J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tuffereau, C.
Right arrow Articles by Perrin, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tuffereau, C.
Right arrow Articles by Perrin, P.
Agricola
Right arrow Articles by Tuffereau, C.
Right arrow Articles by Perrin, P.
Journal of General Virology (2001), 82, 2861-2867.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Interaction of lyssaviruses with the low-affinity nerve-growth factor receptor p75NTR

Christine Tuffereau1, Emmanuel Desmézières2, Jacqueline Bénéjean1, Corinne Jallet2, Anne Flamand1, Noël Tordo2 and Pierre Perrin2

Laboratoire de Génétique des Virus, Bat 14B, Centre National de la Recherche Scientifique, 91198, Gif sur Yvette Cedex, France1
Laboratoire des Lyssavirus, Institut Pasteur, 28, rue du Dr. Roux, 75724 Paris Cedex 15, France2

Author for correspondence: Christine Tuffereau. Fax +33 1 69 82 43 08. email ctuffer{at}gv.cnrs-gif.fr


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The low-affinity nerve-growth factor receptor p75NTR interacts in vitro with the rabies virus (RV) glycoprotein and serves as a receptor for RV. The Lyssavirus genus comprises seven genotypes (GTs) of rabies and rabies-related viruses. The ability of p75NTR to interact with the glycoprotein of representative lyssaviruses from each GT was investigated. This investigation was based on a specific binding assay between BSR cells infected with a lyssavirus and Spodoptera frugiperda (Sf21) cells expressing p75NTR on the cell surface. A specific interaction was observed with the glycoprotein of GT 1 RV (challenge virus standard or Pasteur virus strains) as well as wild-type RV and the glycoprotein of GT 6 European bat lyssavirus type 2. In contrast, no interaction was detected with the glycoprotein of lyssaviruses of GTs 2–5 and 7. Therefore, p75NTR is only a receptor for some lyssavirus glycoproteins, indicating that the other GTs must use an alternative specific receptor.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Lyssaviruses are the aetiological agents of rabies encephalomyelitis. The Lyssavirus genus (rabies and rabies-related viruses) in the family Rhabdoviridae had been divided previously into four serotypes, 1 [rabies virus (RV)], 2 [Lagos bat virus (LB)], 3 [Mokola virus (Mok)] and 4 [Duvenhage virus (Duv) and European bat lyssaviruses (EBL)] (King & Crick, 1988Down ; Rupprecht, 1991Down ; Schneider et al., 1973Down ) according to the cross-reactivity of neutralizing antibodies. However, the lyssaviruses are divided currently into seven genotypes (GTs): the prototype strains are classic RV (GT 1), LB (GT 2), Mok (GT 3), Duv (GT 4), EBL types 1 (GT 5) and 2 (GT 6) and Australian bat lyssavirus (ABL) (GT 7) (Bourhy et al., 1993Down ; Gould et al., 1998Down ). These GTs have been divided recently into two phylogroups, members of which differ in pathogenicity and immunogenicity: phylogroup I comprises viruses of GTs 1 and 4–7, whereas phylogroup II comprises viruses of GTs 2 and 3 (Badrane et al., 2001Down ).

Lyssaviruses are enveloped viruses with glycoprotein (G protein) spikes that associate into trimers (Gaudin et al., 1992Down ). The G protein is a type I integral transmembrane protein with an ectodomain that can be divided into two immunologically autonomous halves, each providing a protective immune response (Bahloul et al., 1998Down ; Jallet et al., 1999Down ). The G protein is involved also in the induction of both virus neutralizing antibodies (Wiktor et al., 1973Down ) and immune protection (Perrin et al., 1985Down ) and in the attachment of the virus to the target cell (see below).

With the exception of the beginning and end of the virus infectious process, i.e. when the viruses infect non-neuronal tissues, lyssaviruses multiply and propagate exclusively in neurones. This restricted tropism in vivo is also observed in vitro, as lyssaviruses isolated from the salivary glands or brains of rabid animals mostly infect cell lines of neuronal origin. In contrast, laboratory strains, which have been adapted for cell growth in vitro, grow in non-neuronal cells as well. It has been suggested, but not demonstrated, that, whereas the use of specific receptors would explain in vivo neurotropism, the adaptation to non-neuronal cells is, at least, due partly to the ability of laboratory strains to use ubiquitous receptor molecules. Various receptor candidates for RV and its glycoprotein have been proposed, such as phospholipids (Perrin et al., 1982Down ; Rupprecht et al., 1994Down ; Superti et al., 1984Down ), gangliosides (Superti et al., 1986Down ) and proteins (Broughan & Wunner, 1995Down ; Perrin et al., 1982Down ) that are present on most cell types investigated to date (Seganti et al., 1990Down ). More neuronal-specific protein receptors include the nicotinic acetylcholine receptor (Lentz et al., 1984Down , 1986Down ), the neural cell adhesion molecule (NCAM) (Thoulouze et al., 1998Down ) and the mouse low-affinity nerve-growth factor receptor p75NTR (Tuffereau et al., 1998bDown ). NCAM has been identified as a receptor for the cell-adapted challenge virus standard (CVS) strain of RV. p75NTR was identified in an expression clone of a cDNA library (from a neuroblastoma cell line) using a soluble form of the RV G protein (Gs) as a ligand (Tuffereau et al., 1998bDown ). It was then demonstrated that p75NTR can serve as a receptor for RV, as BSR cells stably expressing p75NTR could be infected with a wild-type strain of RV (isolated from a rabid fox), which was unable to replicate in cells that did not express the protein. p75NTR is a type I glycoprotein that belongs to the tumour necrosis factor receptor superfamily and posses an ectodomain containing four cysteine-rich domains and a serine/threonine-rich stalk which is highly O-glycosylated. Its intracellular domain bears a ‘death’ domain (Chao, 1994Down ). In adults, p75NTR was reported to be expressed in several categories of neurones as well as in others tissues, such as muscle, inner ear, testes or sub-maxillary glands. In neurones, the expression of p75NTR is located mainly at the synapses.

The restricted neuronal tropism of the RV G protein was also demonstrated by evidence of specific binding of Spodoptera frugiperda (Sf21) cells expressing the RV G protein on the surface to neuronal cells of various origins, whereas no binding was observed with the non-neuronal cell lines tested (Tuffereau et al., 1998aDown ). In order to investigate whether p75NTR could interact with lyssaviruses other than RV, we have used Sf21 cells in a reverse-binding assay. This assay was based on the specific interaction between infected BSR and Sf21 cells expressing cell surface lyssavirus glycoproteins and p75NTR, respectively.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Mice and cells.
Male Swiss OF1 mice [young mouse (10 g), adult mouse (20 g)] used for the amplification of wild-type RV isolates and virus titration were purchased from the Centre d’Elevage et de Recherche Janvier, France.

BSR (cloned from baby hamster kidney cells, BHK-21) (Sato et al., 1977Down ), BHK-21 and Neuro2a (murine neuroblastoma) cells from the ATCC were grown in Eagle’s minimal essential medium (MEM) (Life Technologies) supplemented with 8% foetal bovine serum (FBS) at 37 °C. These cells were used to propagate the different lyssaviruses. After infection, BSR cells were also used for binding assays. Sf21 cells (Invitrogen) were grown in TC100 (Life Technologies) medium supplemented with 10% FBS at 28 °C.

{blacksquare} Lyssaviruses.
Cell-adapted viruses from the seven lyssavirus GTs were used: RV [GT 1 strains Pasteur virus (PV) and CVS], LB (GT 2), Mok (GT 3), Duv (GT 4), EBL-1 (GT 5), EBL-2 (GT 6) and ABL (GT 7). The cell-adapted PV and CVS RV strains were grown in BHK-21 cells (Perrin, 1996Down ). Low passages of LB (strain LB1-8619, isolated from a bat in Nigeria), Mok (strains Mok2-Zim and P11, isolated on 10 February 1989), EBL-1 (strain 8916FRA, subtype b, derived from a bat from France) and EBL-2 (strain 9007FIN, subtype b, isolated from a human in Finland) were received from H. Bourhy (Bourhy et al., 1993Down ) and amplified in BSR cells, as described previously (Perrin et al., 1996Down ). Duv (bat isolate 1486/81, mouse passage no. 3), obtained from C. D. Meredith (Veterinary Institute, Ondersterpoort, South Africa), was passaged once in mouse brain, five times in Neuro2a cells and once in BSR cells to obtain 100% infection. ABL was received from F. Cliquet (AFSSA, Malzeville, France) as low intracerebral passages in mice and directly adapted to BSR cells by four passages. Cell-adapted lyssaviruses were titrated as described by Smith et al. (1996)Down . Titres of virus preparations are expressed as fluorescent focus units per ml. For each lyssavirus, we diluted the clarified BSR-infected cell supernatant such that 100% of the cells were infected after 48 h.

{blacksquare} Antibodies.
FITC-conjugated rabbit anti-ribonucleoprotein (RNP) polyclonal antibodies (PAbs) were prepared as described elsewhere (Perrin, 1996Down ) and were used to monitor virus infection. For immunoprecipitation of lyssavirus glycoproteins, specific PAbs or monoclonal antibodies (MAbs) were prepared in different species: PV PAb (rabbit), LB PAb (mouse), Mok PAb (rabbit) and EBL-1 PAb (mouse) (Perrin et al., 1996Down ; Jallet et al., 1999Down ).

Hybridoma cells [200-3-G6 (20-4)] secreting the specific anti-p75NTR MAb were obtained from the ATCC and ascites fluids were produced in BALB/c mice from the Centre d’Elevage et de Recherche Janvier.

{blacksquare} BSR cell infection.
BSR cells (2x106) were plated onto Petri dishes (6 cm in diameter) treated with poly(L)-lysine (Sigma). Cells were cultured for 24 h in Dulbecco’s MEM (DMEM) supplemented with 10% FBS at 37 °C in a humidified atmosphere containing 7·5% CO2. After the removal of the medium, cells were infected with the various lyssaviruses diluted in 1 ml DMEM to infect about 100% of cells. After virus adsorption for 1 h at room temperature, 2 ml of DMEM supplemented with 2% FBS were added and cells were incubated for 48 h at 37 °C in a humidified atmosphere containing 7·5% CO2.

{blacksquare} RV protein immunoprecipitation.
Proteins were radiolabelled and immunoprecipitations were carried out according to Mebatsion et al. (1999)Down , with some modifications. Briefly, BSR cells (106 cells in 35 mm dishes) were infected at an m.o.i. of 1 with each lyssavirus. At 24 h post-infection, cells were radiolabelled for 6 h with 1·85 MBq of [35S]methionine (Amersham) in methionine-free MEM and chased with MEM containing methionine and 10% FBS.

Immunoprecipitation of lyssavirus proteins expressed on the cell surface was performed at 48 h post-infection. Cells were washed with 1 ml of MEM and incubated with lyssavirus-specific antibodies under optimal conditions (see Fig. 2BDown) for 1 h at 37 °C. Cells were then washed in PBS (Ca+/Mg2+) and lysed in 2 ml of lysis buffer (10 mM Tris–HCl pH 7·4, 150 mM NaCl, 1% Triton X-100, 0·5% sodium deoxycholate) for 30 min at 37 °C. Cell extract was pelleted for 2 min at 10000 g and 100 µl of protein A–Sepharose (Amersham Pharmacia) was added to the supernatants. After incubation for 90 min at room temperature and centrifugation for 2 min at 10000 g, protein complexes were washed twice in lysis buffer supplemented with 0·45% SDS, centrifuged again and suspended in Laemmli buffer. Protein analysis was performed by SDS–PAGE.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Expression of lyssavirus (GTs 1–7) glycoproteins at the surface of infected-BSR cells. Proteins from non-infected cells (lane 4) or from cells infected with RV strain PV (lanes 1–3) and incubated before cell lysis with anti-G protein PV MAb (lane 1) and anti-RNP PV PAb (lane 2) or after cell lysis with anti-RNP PAb (lane 3). Protein from BSR cells infected with a lyssavirus from each GT (lanes 5–11) and incubated before cell lysis with various antibodies: PV (GT 1) and anti-G PV PAb (lane 5); LB (GT 2) and anti-G LB PAb (lane 6); Mok (GT 3) and anti-G Mok PAb (lane 7); Duv (GT 4) and anti-G EBL-1 PAb (lane 8); EBL-1 (GT 5) and anti-G EBL-1 PAb (lane 9); EBL-2 (GT 6) and anti-G PV PAb (lane 10); ABL (GT 7) and anti-G PV PAb (lane 11).

 
Immunoprecipitation of intracellular viral proteins was carried out as described above except that anti-RNP serum (1/200 dilution) was added to the cell extract after detergent cell lysis. Immune complexes were treated as described above.

{blacksquare} Recombinant baculovirus encoding p75NTR.
The human p75NTR-coding sequence was amplified by PCR using the specific oligonucleotides 5' GCGGGATCCCGGGCGATGGGGGCAG 3' and 5' CGCGGATCCTCATCACACCGGGGATGTGGC 3', which hybridize to the complementary 5' and 3' ends of the human p75NTR-coding sequence, respectively. The amplified cDNA fragment was digested with BamHI and inserted into the transfer vector pAcYM1 (Matsura et al., 1987Down ). Recombinant plasmids were used to co-transfect Sf21 cells, together with linearized lacZ DNA from the Autographa californica nuclear polyhedrosis virus. Two rounds of plaque purification with Sf21 cells isolated recombinant baculoviruses. A virus stock was prepared and titrated in Sf21 cells.

{blacksquare} Binding of the RV Gs protein to Sf21 cells expressing p75NTR (p75-Sf21).
A soluble form of the RV G protein (Gs) was produced as described previously (Tuffereau et al., 1998bDown ). The Gs protein, which was released in the supernatant of cells expressing the full-length glycoprotein, has been shown to interact with p75NTR-expressing COS-7 cells. Medium containing the Gs protein was added to paraformaldehyde-fixed p75-Sf21 cells. After a 2 h incubation at room temperature, cells were treated with specific anti-G protein MAbs and FITC-conjugated goat anti-mouse secondary antibody, as described by Tuffereau et al. (1998bDown ).

{blacksquare} Binding assays.
(i) With radiolabelled live p75-Sf21cells.
BSR cell monolayers infected with various lyssaviruses were incubated in the presence of a suspension of p75-Sf21 cells. Before the binding assay, Sf21 cells (7·5x106 cells in TC100 medium supplemented with 10% FBS) were cultured in Petri dishes (120 mm in diameter) and infected with the recombinant p75NTR baculovirus (m.o.i. of 5) for 6 h at 28 °C. The cells were then incubated with [35S]methionine/cysteine (ICN) (1·85 MBq of Trans-label was used per 107 cells) for 24 h at 28 °C. Before use, p75-Sf21 cells were suspended in DMEM supplemented with 5 mM EDTA, pelleted and resuspended to obtain a density of 106 cells per ml. A 2 ml suspension of p75-Sf21 cells was then added drop-wise onto the infected BSR cell monolayer (in triplicate). After 30 min of incubation at room temperature, unbound p75-Sf21 cells were removed by washing three times with PBS, pH 7·4. The bound p75-Sf21 cells were scraped into 1 ml of TD buffer (137 mM NaCl, 25 mM Tris–HCl, 0·7 mM Na2HPO4, 5 mM KCl, pH 7·4) supplemented with 10 mM EDTA. Sf21 cells expressing {beta}-galactosidase (lacZ-Sf21) were used as the control cell line.

(ii) On paraformaldehyde-fixed p75-Sf21 cells.
Monolayers of 3x106 Sf21 cells were infected with recombinant baculovirus encoding p75NTR at an m.o.i. of 5. At 30 h post-infection, cells were fixed with cold 4% paraformaldehyde in PBS (pH 7·4) for 10 min and the monolayers were washed three times with PBS. Monolayers were then incubated with dilutions of anti-p75 MAb ascites fluids for 2 h at room temperature before incubation with radiolabelled RV-infected cells. BSR cells were infected with the CVS strain of RV at an m.o.i. of 5 and were then radiolabelled with [35S]methionine/cysteine (1·85 MBq of Trans-label per 107 cells) for 24 h at 37 °C. At 30 h post-infection, BSR-infected cells were collected in TD buffer supplemented with 10 mM EDTA, dissociated by pipetting, pelleted at 1000 g for 5 min and resuspended in DMEM supplemented with 5 mM EDTA to obtain 1–2x106 cells per ml. The infected BSR cell suspension was then added to the p75-Sf21 cell monolayers pre-treated with antibodies and binding was performed as described above.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Functional expression of p75NTR on the surface of Sf21 cells
After infection with a recombinant baculovirus encoding the p75NTR receptor, a significant amount of p75NTR was detected on the cell surface of p75-Sf21 cells by immunofluorescence [Fig. 1BDown (1)]. Furthermore, specific binding of the RV Gs protein can be observed on p75-Sf21 cells [Fig. 1A (1)Down], indicating that a functional p75NTR protein was expressed on the surface of Sf21 cells after infection with the recombinant baculovirus. Therefore, these cells were used to monitor the interaction between the lyssaviruses G protein and p75NTR.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Functional expression of p75NTR on the surface of Sf21 cells. Sf21 cells were infected with the p75NTR recombinant baculovirus at an m.o.i. of 5 for 30 h. Cells were fixed with 4% paraformaldehyde, treated with an anti-p75 MAb [B (panel 1)] or incubated first with the soluble rabies glycoprotein (Gs) and then incubated with anti-G protein MAbs [A (panel 1)], followed by a goat FITC-labelled anti-mouse secondary antibody. [A, B (panels 2)] Control samples in the absence of the Gs protein or anti-p75 MAb, respectively. Magnification x100.

 
Lyssavirus G protein expression on the surface of BSR-infected cells
We first investigated the expression of viral proteins after infection. Under optimal conditions, about 100% of BSR cells showed intracytoplasmic RNP inclusions, irrespective of the lyssavirus that was used for infection (data not shown). In addition, cells were tested either by immunofluorescence on formaldehyde-fixed cells (data not shown) or by cell surface immunoprecipitation for their ability to express glycoproteins on the surface.

Immunoprecipitation of proteins expressed on the surface of BSR cells infected with each lyssavirus was also performed (Fig. 2Up). For RV strain PV (Fig. 2Up, lanes 1–4), when antibodies directed against the RV G protein (Fig. 2Up, lane 1Up) or RNP (Fig. 2Up, lane 2) were added prior to cell lysis, the surface G protein was immunoprecipitated but the internal RNP was not. RNP (mainly nucleoprotein) was precipitated only when cells were lysed before adding the antibodies (Fig. 2Up, lane 3) and no precipitation was observed with non-infected BSR cells (Fig. 2Up, lane 4). Therefore, immunoprecipitation with antibodies prior to cell lysis only allows the detection of RV G protein expressed on the cell surface and can be used to compare the cell surface expression of the different lyssavirus G proteins.

After infection with a virus representative of each lyssavirus GT, a significant amount of G protein was immunoprecipitated (Fig. 2Up, lanes 5–11) for each virus. Consequently, the following binding assay with lyssavirus-infected BSR cells and p75-Sf21 cells can be performed under satisfactory experimental conditions.

Specific binding between RV G protein and p75NTR
We developed specific binding assays to assess the interaction of lyssavirus G protein with p75NTR. We monitored either the binding of radiolabelled RV-infected BSR cells to Sf21 cell monolayers expressing large amounts of p75NTR on the surface after infection with a recombinant baculovirus (p75-Sf21) or the symmetrical experiment.

In the first assay, while radiolabelled BSR cells infected with RV strain CVS (GT 1) bound to monolayers of p75-Sf21 cells [Fig. 3ADown, NIS (non-immune serum)], pre-treatment of p75-Sf21 cells with anti-p75 antibodies inhibited binding according to the antibody concentration used (Fig. 3ADown, p75-MAb at a 1/50 or 1/150 dilution). RV-infected BSR cells did not bind to Sf21 cells expressing {beta}-galactosidase (lacZ-Sf21) (data not shown). These results indicate clearly that p75NTR, expressed on the surface of p75-Sf21 cells, alone was involved in the binding to RV-infected BSR cells and that no co-receptor was required.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. Specificity of the interaction between the RV glycoprotein and p75NTR. (A) Inhibition by anti-p75NTR MAb. Monolayers of Sf21 cells, infected with the p75NTR baculovirus recombinant at an m.o.i. of 5 for 30 h, were treated with NIS diluted 1/50 or anti-p75NTR ascites fluids diluted 1/150 or 1/50 before incubation with radiolabelled RV strain PV-infected BSR cells. Each value is the mean of a triplicate set of results [(c.p.m. of infected BSR cells)-(c.p.m. of uninfected BSR cells)] for the same experiment. (B) Inhibition by anti-G PV PAb. Monolayers of BSR cells infected with RV strain PV at an m.o.i. of 3 were either non-treated (medium) or treated with NIS diluted 1/100 or an anti-G PAb diluted 1/100 before binding with radiolabelled p75-Sf21 cells. Each value is the mean of a triplicate set of results [(c.p.m. with infected cells)-(c.p.m. with uninfected cells)] for the same experiment.

 
In the second assay, while radiolabelled p75-Sf21cells bound to monolayers of BSR cells infected with RV strain PV (GT 1) (Fig. 3BUp, medium), pre-treatment of RV-infected BSR cells with an anti-G protein immune serum inhibited binding (Fig. 3BUp, G-PAb at a 1/100 dilution), whereas no significant decrease in binding was observed upon treatment with NIS at a 1/100 dilution. As we have shown that the RV G protein was the only viral protein expressed on the surface of RV-infected cells (Fig. 2Up), this clearly indicates that the G protein is involved in the binding to p75-Sf21 cells. Consequently, this binding reaction is dependant on the specific interaction between the RV G protein and p75NTR and will be used to address the ability of the different lyssavirus glycoproteins to interact with p75NTR.

Binding of p75-Sf21 cells to lyssavirus-infected BSR cells
We studied the interaction between representative viruses of each lyssavirus GT and p75NTR by incubating BSR cells infected with lyssaviruses (GTs 1–7) with radiolabelled p75-Sf21 cells. The binding efficiency of p75-Sf21 cells depends on the lyssavirus GT (Fig. 4Down). p75-Sf21 cells binds with a similar efficiency to cells infected with lyssaviruses from GTs 1 (Fig. 4Down, RV strain PV) or 6 (Fig. 4Down, EBL-2). In contrast, no significant binding was observed with non-infected cells (Fig. 4Down, ni) or with BSR cells infected with viruses of GTs 2 (LB), 3 (Mok), 4 (Duv), 5 (EBL-1) or 7 (ABL). This absence of interaction was not due to the low levels of G protein expressed on the surface of the infected cell, as the amounts of G protein were found to be similar after specific immunoprecipitation of the G protein expressed on the surface of BSR cells infected with any lyssavirus (Fig. 2BUp). Thus, Sf21 cells expressing p75NTR specifically bound only to BSR cells infected with lyssaviruses of GTs 1 and 6, suggesting that the G protein of viruses belonging to GTs 2–5 and 7 could interact with other receptor(s).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Binding of radiolabelled p75-Sf21 cells to BSR cells infected with lyssavirus (GTs 1–7). Monolayers of BSR cells were infected at an m.o.i. that would result in the expression of lyssavirus glycoproteins on the surface of about 100% of cells. At 48 h after infection, cells were incubated with radiolabelled p75-Sf21 cells. Representative viruses for each GT were RV (strain PV) for GT 1, LB for GT 2, Mok for GT 3, Duv for GT 4, EBL-1 for GT 5, EBL-2 for GT 6 and ABL for GT 7. Each value represents the mean of a triplicate set of results for the same experiment.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Very few comparative studies on lyssaviruses have been published to date (most are reviewed by Rupprecht et al., 1994Down ; Badrane et al., 2001Down ). This is particularly true for the interaction between lyssaviruses and their receptors. In this paper, we have investigated the interaction between lyssavirus glycoprotein G and p75NTR, which has been shown previously to interact with the GT 1 RV glycoprotein (Tuffereau et al., 1998bDown ).

For this purpose, we developed a specific binding assay between lepidopteran Sf21 cells expressing p75NTR on the surface after infection with a recombinant baculovirus and BSR cells infected with lyssaviruses. We first showed that Sf21 cells expressing p75NTR bound specifically to RV, but not to cells infected with the vesicular stomatitis virus (prototype virus of the genus Vesiculovirus, family Rhabdoviridae) (data not shown). This binding was inhibited by the pre-treatment of either p75-Sf21 cells with anti-p75 MAb or RV-infected BSR cells with an anti-G protein antiserum. This binding was found to be the same as that which was conducted for the identification of p75NTR as a receptor for RV, where the RV G protein was expressed on the surface of Sf21 cells and p75NTR was expressed in BSR cells (Tuffereau et al., 1998bDown ). Taken together, these experiments indicate that binding assays between Sf21 cells and mammalian cells, each expressing either the protein or its ligand on the surface, may be a simple alternative method for analysing virus–receptor interactions. Moreover, this method does not require the production and purification of soluble proteins and can be used to assess the interaction of wild-type virus isolates. For example, using a similar binding assay, Hsu et al. (1998)Down have shown that Sf21 cells expressing the Edmonston measles virus H protein (but not those expressing the wild-type H protein) bind specifically to CD46-expressing cells.

Using this type of assay, we have shown that only GT 1 (CVS, PV and wild-type RV isolates) and the related GT 6 (EBL-2) lyssaviruses bound to p75NTR. No interaction was detected with lyssaviruses from the other genotypes. Among the lyssaviruses that were found to be unable to interact with p75NTR, binding with the Mok virus glycoprotein was intensively studied (data not shown). A wild-type Mok virus isolate did not infect BSR cells that stably expressed p75NTR, whereas a wild-type RV isolate efficiently replicated in these cells. Moreover, p75-Sf21 cells did not bind to Neuro2a cells transiently transfected with a plasmid encoding the Mok virus G protein, whereas they did bind to cells transiently expressing the G protein of RV strain PV. This clearly indicates that only viruses belonging to GTs 1 and 6 interact with p75NTR.

Lyssaviruses have been classified into seven GTs, which can be divided into two phylogroups (Badrane et al., 2001Down ; Bourhy et al., 1993Down ). Thus, the ability of lyssavirus glycoprotein to interact with p75NTR is preserved for only two GTs from phylogroup 1 (GTs 1 and 6), but not for three others (GTs 4, 5 and 7). Glycoprotein sequence comparisons between the lyssaviruses used in this study do not give a clear indication about the localization of the potential binding site. Previous results suggest that antigenic site III could be involved in the p75NTR interaction, which has been shown by the K330N and R333M substitutions in the RV G protein that reduced the binding to p75NTR (Tuffereau et al., 1998bDown ). In order to identify precisely the p75NTR-binding site on the RV G protein, we are selecting mutants resistant to a soluble form of p75NTR. This strategy has been successfully used to perform fine mapping of the binding site with a few virus receptors, such as those for poliovirus (Colston & Racaniello, 1994Down ) and coronavirus (Saeki et al., 1997Down ). Although we have shown that p75NTR can serve as a receptor for a wild-type isolate allowing in vitro cell infection (Tuffereau et al., 1998bDown ), its role in vivo is not clear. p75NTR-deficient mice developed a fatal encephalitis when inoculated intracerebrally with the cell-adapted CVS-11 strain of RV (Jackson & Park, 1999Down ), but this was delayed (1–2 days) when a wild-type RV isolate was inoculated intramuscularly (C. Tuffereau and P. Perrin, unpublished observations). However, it has been reported that a mRNA splice variant of p75NTR, which lacks exon 3, has been discovered (Dechant & Barde, 1997Down ; G. Dechant, personal communication). This alternative spliced form is, apparently, still expressed in the original p75 knockout mice, which have a deletion of the p75 exon 3, brought about by homologous recombination. If confirmed, the presence of this alternate transcript permits the re-evaluation of the conclusions drawn from studies using the p75 knockout mice. Other mice that are completely deficient in p75NTR should be tested for wild-type RV infection. It is also possible that several neuronal receptors can mediate RV infection. Indeed, we have demonstrated that neuroblastoma cell lines that do not express p75NTR, were able to bind specifically the RV glycoprotein (C. Tuffereau, unpublished observations), suggesting the existence of additional neuronal receptors for RV. Such a situation would not be original among viruses, as the use of more than one receptor or co-receptor has been described frequently. For example, in the case of measles virus, a secondary receptor recognized both by the vaccine strain and the wild-type isolate has been cloned recently (Tatsuo et al., 2000Down ).

Differences in the pathogenicity within members of the Lyssavirus genus also suggest the existence of additional receptors. Representative viruses from phylogroup I (GTs 1 and 4–7) are pathogenic in mice both by intramuscular and intracerebral routes, whereas members from phylogroup II (GTs 3 and 2) are pathogenic to mice only when injected intracerebrally (Badrane et al., 2001Down ; Bahloul et al., 1998Down ; Fekadu et al., 1988Down ; Jallet et al., 1999Down ; King & Crick, 1988Down ; Murphy et al., 1973Down ; Perrin et al., 1996Down ). As only viruses belonging to GTs 1 and 6 interact with p75NTR, other neuronal receptors that are able to mediate virus entry into the nervous system after intramuscular inoculation of GTs 7, 5 and 4 or intracerebral inoculation of members of the phylogroup II (GTs 3 and 2) can be postulated. Efforts are being made currently to identify these other neuronal receptors.


   Acknowledgments
 
This work was supported by the CNRS (UPR 9053), the Institut Pasteur and the Ministère de l’Education Nationale de la Recherche et de la Technologie (PRFMMIP). We are grateful to Hassan Badrane for information on lyssavirus phylogeny and Florence Cliquet for providing ABL virus.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Badrane, H., Bahloul, C., Perrin, P. & Tordo, N. (2001). Evidence of two lyssavirus phylogroups with distinct pathogenicity and immunogenicity. Journal of Virology 75, 3268-3276.[Abstract/Free Full Text]

Bahloul, C., Jacob, Y., Tordo, N. & Perrin, P. (1998). DNA-based immunization for exploring the enlargement of immunological cross-reactivity against the lyssaviruses. Vaccine 16, 417-425.[Medline]

Bourhy, H., Kissi, B. & Tordo, N. (1993). Molecular diversity of the Lyssavirus genus. Virology 194, 70-81.[Medline]

Broughan, J. H. & Wunner, W. H. (1995). Characterization of protein involvement in rabies binding to BHK-21 cells. Archives of Virology 140, 75-93.[Medline]

Chao, M. V. (1994). The p75 neurotrophin receptor. Journal of Neurobiology 25, 1373-1385.[Medline]

Colston, E. & Racaniello, V. R. (1994). Soluble receptor-resistant poliovirus mutants identify surface and internal capsid residues that control interaction with the cell receptor. EMBO Journal 13, 5855-5862.[Medline]

Dechant, G. & Barde, Y.-A. (1997). Signalling through the neurotrophin receptor p75NTR. Current Opinion in Neurobiology 7, 413-418.[Medline]

Fekadu, M., Shaddock, J. H., Sanderlin, D. W. & Smith, J. S. (1988). Efficacy of rabies vaccines against Duvenhage virus isolated from European house bats (Eptesicus serotinus), classic rabies and rabies-related virus. Vaccine 6, 533-539.[Medline]

Gaudin, Y., Ruigrok, R., Tuffereau, C., Knossow, M. & Flamand, A. (1992). Rabies glycoprotein is a trimer. Virology 187, 627-632.[Medline]

Gould, A. R., Hyatt, A. D., Lunt, R., Kattenbelt, J. A., Hengstberger, S. & Blacksell, S. D. (1998). Characterisation of a novel lyssavirus isolated from Pteroid bats in Australia. Virus Research 54, 165-187.[Medline]

Hsu, E. C., Sarangi, F., Iorio, C., Sidhu, M., Udem, S., Dillehay, D. L., Xu, W., Rota, P. A., Bellini, W. J. & Richardson, C. D. (1998). A single amino acid change in the hemagglutinin protein of measles virus determines its ability to bind CD46 and reveals another receptor on marmoset B cells. Journal of Virology 72, 2905-2916.[Abstract/Free Full Text]

Jackson, A. C. & Park, H. (1999). Experimental rabies virus infection of p75 neurotrophin receptor-deficient mice. Acta Neuropathology 98, 641-644.

Jallet, C., Jacob, Y., Bahloul, C., Drings, A., Desmézières, E., Tordo, N. & Perrin, P. (1999). Chimeric lyssavirus glycoproteins with increased immunological potential. Journal of Virology 73, 225-233.[Abstract/Free Full Text]

King, A. & Crick, J. (1988). Rabies-related viruses In Rabies , pp. 117-199. Edited by J. B. Campbell & K. M. Charlton. Boston:Kluwer.

Lentz, T. L., Wilson, P. T., Hawrot, E. & Speicher, D. W. (1984). Amino acid sequence similarity between rabies virus glycoprotein and snake curaremimetic neurotoxins. Science 226, 847-848.[Abstract/Free Full Text]

Lentz, T. L., Benson, R. J., Klimowicz, D., Wilson, P. T. & Hawrot, E. (1986). Binding of rabies virus to purified Torpedo acetylcholine receptor. Brain Research 1, 211-219.

Matsura, Y., Possee, R. D., Overton, H. A. & Bishop, D. H. (1987). Baculovirus expression vectors: the requirement for high level expression of proteins, including glycoproteins. Journal of General Virology 68, 1233-1250.[Abstract/Free Full Text]

Mebatsion, T., Weiland, F. & Conzelmann, K.-K. (1999). Matrix protein of rabies virus is responsible for the assembly and budding of bullet-shaped particles and interacts with the transmembrane spike glycoprotein G. Journal of Virology 73, 242-250.[Abstract/Free Full Text]

Murphy, F., Harrison, A., Washington, C., Winn, M. & Bauer, S. (1973). Comparative pathogenesis of rabies and rabies-like viruses. Laboratory Investigation 29, 1-16.[Medline]

Perrin, P. (1996). Techniques for the preparation of rabies conjugates In Laboratory Techniques in Rabies , pp. 433-445. Edited by F.-X. Meslin, M. Kaplan & H. Koprowski. Geneva:World Health Organization.

Perrin, P., Portnoi, D. & Sureau, P. (1982). Etude de l’adsorption et de la pénétration du virus rabique: interactions avec les cellules BHK-21 et des membranes artificielles. Annales Virologie 133, 403-422.

Perrin, P., Thibodeau, L. & Sureau, P. (1985). Rabies immunosome (subunit vaccine) structure and immunogenicity. Pre- and post-exposure treatment. Vaccine 3, 325-332.[Medline]

Perrin, P., Tino de Franco, M., Jallet, C., Fouque, F., Morgeaux, S., Tordo, N. & Colle, J.-H. (1996). The antigen-specific cell-mediated immune response in mice is suppressed by infection with pathogenic lyssaviruses. Research in Virology 147, 289-299.[Medline]

Rupprecht, C. (1991). Antigenic relationships of lyssavirus In The Natural History of Rabies , pp. 69-100. Edited by G. Baer. Boca Raton, FL:CRC Press.

Rupprecht, C., Dietzschold, B. & Koprowski, H. (1994). Lyssaviruses. Current Topics in Microbiology and Immunology 187, 1-339.[Medline]

Saeki, K., Ohtsuka, N. & Taguchi, F. (1997). Identification of spike protein residues of murine coronavirus responsible for receptor-binding activity by use of soluble receptor-resistant mutants. Journal of Virology 71, 9024-9031.[Abstract]

Sato, M., Maeda, N., Yoshida, H., Urade, M., Saito, S., Miyazaki, T., Shibata, T. & Watanabe, M. (1977). Plaque formation of herpes virus hominis type 2 and rubella virus in variants isolated from the colonies of BHK-21/WI-2 cells formed in soft agar. Archives of Virology 53, 269-273.[Medline]

Schneider, L., Dietzschold, B., Dierks, R., Mathaeus, W., Enzman, P. & Strohmaier, K. (1973). Rabies group-specific ribonucleoprotein antigen and test system for grouping and typing rhabdoviruses. Journal of Virology 11, 748-755.[Abstract/Free Full Text]

Seganti, L., Superti, F., Bianchi, S., Orsi, N., Divizia, M. & Pana, A. (1990). Susceptibility of mammalian, avian, fish, and mosquito cell lines to rabies infection. Archives of Virology 34, 155-163.

Smith, J., Yager, P. & Baer, G. (1996). A rapid fluorescent focus inhibition test (RFFIT) for determining virus-neutralizing antibody In Laboratory Techniques in Rabies , pp. 181-189. Edited by F.-X. Meslin, M. Kaplan & H. Koprowski. Geneva:World Health Organization.

Superti, F., Seganti, L., Tsiang, H. & Orsi, N. (1984). Role of phospholipids in rhabdovirus attachment to CER cell. Archives of Virology 81, 321-328.[Medline]

Superti, F., Hauttecoeur, B., Morelec, M. J., Goldoni, P., Bizzini, B. & Tsiang, H. (1986). Involvement of gangliosides in rabies virus infection. Journal of General Virology 67, 47-56.[Abstract/Free Full Text]

Tatsuo, H., Ono, N., Tanaka, K. & Yanagi, Y. (2000). SLAM (CDw150) is a cellular receptor for measles virus. Nature 406, 893-897.[Medline]

Thoulouze, M.-I., Lafage, M., Schachner, M., Hartmann, U., Cremer, H. & Lafon, M. (1998). The neuronal cell adhesion molecule is a receptor for rabies virus. Journal of Virology 72, 7181-7190.[Abstract/Free Full Text]

Tuffereau, C., Bénéjean, J., Roque-Afonso, A-M., Flamand, A. & Fishman, M. C. (1998a). Neuronal cell surface molecules mediate specific binding to rabies virus glycoprotein expressed by a recombinant baculovirus on the surfaces of lepidopteran cells. Journal of Virology 72, 1085-1091.[Abstract/Free Full Text]

Tuffereau, C., Bénéjean, J., Blondel, D., Kieffer, B. & Flamand, A. (1998b). Low-affinity nerve-growth factor receptor (p75NTR) can serve as a receptor for rabies virus. EMBO Journal 17, 7250-7259.[Medline]

Wiktor, T., Gyorgy, E., Schlumberger, D., Sokol, F. & Koprowski, H. (1973). Antigenic properties of rabies virus components. Journal of Immunology 110, 269-276.[Abstract/Free Full Text]

Received 21 May 2001; accepted 15 August 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
C. Tuffereau, K. Schmidt, C. Langevin, F. Lafay, G. Dechant, and M. Koltzenburg
The Rabies Virus Glycoprotein Receptor p75NTR Is Not Essential for Rabies Virus Infection
J. Virol., December 15, 2007; 81(24): 13622 - 13630.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. J. Guyatt, J. Twin, P. Davis, E. C. Holmes, G. A. Smith, I. L. Smith, J. S. Mackenzie, and P. L. Young
A molecular epidemiological study of Australian bat lyssavirus
J. Gen. Virol., January 1, 2003; 84(2): 485 - 496.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Langevin and C. Tuffereau
Mutations Conferring Resistance to Neutralization by a Soluble Form of the Neurotrophin Receptor (p75NTR) Map outside of the Known Antigenic Sites of the Rabies Virus Glycoprotein
J. Virol., October 2, 2002; 76(21): 10756 - 10765.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Langevin, H. Jaaro, S. Bressanelli, M. Fainzilber, and C. Tuffereau
Rabies Virus Glycoprotein (RVG) Is a Trimeric Ligand for the N-terminal Cysteine-rich Domain of the Mammalian p75 Neurotrophin Receptor
J. Biol. Chem., September 27, 2002; 277(40): 37655 - 37662.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tuffereau, C.
Right arrow Articles by Perrin, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tuffereau, C.
Right arrow Articles by Perrin, P.
Agricola
Right arrow Articles by Tuffereau, C.
Right arrow Articles by Perrin, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS