 nt, were identified in this region. Subfragments of the enhancer region containing one or both the AP1 motifs, when placed upstream of the minimal promoter, did not stimulate expression from the polh minimal promoter. Although the 101 bp subfragment, harbouring two AP1 sites, formed a specific complex with nuclear extracts from infected BmN cells (but not with uninfected cell extracts) in gel mobility-shift assays, the complex was not chased out with an excess of AP1 sequences (data not shown). Taken together, these results imply that the AP1 sites may not be involved in the enhancer function. The minimal enhancer element constituted the N-terminal coding regions of ORF453 and ORF327, which belong to the class of uncharacterized genes in all known baculoviruses. The region encompassing the enhancer is actively transcribed (Fig. 6aUp, bUp) from both strands, a feature so far not reported in other conventional enhancers. The significance, if any, of the transcription of this enhancer region is not clear. We therefore define this newly identified region as an enhancer-like element, to distinguish it from conventional enhancers.

The enhancer fragment identified here has been tested with two very late viral promoters, polh and p10. Although these promoters are transcribed exclusively by the virus-encoded polymerase induced late in the infection (Guarino et al., 1998Down ), host factors have also been reported to play a role in late gene transcription (Burma et al., 1994Down ; Mukherjee et al., 1995Down ). However, since extracts from uninfected cells failed to yield a complex with a segment of the enhancer fragment (data not shown), the involvement of early or late virus factors serving as activators through this enhancer element is more likely. For the highest levels of expression from the polh promoter containing the entire 4·0 kb 5' upstream region of the promoter (as in pVL1392), the optimal placement of the foreign gene is at +35 nt with respect to the +1 ATG (Luckow & Summers, 1989Down ). In vector pBm030, the reporter gene is located at -3 nt in relation to the polh ATG, and the expression levels are much lower (10–20% of the former; Sriram et al., 1997Down ). Even though the p10 promoter in vector pUW1 contains only 300 nt upstream of the +1 ATG, it still provides an expression level of 60% compared with the optimized polh promoter-based vector, with its full-length 5' upstream region. Activity from the minimal AcMNPV polh promoter (harbouring up to 550 nt of 5' upstream sequences) was much lower (20%) compared with p10-based expression (Sriram et al., 1997Down ; Sriram & Gopinathan, 1998Down ; Palhan & Gopinathan, 2000Down ).

Although both p10 and polh are transcribed as very late genes by the same virus-encoded polymerase, the requirements for cis elements appear to be somewhat different. Earlier studies on expression from these two promoters suggested competition for one or more components (Chaabihi et al., 1993Down ; van Oers et al., 1992Down ). Deletion of the p10 promoter boosted polh gene expression, presumably through the liberation of one or more components involved in polh transcription. In contrast, no transcriptional enhancement from the p10 promoter was seen when the polh gene was deleted, suggesting the requirement for p10-specific factors that are limiting. The activation of p10 occurs a few hours earlier than that of polh and the maximum expression levels attained are much lower (Roelvink et al., 1992Down ). Furthermore, except for the consensus core sequence TAAG motif at the transcriptional initiation site, the leader sequences of polh and p10 share only limited nucleotide sequence similarity, implying different requirements for transcription factors. This may be the basis for differential regulation of the two very late viral promoters, despite being transcribed by the same virus RNA polymerase. We extend this hypothesis to the case of the enhancer-like region identified here, since the extent of stimulation observed for the two promoters was not the same. Although the 2·3 kb polh 5' upstream regions of BmNPV and AcMNPV differed significantly (absence of ORF603 and presence of bro-e in BmNPV), the 293 bp region was present in both baculoviruses and showed more than 95% identity. However, the 293 bp region was located at different distances, 0·9–1·2 kb upstream of the +1 ATG of polh in BmNPV and 1·6–1·9 kb upstream in AcMNPV. In both viruses, the hr1 sequences are located about 4 kb upstream of the polyhedrin start site. The very high level of expression from the polh promoter achieved in vivo is likely to be the combined effect of the enhancer-like element(s) and the hr sequences.


   Acknowledgments
 
Plasmid pBm030 was a gift from Dr S. Maeda. The authors thank Dr Satyanarayana Sriram for useful discussions and help, especially in the RNase protection assays. We also thank the Department of Biotechnology, Government of India, for financial assistance.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Ahrens, C. H. & Rohrmann, G. F. (1995). Replication of Orgyia pseudotsugata baculovirus DNA: lef-2 and ie-1 are essential and ie-2, p34, and Op-iap are stimulatory genes. Virology 212, 650-662.[Medline]

Ahrens, C. H., Russell, R. L., Funk, C. J., Evans, J. T., Harwood, S. H. & Rohrmann, G. F. (1997). The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 229, 381-399.[Medline]

Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605.[Medline]

Blissard, G. W. & Rohrmann, G. F. (1990). Baculovirus diversity and molecular biology. Annual Review of Entomology 35, 127-155.[Medline]

Burma, S., Mukherjee, B., Jain, A., Habib, S. & Hasnain, S. E. (1994). An unusual 30-kDa protein binding to the polyhedrin gene promoter of Autographa californica nuclear polyhedrosis virus. Journal of Biological Chemistry 269, 2750-2757.[Abstract/Free Full Text]

Chaabihi, H., Ogliastro, M. H., Martin, M., Giraud, C., Devauchelle, G. & Cerutti, M. (1993). Competition between baculovirus polyhedrin and p10 gene expression during infection of insect cells. Journal of Virology 67, 2664-2671.[Abstract/Free Full Text]

Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162, 156-159.[Medline]

Gearing, K. L. & Possee, R. D. (1990). Functional analysis of a 603 nucleotide open reading frame upstream of the polyhedrin gene of Autographa californica nuclear polyhedrosis virus. Journal of General Virology 71, 251-262.[Abstract/Free Full Text]

Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323-1337.[Abstract]

Guarino, L. A. & Dong, W. (1994). Functional dissection of the Autographa californica nuclear polyhedrosis virus enhancer element hr5. Virology 200, 328-335.[Medline]

Guarino, L. A. & Summers, M. D. (1986). Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. Journal of Virology 60, 215-223.[Abstract/Free Full Text]

Guarino, L. A., Xu, B., Jin, J. & Dong, W. (1998). A virus-encoded RNA polymerase purified from baculovirus-infected cells. Journal of Virology 72, 7985-7991.[Abstract/Free Full Text]

Habib, S., Pandey, S., Chatterji, U., Burma, S., Ahmad, R., Jain, A. & Hasnain, S. E. (1996). Bifunctionality of the AcMNPV homologous region sequence (hr1): enhancer and ori functions have different sequence requirements. DNA and Cell Biology 15, 737-747.[Medline]

Hayakawa, T., Rohrmann, G. F. & Hashimoto, Y. (2000). Patterns of genome organization and content in lepidopteran baculoviruses. Virology 278, 1-12.[Medline]

Kang, W., Suzuki, M., Zemskov, E., Okano, K. & Maeda, S. (1999). Characterization of baculovirus repeated open reading frames (bro) in Bombyx mori nucleopolyhedrovirus. Journal of Virology 73, 10339-10345.[Abstract/Free Full Text]

Keddie, B. A., Aponte, G. W. & Volkman, L. E. (1989). The pathway of infection of Autographa californica nuclear polyhedrosis virus in an insect host. Science 243, 1728-1730.[Abstract/Free Full Text]

Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. M. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 17-34.[Medline]

Leisy, D. J. & Rohrmann, G. F. (1993). Characterization of the replication of plasmids containing hr sequences in baculovirus-infected Spodoptera frugiperda cells. Virology 196, 722-730.[Medline]

Lu, M., Farrell, P. J., Johnson, R. & Iatrou, K. (1997). A baculovirus (Bombyx mori nuclear polyhedrosis virus) repeat element functions as a powerful constitutive enhancer in transfected insect cells. Journal of Biological Chemistry 272, 30724-30728.[Abstract/Free Full Text]

Luckow, V. A. & Summers, M. D. (1989). High level expression of nonfused foreign genes with Autographa californica nuclear polyhedrosis virus expression vectors. Virology 170, 31-39.[Medline]

Maeda, S. (1989). Gene transfer vectors of a baculovirus, Bombyx mori nuclear polyhedrosis virus, and their use for expression of foreign genes in insect cells. In Invertebrate Cell System Applications , pp. 167-182. Edited by J. Mitsuhashi. Boca Raton, FL:CRC Press.

Merrington, C. L., Kitts, P. A., King, L. A. & Possee, R. D. (1996). An Autographa californica nucleopolyhedrovirus lef-2 mutant: consequences for DNA replication and very late gene expression. Virology 217, 338-348.[Medline]

Mukherjee, B., Burma, S. & Hasnain, S. E. (1995). The 30-kDa protein binding to the ‘initiator’ of the baculovirus polyhedrin promoter also binds specifically to the coding strand. Journal of Biological Chemistry 270, 4405-4411.[Abstract/Free Full Text]

Ooi, B. G., Rankin, C. & Miller, L. K. (1989). Downstream sequences augment transcription from the essential initiation site of a baculovirus polyhedrin gene. Journal of Molecular Biology 210, 721-736.[Medline]

O’Reilly, D. R., Miller, L. K. & Luckow, V. E. (1992). Baculovirus Expression Vectors: A Laboratory Manual. New York: W. H. Freeman.

Palhan, V. B. & Gopinathan, K. P. (2000). The p10 gene of Bombyx mori nucleopolyhedrosis virus encodes a 7·5 kDa protein and is hypertranscribed from a TAAG motif. Journal of Genetics 79, 33-40.

Palhan, V. B., Sumathy, S. & Gopinathan, K. P. (1995). Baculovirus mediated high-level expression of luciferase in silkworm cells and larvae. Biotechniques 19, 97-104.[Medline]

Pearson, M., Bjornson, R., Pearson, G. & Rohrmann, G. F. (1992). The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257, 1382-1384.[Abstract/Free Full Text]

Possee, R. D. & Howard, S. C. (1987). Analysis of the polyhedrin gene promoter of the Autographa californica nuclear polyhedrosis virus. Nucleic Acids Research 15, 10233-10248.[Abstract/Free Full Text]

Rankin, C., Ooi, B. G. & Miller, L. K. (1988). Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression. Gene 70, 39-49.[Medline]

Roelvink, P. W., van Meer, M. M. M., de Kort, C. A. D., Possee, R. D., Hammock, B. D. & Vlak, J. M. (1992). Dissimilar expression of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus polyhedrin and p10 genes. Journal of General Virology 73, 1481-1489.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sharma, S., Sriram, S., Patwardhan, L. & Gopinathan, K. P. (1997). Expression of individual members of a tRNA1Gly multigene family in vivo follows the same pattern as in vitro. Gene 194, 257-266.[Medline]

Sriram, S. (1998). Bombyx mori nucleopolyhedrosis virus: expression from very late promoters. PhD thesis, Indian Institute of Science, Bangalore.

Sriram, S. & Gopinathan, K. P. (1998). The potential role of a late gene expression factor, lef2, from Bombyx mori nuclear polyhedrosis virus in very late gene transcription and DNA replication. Virology 251, 108-122.[Medline]

Sriram, S., Palhan, V. B. & Gopinathan, K. P. (1997). Heterologous promoter recognition leading to high-level expression of cloned foreign genes in Bombyx mori cell lines and larvae. Gene 190, 181-189.[Medline]

van Oers, M. M., Malarme, D., Jore, J. M. P. & Vlak, J. M. (1992). Expression of the Autographa californica nuclear polyhedrosis virus p10 gene: effect of polyhedrin gene expression. Archives of Virology 123, 1-11.[Medline]

Zemskov, E. A., Kang, W. & Maeda, S. (2000). Evidence for nucleic acid binding ability and nucleosome association of Bombyx mori nucleopolyhedrovirus BRO proteins. Journal of Virology 74, 6784-6789.[Abstract/Free Full Text]

Received 2 April 2001; accepted 31 July 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
A. Acharya and K. P. Gopinathan
Characterization of late gene expression factors lef-9 and lef-8 from Bombyx mori nucleopolyhedrovirus
J. Gen. Virol., August 1, 2002; 83(8): 2015 - 2023.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acharya, A.
Right arrow Articles by Gopinathan, K. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acharya, A.
Right arrow Articles by Gopinathan, K. P.
Agricola
Right arrow Articles by Acharya, A.
Right arrow Articles by Gopinathan, K. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS