J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hatama, S.
Right arrow Articles by Fujii, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hatama, S.
Right arrow Articles by Fujii, Y.
Agricola
Right arrow Articles by Hatama, S.
Right arrow Articles by Fujii, Y.
Journal of General Virology (2001), 82, 2999-3004.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Isolation and sequencing of infectious clones of feline foamy virus and a human/feline foamy virus Env chimera

Shinichi Hatama1,3, Kaori Otake2, Shinya Omoto1, Yasunori Murase1, Atushi Ikemoto1, Masami Mochizuki4, Eiji Takahashi3, Harumi Okuyama1 and Yoichi Fujii1

Department of Biological Chemistry, Faculty of Pharmaceutical Sciences, Nagoya City University, Nagoya 467-8603, Japan1
Department of Immunology, National Institute of Infectious Disease, Tokyo 113-8657, Japan2
Department of Veterinary Microbiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo 1-1-1, Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan3
Central Laboratory, Kyoritu Shouji Co. Ltd, Ibaraki, Japan4

Author for correspondence: Yoichi Fujii. Fax +81 52 836 3430. e-mail fatfuji{at}hotmail.com


   Abstract
TOP
Abstract
Main text
References
 
Full-length DNAs of the Coleman and S7801 strains (pSKY3.0, pSKY5.0) of infectious feline foamy viruses (FFVs) were cloned and sequenced. Parental viruses, designated SKY3.0 and SKY5.0, were secreted following transfection of Crandell feline kidney (CRFK) cells. Production of the rescued parental viruses was enhanced in the presence of trichostatin A. Amino acid sequence similarities between FFV and human foamy virus (HFV) are extremely low for the envelope protein and capsid antigen, as predicted from the two clones. However, a chimeric FFV clone was constructed with the HFV Env substituted for the FFV Env. The chimeric virus (HFFV, SKY4.0) was able to infect and replicate in CRFK cells as well as in peripheral blood mononuclear cells of cats in vivo. Consequently, the chimeric HFFV may be useful for the creation of FV vectors for gene transfer strategies.


   Main text
TOP
Abstract
Main text
References
 
The genomic DNA of feline foamy virus (FFV) contains structural genes designated gag, pol and env, as well as the auxiliary gene bel (Helps & Harbour, 1997Down ). These genes are located between two long terminal repeats (LTRs). Although this type of genome organization is common for foamy viruses (FVs) from several species of mammals, there are remarkable dissimilarities between FVs and other retroviruses in their mode of replication (Yu et al., 1996Down ). For example, interactions between group-specific antigen (Gag) and envelope protein (Env) are essential for the assembly and budding of infectious FV particles (Pietschmann et al., 1999Down ), whereas the Gag protein alone is sufficient to allow budding in cells infected with retroviruses other than FVs (Linial, 1999Down ). Reports indicate that it is difficult to produce high titre pseudotyped FV bearing glycoproteins from murine leukaemia virus Env or vesicular stomatitis virus G proteins (Lindemann et al., 1997Down ; Hill et al., 1999Down ). These observations indicate that the interaction between FV Gag and Env of different species of origin may be of interest when evaluating FVs as vector candidates for gene transfer. We report the isolation and sequencing of FFV clones SKY3.0 and SKY5.0. Furthermore, we show that a chimeric FFV clone (HFFV) bearing Env and a part of the trans-activator (Tas) from human foamy virus (HFV) can infect and replicate in HFV-susceptible cells.

Coleman, S7801 and Sammy-1 strains of FFV were grown as described previously (Hatama et al., 2001Down ). Crandell feline kidney (CRFK) cells were infected with each FFV strain, and total DNA was extracted using the Total DNA Extraction kit (Stratagene) according to the manufacturer’s instructions. Preliminary experiments revealed that the extracted DNA contained a number of circular forms of unintegrated viral DNA which contained single LTRs. To construct the infectious clones, pSKY1.0 and pSKY2.0, the extracted DNA was amplified by PCR using two primer pairs, 5' agctgatgatccaagtgatgttgcttccc 3' (nt 10239–10267 in the FUV genome; accession no. Y08851) and 5' cgactcatcctgagttgcatgttgacata 3' (nt 6395–6423), and 5' ggaatggaatgctcacaaacaactacaga 3' (nt 6357–6385) and 5' ctagggaccttaccttactgaggaaggat 3' (nt 1415–1443). Amplified DNAs were cloned into pCR2.1 (Invitrogen) to give two clones designated as 5'LTR-gag-pol (pSKY1.0) and env-bel-3'LTR (pSKY2.0). To construct the full-length Coleman clone, pSKY3.0, the SalI and SpeI double-digested fragment of pSKY2.0 was inserted into pSKY1.0 after digestion of the plasmid with the same enzymes. A similar procedure was used to construct the full-length S7801 clone, pSKY5.0. The DNA sequences of the FFV clones, pSKY3.0 (accession no. AB052796) and pSKY5.0 (accession no. AB052797) were determined using a DSQ-2000L DNA sequencer (Shimazu Co.). The Coleman and S7801 clones were 11694 and 11660 bp in length. Comparisons of the putative Gag, Pol, Env, Bel I and Bel II amino acid sequences between either SKY3.0 or SKY5.0 and FUV (Winkler et al., 1997Down ) gave similarity estimates of 95·9, 96·9, 82·4, 89·8 and 94·2%, and 96·9, 95·4, 83·3, 94·3 and 93·6%, respectively. Gag, Pol, Env, Bel I and Bel II amino acid sequence similarities between either SKY3.0 or SKY5.0 and HFV (Löchelt et al., 1991Down ) were 34·7, 60·1, 42·3, 17·6 and 31·8%, and 34·4, 59·7, 43·0, 46·2 and 36·4%, respectively. To investigate whether HFV Env and FFV Gag proteins can assemble together, we constructed an HFV Env (Tas) chimeric clone. The infectious clone of HFV-N (pHS007) has been described previously (Adachi et al., 1995Down ). DNA representing the full-length env and a part of bel I of HFV-N (3229 bp) was amplified by PCR using primers 5' aaatgaataaagcgcatgagg 3' (nt 7185–7205) and 5' taaaacagtcagggtcagtatc 3' (nt 10444–10465). The amplified fragment was inserted into the SalI and MroI double-digested pSKY3.0 after blunting the ends (HFFV, pSKY4.0; accession no. AB052798) (Fig. 1ADown). The fragment representing the HFV env and a part of bel I was substituted for the equivalent region of FFV (aa 1–129 of HFV Tas, I was converted to T at aa 130, and fused with aa 131–209 of FFV Tas) (Fig. 1ADown). FV plasmid DNA (20 µg/ml) was transfected into FFV or HFV permissive cells (5x106) using 5 µg of lipofectin (Gibco) in the presence of 10-5 M of trichostatin A (TA), as described previously (Hatama et al., 2001Down ). Cells (1x105) were infected with 0·1 ml of the cell-free supernatants and cultured with 1 ml of complete medium. CRFK cells infected with either the Coleman strain of FFV or SKY3.0 showed cytocidal effects with the formation of large syncytia (Fig. 1BDown b, c).. HFV-N as well as SKY4.0 also produced marked cytopathic effects (CPE) in BHK-21 cells (Fig. 1BDown e, f). A non-cytopathic, persistent infection was established following four passages of SKY3.0- or SKY4.0-infected cells with uninfected cells. SKY3.0 and SKY4.0 DNAs were detected by PCR in the persistently infected cells, as well as in acutely infected CRFK and BHK-21 cells (data not shown). These data indicate that the cloned FFV and HFFV DNAs can persist in the cells after repeated passage. Transfection of pCR2.1 as a negative control did not produce CPE in CRFK or BHK-21 (Fig. 1BDown a, d).. The virus titre was measured daily for 7 days using a CPE assay with end-points reported as TCID50 (Ikeda et al., 1997Down ). Cell-free supernatants from pSKY3.0-, pSKY4.0- and pSKY5.0-transfected CRFK cells yielded approximately 102 TCID50 after 30 h. After infection with supernatants from transfected cells, titres of SKY3.0 and -5.0 parental viruses at day 3 were 106 and 103 TCID50/ml, respectively (Fig. 1CDown).. Titres of SKY1.0 plus SKY2.0 viruses were lower (approximately 103 at day 4) than when full-length recombinant clones were used. The titre of SKY4.0 recombinant virus (HFFV) was approximately 105 TCID50/ml at day 3 (Fig. 1CDown)..




View larger version (55K):
[in this window]
[in a new window]
 
Fig. 1. (A) Insertion of the HFV env and a part of the bel I genes into the FFV genome. The full-length FFV Coleman clone (pSKY3.0) was constructed from clones pSKY1.0 (5'-half) and pSKY2.0 (3'-half). The entire env region from an infectious HFV-N clone was amplified by PCR. The chimeric FFV with HFV env plasmid (pSKY4.0) was constructed by inserting an approximately 3·2 kbp fragment (env and a part of bel I) from pHFV-N into the SalI (nt 6394)–MroI (nt 9622) blunted site of pSKY3.0. The predicted initiation and termination sites of the env and bel I ORFs, and both sites of the insert are depicted. Exact insertion points are represented by arrows in the nucleic acid sequences. Amino acid residues and numbers are also shown. IP, internal promoter. (B) Morphological alteration of cells infected with chimeric virus. Typical syncytia were formed in CRFK cells infected with FFV Coleman strain (b) and SKY3.0 (c), and BHK-21 cells infected with HFV-N (e) and SKY4.0 (f). The respective mock-infected cells are shown in (a) and (d). The plaque morphologies are observed at x200 magnification after staining with May–Grünwald–Giemsa. (C) Replication kinetics of parental viruses from infectious DNA clones. The FFV infectious clones, pSKY1.0 plus pSKY2.0, pSKY3.0 and pSKY5.0 were transfected into CRFK cells and the HFFV chimeric clone, pSKY4.0, was also transfected into BHK-21 cells. At 30 h post-transfection, the appropriate parental viruses were secreted into the culture supernatant and injected to the cells in the presence of TA. The culture media from the infected cells was harvested at intervals of 24 h and virus titres were determined by TCID50/ml. SKY1.0+SKY2.0 ({blacksquare}), SKY3.0 ({square}) and SKY5.0 ({bullet}) and SKY4.0 ({blacktriangleup}).

 
The CPE of FFV, HFFV and HFV-N were examined on CRFK, BHK-21, Gin-1, HeLa, HL60 and PC12 cells (Table 1Down). HFFV derived from pSKY4.0 induced syncytia formation in HFV-susceptible BHK-21 cells, but not in the Gin-1, HeLa or HL60 human, or the CRFK feline, cell lines (Table 1Down). FFV and HFV derived from pSKY3.0 and pHFV-N caused the expected syncytia formation in CRFK and BHK-21 cells. CRFK, BHK-21, Gin-1, HeLa and HL60 cells contained FFV-, HFFV- and HFV-specific gag DNA that was detectable by PCR (Table 1Down). These results indicate that the pattern of CPE produced by the chimeric viruses in various mammalian cell lines is consistent with the species of origin of the env gene, and that FV receptors are all similarly distributed on different mammalian cell lines.


View this table:
[in this window]
[in a new window]
 
Table 1. Susceptibility of cell lines to infectious foamy virus clones

 
To investigate the infectivity of the FFV (SKY3.0) and HFFV (SKY4.0) molecular clones in vivo, FVs were injected into four specific-pathogen-free male cats (cats A and B, SKY3.0; cats C and D, SKY4.0). Cats were infected by the intraperitoneal route with 104·5 TCID50 of FFV from supernatants of infected cells and sera were obtained at 30 days post-infection. Antibodies against FFV and HFFV were detected in the FV-infected cats by immunoblotting (Otake et al., 1994Down ). Serum from SKY3.0-infected cat B was used to probe lysates of Coleman strain- or SKY3.0-infected CRFK cells and SKY4.0- or HFV-N-infected BHK-21 cells (Fig. 2ADown). Bands of the 48 and 53 kDa Gag proteins were observed in infected cells, but not in mock-infected or HFV-N-infected cells (Fig. 2ADown). Serum from mock-infected cat #1 did not react with the Gag proteins (Fig. 2ADown). Similar results were obtained using sera from cats A, C and D (data not shown). His-tagged Gag protein was expressed in E. coli and also used as a target antigen for immunoblotting with the cat sera. The recombinant FFV gag-expressing plasmid pFFV/01 was constructed by inserting the blunted XhoI–ScaI fragment (nt 1525–3696) into the SalI-digested and blunted pQE02 plasmid (Qiagen). The His-tagged Gag protein was extracted and purified using Ni-nitrilotriacetic acid (NTA) column chromatography (Qiagen). Sera containing anti-Gag polyclonal antibody were obtained from rabbits hyperimmunized with purified His-tagged Gag. Sera from cats B and C reacted with the 53·5 kDa recombinant Gag protein (Fig. 2BDown), while pre-immune sera were non-reactive (data not shown). Ni-NTA alkaline phosphatase conjugates and anti-Gag rabbit serum reacted with the 53·5 kDa bands (Fig. 2BDown). Serum from mock-infected cat #1 did not react with the Gag protein bands. Both pre-infection and infected sera from cats A and D, infected with SKY3.0 and SKY4.0, respectively, gave results comparable to those obtained with sera from cats B and C (data not shown). To investigate whether viral genomes were present in the peripheral blood mononuclear cells (PBMC) of infected cats, total DNA was extracted from PBMC at 30 days post-infection and analysed by nested PCR. Three pairs of primers, 5' aggacctgaaagacatg 3' (nt 1732–1748) and 5' ttgttgagatcgtccctg 3' (nt 2528–2545) for FFV gag, 5' tatgtccctaggagagg 3' (nt 8172–8188) and 5' aagcttgttagccgagg 3' (nt 8890–8906) for FFV env and 5' tgaagaaaatcctcgacgcc 3' (nt 9416–9435) and 5' ttgacgtttgcttcggcatg 3' (nt 9727–9746) for chimeric bel I, were used for the first-round PCR. Three additional pairs, 5' aggacctgaaagacatg 3' (nt 1732–1748) and 5' agcggctgtagatcttcc 3' (nt 2039–2056) for FFV gag, 5' tatgtccctaggagagg 3' (nt 8172–8188) and 5' ttcccacgcactagaag 3' (nt 8384–8400) for FFV env and 5' cccacaccagaggaaatgag 3' (nt 9537–9746) and 5' ttgacgtttgcttcggcatg 3' (nt 9727–9746) for chimeric bel I, were used for the second-round PCR. FFV gag-specific DNA was detected in SKY3.0- and SKY4.0-infected cats (Fig. 2CDown). FFV env- and chimeric bel I-specific DNAs were detected only in cats infected with SKY3.0 and SKY4.0, respectively (Fig. 2CDown). The PBMCs from the negative control, mock-infected cat #1, yielded no bands, while the pSKY3.0 and pSKY4.0 positive control gave the expected FV-specific bands (Fig. 2CDown). Therefore, these results suggest that SKY3.0 and SKY4.0 are replication competent in vivo, and the viral DNA is harboured in the PBMC for at least 30 days after infection.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2. (A) Expression of Gag protein from infectious chimeric clones. The lysates of CRFK, BHK-21, Coleman strain-infected CRFK, SKY3.0-infected CRFK, SKY4.0 (HFFV)-infected BHK-21 and HFV-N-infected BHK-21 cells were analysed by SDS–PAGE. Immunoblotting was performed with SKY3.0-infected cat B serum and mock-infected cat #1 serum. (B) Expression of Gag protein in E. coli. Six histidine (x6His)-tagged Gag protein of the FFV Coleman strain was expressed in E. coli. The x6His-Gag protein was purified by NTA column chromatography, subjected to SDS–PAGE and transferred electrophoretically to membranes. The membranes were immunostained with mock-infected cat #1 serum, alkaline phosphatase-labelled Ni-NTA, the serum from x6His-tagged Gag protein-immunized rabbits, SKY3.0-infected cat B serum and SKY4.0-infected cat C serum. The molecular mass of the expressed protein is shown to the left. (C) Infectivity of the chimeric virus clone in vivo. In order to detect FV-specific DNA from infected cats, total DNA was isolated from PBMC of SKY3.0-infected cat B and SKY4.0-infected cat C at 30 days post-infection. Three sets of primers were designed for the FFV gag, env and HFV bel I plus FFV bel I regions and nested PCR was performed. Mock-infected cat #1 was the negative control and pSKY3.0 or pSKY4.0 DNAs were positive controls. For FFV-specific gag and env sequences, 230 bp and 325 bp were amplified, respectively. For the chimeric bel I sequence, 209 bp were amplified.

 
Our data suggested the feasibility of using chimeric FFV genomes to produce replication-competent FFV particles. Low titres of cell-free, secreted FV are a practical disadvantage for exploitation of FV clones as vectors (Zemba et al., 2000Down ). The use of TA as a supplement in the transfection procedure (Hatama et al., 2001Down ), along with the use of CRFK cells containing {beta}-gal reporter plasmids as a sensitive detector system (Yu & Linial, 1993Down ), gives extracellular titres of approximately 108 f.f.u./ml. The titres may be greater than those obtained previously for HFV by Yu & Linial (1993)Down . The functional domains of HFV Tas, the promoter-targeting domain, the nuclear localization signal and the transcription activation domain, have been reported to be located within the central and carboxyl-terminal region of the Tas protein (He et al., 1996Down ). The chimeric Tas of HFFV contains aa 1–129 from the amino-terminal region of HFV Tas and aa 131–209 from the carboxyl-terminal region of FFV Tas. Although amino acid sequence similarity was low between HFV and FFV Tas, the chimeric tas gene was functional in generating a viral protein which is able to activate the FFV promoter. These results indicate that the major functional domains of the chimeric Tas are probably localized in the central to carboxyl-terminal region. Thus, HFFV is likely to be a very useful tool for a DNA delivery system. In previous studies, attempts to pseudotype HFV using Env from other retroviruses did not result in secretion of particles (Lindemann et al., 1997Down ; Pietschmann et al., 1999Down ). However, we found that the HFFV chimera can produce progeny viruses. Thus, it is suggested that HFV Env can interact with the FFV Gag protein to give a productive replication cycle. Although several cell lines are susceptible to HFV in vitro (Hooks & Gibbs, 1975Down ), our results indicate that HFV- (Russell et al., 1996Down ) as well as FFV-based vectors may be suitable for gene transfer.


   Acknowledgments
 
This work was supported in part by a Grant-in-Aid from the Program for Promotion of Basic Research Activities for Innovative Bioscience, Japan.


   References
TOP
Abstract
Main text
References
 
Adachi, A., Sakai, H., Tokunaga, K. & Kawamura, M. (1995). Functional analysis of human spuma retrovirus genome. Virus Genes 11, 15-20.[Medline]

Hatama, S., Otake, K., Ohta, M., Kobayashi, M., Imakawa, K., Ikemoto, A., Okuyama, H., Mochizuki, M., Miyazawa, T., Tohya, Y., Fujii, Y. & Takahashi, E. (2001). Reactivation of feline foamy virus from a chronically-infected feline renal cell line by trichostatin A. Virology 283, 315-323.[Medline]

He, F., Blair, W. S., Fukushima, J. & Cullen, B. R. (1996). The human foamy virus Bel-1 transcription factor is a sequence-specific DNA binding protein. Journal of Virology 70, 3902-3908.[Abstract]

Helps, C. R. & Harbour, D. A. (1997). Comparison of the complete sequence of feline spumavirus with those of the primate spumaviruses reveals a shorter gag gene. Journal of General Virology 78, 2549-2564.[Abstract]

Hill, C. L., Bieniasz, P. D. & McClure, M. O. (1999). Properties of human foamy virus relevant to its development as a vector for gene therapy. Journal of General Virology 80, 2003-2009.[Abstract/Free Full Text]

Hooks, J. J. & Gibbs, C. J. (1975). The foamy viruses. Bacteriological Reviews 39, 169-185.[Free Full Text]

Ikeda, Y., Itagaki, S., Tsutsui, S., Inoshima, Y., Fukasawa, M., Tomonaga, K., Tohya, Y., Maeda, K., Mochizuki, M., Miyazawa, T. & Mikami, T. (1997). Replication of feline syncytial virus in feline T-lymphoblastoid cells and induction of apoptosis in the cells. Microbiology and Immunology 41, 431-435.[Medline]

Lindemann, D., Bock, M., Schweizer, M. & Rethwilm, A. (1997). Efficient pseudotyping of murine leukemia virus particles with chimeric human foamy virus envelope proteins. Journal of Virology 71, 4815-4820.[Abstract]

Linial, M. L. (1999). Foamy viruses are unconventional retroviruses. Journal of Virology 73, 1747-1755.[Free Full Text]

Löchelt, M., Zentgraf, H. & Flügel, R. M. (1991). Construction of an infectious DNA clone of the full-length human spumaretrovirus genome and mutagenesis of the bel 1 gene. Virology 184, 43-54.[Medline]

Otake, K., Fujii, Y., Nakaya, T., Nishino, Y., Zhong, Q., Fujinaga, K., Kameoka, M., Ohki, K. & Ikuta, K. (1994). The carboxyl-terminal region of HIV-1 Nef protein is a cell surface domain that can interact with CD4+ T cells. Journal of Immunology 153, 5826-5837.[Abstract]

Pietschmann, T., Heinkelein, M., Heldmann, M., Zentgraf, H., Rethwilm, A. & Lindemann, D. (1999). Foamy virus capsids require the cognate envelope protein for particle export. Journal of Virology 73, 2613-2621.[Abstract/Free Full Text]

Russell, D. W. & Miller, A. D. (1996). Foamy virus vectors. Journal of Virology 70, 217-222.[Abstract]

Winkler, I., Bodem, J., Haas, L., Zemba, M., Delius, H., Flower, R., Flügel, R. M. & Löchelt, M. (1997). Characterization of the genome of feline foamy virus and its proteins shows distinct features different from those of primate spumaviruses. Journal of Virology 71, 6727-6741.[Abstract]

Yu, S. J. & Linial, M. L. (1993). Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay. Journal of Virology 67, 6618-6624.[Abstract/Free Full Text]

Yu, S. F., Baldwin, D. N., Gwynn, S. R., Yendapalli, S. & Linial, M. L. (1996). Human foamy virus replication – a pathway distinct from that of retroviruses and hepadnaviruses. Science 271, 1579-1582.[Abstract]

Zemba, M., Alke, A., Bodem, J., Winkler, I. G., Flower, R. L. P., Pfrepper, K.-I., Delius, H., Flügel, R. M. & Löchelt, M. (2000). Construction of infectious feline foamy virus genome: cat antisera do not cross-neutralize feline foamy virus chimera with serotype-specific Env sequences. Virology 266, 150-156.[Medline]

Received 25 June 2001; accepted 5 September 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
S. Omoto and Y. R. Fujii
Regulation of human immunodeficiency virus 1 transcription by nef microRNA
J. Gen. Virol., March 1, 2005; 86(3): 751 - 755.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Omoto, E. A. Brisibe, H. Okuyama, and Y. R. Fujii
Feline foamy virus Tas protein is a DNA-binding transactivator
J. Gen. Virol., October 1, 2004; 85(10): 2931 - 2935.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hatama, S.
Right arrow Articles by Fujii, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hatama, S.
Right arrow Articles by Fujii, Y.
Agricola
Right arrow Articles by Hatama, S.
Right arrow Articles by Fujii, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS