J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Franti, M.
Right arrow Articles by Agut, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Franti, M.
Right arrow Articles by Agut, H.
Agricola
Right arrow Articles by Franti, M.
Right arrow Articles by Agut, H.
Journal of General Virology (2001), 82, 3045-3050.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Genetic polymorphism of human herpesvirus-7 among human populations

Michael Franti1, Antoine Gessain2, Pierre Darlu3, Agnès Gautheret-Dejean1, Haruhiko Kosuge1, Philippe Mauclère4, Jean-Thierry Aubin1, Vladimir Gurtsevitch5, Koichi Yamanishi6 and Henri Agut1

Laboratoire de Virologie, CERVI, UPRES EA 2387, Hôpital Pitié-Salpétrière, 83 bld de l’Hôpital, 75651 Paris cedex 13, France1
Unité d’Epidémiologie et de physiopathologie des virus oncogènes, Institut Pasteur, 75724 Paris cedex 15, France2
Génétique épidémiologique et structure des populations humaines, INSERM U535, 94276 Kremlin Bicêtre cedex, France3
Centre Pasteur du Cameroun, BP 1274, Yaoundé, Cameroon4
Cancer Research Center, RAMS, Kashirskaya 24, 115478, Moscow, Russia5
Department of Microbiology, Osaka University Medical School, Suita, Osaka, Japan6

Author for correspondence: Henri Agut. Fax +33 1 42 17 74 11. e-mail henri.agut{at}psl.ap-hop-paris.fr


   Abstract
TOP
Abstract
Main text
References
 
The analysis of three human herpesvirus-7 (HHV-7) genes encoding phosphoprotein p100, glycoprotein B and major capsid protein respectively had previously shown the existence of distinct gene alleles, leading to the concept of HHV-7 variants. We have analysed the distribution of HHV-7 variants among 297 distinct subjects who belonged to different human populations from Africa, Asia, Europe and America. Two variants, designated Co1 and Co2, were found in 52% and 20% of studied subjects. Ten other variants, designated Co3–Co12, were less frequent and classified into two groups related to Co1 and Co2 respectively. While the former group was ubiquitous and the most frequent in Africa and Asia, the latter one was predominantly found in European and Mongol populations. Despite the high stability of the HHV-7 genome, a few nucleotide substitutions at precise positions define distinct variants which, to some extent, behave as markers of human populations.


   Main text
TOP
Abstract
Main text
References
 
Human herpesvirus-7 (HHV-7) is a member of the Betaherpesvirinae subfamily and is closely related to human herpesvirus-6 (HHV-6) (Berneman et al., 1992Down ; Frenkel et al., 1990Down ). HHV-7 infection is widespread in the human population, with an overall prevalence exceeding 90% and frequent detection of virus in body fluids (Black & Pellett, 1999Down ; Gautheret-Dejean et al., 1997Down ; Wyatt & Frenkel, 1992Down ). To date, HHV-7 does not appear to be a major pathogen, although its role has been discussed in some human diseases, such as exanthem subitum (Black & Pellett, 1999Down ; Tanaka et al., 1994Down ).

The complete genomic characterization of two different HHV-7 strains (Megaw et al., 1998Down ; Nicholas, 1996Down ) as well as the partial nucleotide sequencing of others (Franti et al., 1998Down ; Poirel et al., 1997Down ) indicated a very high degree of homology between these strains. Despite the overall high conservation of HHV-7 DNA, critical point changes allowed us to describe distinct alleles of the glycoprotein B (gB), phosphoprotein p100 and major capsid protein (MCP) genes. Two combinations of p100, gB and MCP alleles, designated Co1 and Co2, were tentatively interpreted as the genetic signatures of two major HHV-7 variants (Franti et al., 1998Down , 1999Down ). Starting with preliminary data about the frequency of distinct gB alleles in African, Caribbean and European subjects (Franti et al., 1998Down ), the hypothesis was made that HHV-7 variants were differently distributed according to the geographical origin of the populations studied.

To explore this hypothesis, we undertook a large study including subjects from different parts of the world. Peripheral blood mononuclear cells (PBMC) were obtained from 297 different individuals, some of them having been previously studied with regard to the epidemiology of human T-cell leukaemia virus type 1 (HTLV-1) infection (Biglione et al., 1999Down ; Gessain et al., 1995Down ; Ureta-Vidal et al., 1999Down ). These subjects were classified into four continental groups and nine populations subgroups according to their birthplaces. The African group (n=65) included a Bakola Pygmy population from Cameroon (n=13), and a Bantu population from Cameroon (n=44) and Zaire (n=8). The Asian group (n=100) included a South Asian population (n=13) recruited from a very large heterogeneous area including China (n=9), Vietnam (n=1), Sri Lanka (n=2) and Polynesia (n=1), a Japanese population from Osaka and Kagoshima (n=47), and a Mongol population (n=40) from Irkutsk (Siberia). Both Pygmy and Mongol subjects belonged to isolated groups thought to be aboriginal populations. The European group (n=64) consisted of Caucasian French subjects. The American group (n=68) consisted of three populations: subjects from French West Indies (n=18), Noir-marron subjects (n=40) from French Guiana and South Amerindians (n=10) from Argentina. The nested PCR amplification and characterization of HHV-7 genes from PBMC DNA were carried out as previously reported (Franti et al., 1998Down , 1999Down ), except that, in the case of the p100 gene, the previously described p100.4 inner primer was replaced by p100.6 (5' GTAGAAGGAACGATCTTCCTT 3') located at position 16437–16457 of reference strain JI DNA (Nicholas, 1996Down ). The risk of cross-contamination during amplification was kept under control by specific measures: strict separation of the different steps of PCR analysis, an absolute requirement for the negativity of blank reactions and negative controls, repeated testing of coded samples in independent assays.

The three DNA amplicons, related to p100, gB and MCP genes, were 463, 2491 and 351 bp long respectively. They were analysed by both endonuclease restriction and nucleotide sequencing focused on the characterization of the critical positions highlighted in Table 1Down. The AAT to GAT substitution at codon position 721 of the p100 gene induces an additional MboII cleavage site. Codon ATC at position 763 of the MCP gene also induces an MboII site, while codon ATA at the same position induces an SspI site. Codon ACA at position 774 of the MCP gene induces a MunI site. The GTG codon at position 119 and codon GGG at position 220 of the gB gene correspond to ApaI and BstEII sites respectively. The three other polymorphic sites at the codons 137, 185 and 406 of the gB gene were accessible to nucleotide sequencing only. Except for the AAT to GAT substitution at codon 721 of p100, which induces an aspartic acid to asparagine change, all other nucleotide modifications supporting the definition of HHV-7 alleles were silent at the protein level as previously noted (Franti et al., 1998Down , 1999Down ).


View this table:
[in this window]
[in a new window]
 
Table 1. Nucleotide sequence variability of the different gene alleles and allele combinations

 
Using that strategy, allele characterization was obtained for 216 (73%), 179 (60%) and 190 (64%) out of the 297 PBMC DNA samples tested, in the case of p100, gB and MCP genes respectively (data according to population groups not shown). The lack of characterization for 27%, 40% and 36% of samples respectively was related either to the absence of any detectable amplified product or an insufficient amount of this product for further analysis. As expected, the longer the amplicon the lower the efficiency of nested PCR. Both the alleles D of gB and B of MCP were poorly represented in our study with only 3 (2% of gB alleles) and 5 (3% of MCP alleles) representative samples. Furthermore, the geographical distribution of major alleles, i.e. A and B of p100, C and F of gB, A and C of MCP, significantly differed according to continental groups and populations (P<0·0001, using the {chi}2 test or Fishers’s exact test as appropriate). As an example, allele B of p100 was found in 100% of samples from Pygmy and Japanese populations, while allele A of the same gene was predominant among Mongols (65%) and Caucasian Europeans (75%). In agreement with our previous preliminary findings, allele C of gB was quite predominant in African populations (100%) and Caribbean populations of African origin (French West Indies, French Guiana) (98%) while allele F was predominant among Caucasian Europeans (86%).

In the case of 177 samples among the 297 tested (60%), the alleles of the three genes p100, gB and MCP were identified concomitantly, which permitted us to determine the corresponding combinations according to their genetic definition (Table 1Up). Twelve different combinations, designated Co1–Co12, were found. As in the previous preliminary study (Franti et al., 1999Down ), Co1 and Co2 were the most frequent combinations, with overall detection rates of 52% and 20% respectively (Table 2Down). No other combination exceeded 10% of the samples tested. The phylogenetic relationship between the different combinations was investigated using a parsimony approach (PAUP 4.0, D. L. Swofford, Sinauer associates, Sunderland, MA, USA) and a median network analysis (Bandelt et al., 1999Down ) in the NETWORK software (v2.0b) (http://www.fluxus-engineering.com). Due to the low number of critical point mutations, no recombination event between the three genes could be hypothesized and further considered. In total, 102 distinct phylogenetic trees exhibiting the same parsimony rate were constructed, indicating that many different evolution profiles could explain the present distribution of HHV-7 allele combinations. However, two major groups emerged, as illustrated by network representation (Fig. 1Down), and were aggregated around Co1 and Co2 respectively. The first one, surrounding Co1 and designated group 1, included Co4, Co5, Co6, Co8, Co9 and Co11. The second one, surrounding Co2 and designated group 2, included Co3, Co7, Co10 and Co12. Group 1 was predominant in Asia, Africa and American populations of African origin and was also present, albeit at a lower frequency, in European and Mongol populations. Conversely, group 2 was predominant in European and Mongol populations but almost completely absent in the populations of African origin. The differences of variant distribution between population groups were confirmed using the analysis of molecular variance model (AMOVA) (Excoffier et al., 1992Down ) implemented in the ARLEQUIN software (version 1.1) (http://anthropologie.unige.ch/arlequin) after withdrawal of the American group due to the presence of recently imported populations of African origin. There was a significant difference between the group consisting of European and Mongol populations on one hand, and that consisting of the other Asian and African populations on the other hand (P=0·04). The nonrandom geographical distribution of the different variants confirmed that HHV-7 may behave as a marker of human populations. Each of the two groups of HHV-7 variants was detected in aboriginal populations such as Pygmies for group 1 and Mongols for group 2, indicating the stable long-standing character of this distribution.


View this table:
[in this window]
[in a new window]
 
Table 2. Distribution of allele combinations according to the geographical origin

 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic relationship between the distinct HHV-7 allele combinations. In this network representation, the close circles represent the different combinations with a size proportional to their detection frequency resulting from the analysis of 177 HHV-7-positive samples as shown in Table 2Down. The numbers on the joining lines refer to the crucial nucleotide changes depicted in Table 1Up.

 
Taken together, these results confirmed that the nucleotide sequence of many distinct HHV-7 strains is highly conserved, supporting the idea of a stable propagation of this virus among human populations. The nucleotide sequences surrounding the crucial nucleotide positions, in particular within the gB gene, which has been extensively studied, remain essentially unchanged from one individual to another (not shown). Conversely, the limited nucleotide changes depicted in Table 1Up have allowed us to classify unambiguously the different HHV-7 strains into two distinct variant groups. One may wonder whether this classification results from biases related to the strategy of HHV-7 allele characterization. Indeed, the amplification of viral sequences from PBMC DNA was highly dependent on the viraemia level and overall PCR efficacy. Although the seroprevalence of HHV-7 infection is assumed to exceed 90% in the adult population, the rate of HHV-7 PCR positivity was lower, ranging from 50 up to 70% approximately when starting from 1 µg of PBMC DNA, as observed in our previous studies (Franti et al., 1998Down ). If by chance, one HHV-7 variant was characterized by frequent virus loads under the threshold of PCR detection, the rate of HHV-7 infection could be underestimated in this case. In particular, this point might concern some alleles infrequently detected in our study, such as alleles D of gB and B of MCP. However, the determination of the variant formula was possible in the majority of cases (60%), which fit the expected high prevalence of HHV-7 infection within this group. Moreover, the successful amplification of any of the three genes was linked to a successful amplification of the two others, independent of allele definition. This confirms the major influence of load and/or quality of DNA rather than allele identity in the characterization of HHV-7 variants.

The definition of HHV-7 alleles is based on a low number of crucial nucleotides, which might be considered to be a major limitation of the study. However the reproducibility of variation repertoire at these positions in the present study and previous ones (Franti et al., 1998Down , 1999Down ) unambiguously distinguishes these nucleotide changes from strain-specific polymorphisms which probably exist concomitantly in the HHV-7 genome, as suggested by other authors (Wyatt & Frenkel, 1992Down ). In theory, this makes possible the use of HHV-7 alleles as genetic markers of human populations. On the other hand, the limited number of relevant positions precludes any interpretation about the mechanism of genetic HHV-7 evolution which might involve point mutations, interallelic recombination or both. This low number may also lead us to consider an unexpected genetic proximity between the HHV-7 strains of two distant populations, such as Japanese and Pygmies as well as Mongols and Europeans. It is possible that this apparently close relationship will disappear when areas of higher variability, if such regions exist in the HHV-7 genome, are investigated and reveal local patterns of genetic evolution. As an example, the original studies on human herpesvirus-8 (HHV-8) variability, focused on very conserved small fragments of two genes, led to an initial classification of HHV-8 strains into three subtypes (Zong et al., 1997Down ). More recent studies exploiting the significantly higher genetic variability of another gene, K1, led to a different segregation into at least four major subtypes, which was strongly supported by phylogenetic and epidemiological studies (Lacoste et al., 2000Down ; Poole et al., 1999Down ; Zong et al., 1999Down ). Conversely, the human retrovirus HTLV-1 exhibits a remarkably high genetic stability, explained by virus amplification via clonal expansion of infected cells rather than reverse transcription. The few nucleotide substitutions observed among different HTLV-1 strains have permitted us to understand not only virus transmission but also recent or ancient movements of human populations throughout the world (Biglione et al., 1999Down ; Gessain et al., 1995Down ; Ureta-Vidal et al., 1999Down ). To date, attempts to find areas of higher variability in the HHV-7 genome have been unsuccessful, at least in our hands, in particular when studying the glycoprotein L gene (Franti et al., 1999Down ) and the U89–U90 genes (unpublished results). A notable exception is the previously known variability of genomic termini, also reported for HHV-6 (Dominguez et al., 1999Down ; Isegawa et al., 1999Down ; Wyatt & Frenkel, 1992Down ), which is believed to reflect mainly strain-to-strain variations rather than stable differential genetic profiles.

In that sense, it would be very interesting now to compare, within the same populations, the general distribution of HHV-7 variants to those of HHV-8, HTLV-1 and JC virus, a human papovavirus also used as a marker of human groups (Agostini et al., 1997Down ). With the present state of knowledge, group 1 of the HHV-7 variants appears to be ubiquitous and more widely spread than group 2. However, the prevalence of group 2 both in Europeans and Mongols is intriguing. It would be tempting to revisit this particular distribution in the search for either local virus evolution related to population migration or specific host factors leading to the long-standing selection of pre-existing virus strains.


   Acknowledgments
 
This work was supported in part by the Association Claude Bernard, the Action Concertée Coordonnée des Sciences du Vivant of the French Ministry of Research, and MRTC no. 97-5-12172 research grant to Michael Franti. Haruhiko Kosuge was supported by a grant from Japan Herpesvirus Infections Forum.


   References
TOP
Abstract
Main text
References
 
Agostini, H. T., Yanagihara, R., Davis, V., Ryschkewitsch, C. F. & Stoner, G. L. (1997). Asian genotypes of JC virus in Native Americans and in a Pacific Island population: markers of viral evolution and human migration. Proceedings of the National Academy of Sciences, USA 94, 14542-14546.[Abstract/Free Full Text]

Bandelt, H. J., Forster, P. & Rohl, A. (1999). Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16, 37-48.[Abstract]

Berneman, Z. N., Ablashi, D. V., Li, G., Eger-Fletcher, M., Reitz, M. S., Hung, C. L., Brus, I., Komaroff, A. L. & Gallo, R. C. (1992). Human herpesvirus 7 is a T-lymphotropic virus and is related to, but significantly different from, human herpesvirus 6 and human cytomegalovirus. Proceedings of the National Academy of Sciences, USA 89, 10552-10556.[Abstract/Free Full Text]

Biglione, M., Vidan, O., Mahieux, R., de Colombo, M., de los Angeles de Basualdo, M., Bonnet, M., Pankow, G., De Efron, M. A., Zorrilla, A., Tekaia, F., Murphy, E., de The, G. & Gessain, A. (1999). Seroepidemiological and molecular studies of human T cell lymphotropic virus type II, subtype b, in isolated groups of Mataco and Toba Indians of northern Argentina. AIDS Research and Human Retroviruses 15, 407-417.[Medline]

Black, J. B. & Pellett, P. E. (1999). Human herpesvirus 7. Reviews in Medical Virology 9, 245-262.[Medline]

Dominguez, G., Dambaugh, T. R., Stamey, F. R., Dewhurst, S., Inoue, N. & Pellett, P. E. (1999). Human herpesvirus 6B genome sequence: coding content and comparison with human herpesvirus 6A. Journal of Virology 73, 8040-8052.[Abstract/Free Full Text]

Excoffier, L., Smouse, P. E. & Quattro, J. M. (1992). Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131, 479-491.[Abstract]

Franti, M., Aubin, J. T., Poirel, L., Gautheret-Dejean, A., Candotti, D., Huraux, J. M. & Agut, H. (1998). Definition and distribution analysis of glycoprotein B gene alleles of human herpesvirus 7. Journal of Virology 72, 8725-8730.[Abstract/Free Full Text]

Franti, M., Aubin, J. T., Gautheret-Dejean, A., Malet, I., Cahour, A., Huraux, J. M. & Agut, H. (1999). Preferential associations of alleles of three distinct genes argue for the existence of two prototype variants of human herpesvirus 7. Journal of Virology 73, 9655-9658.[Abstract/Free Full Text]

Frenkel, N., Schirmer, E. C., Wyatt, L. S., Katsafanas, G., Roffman, E., Danovich, R. M. & June, C. H. (1990). Isolation of a new herpesvirus from human CD4+ T cells. Proceedings of the National Academy of Sciences, USA 87, 748-752.[Abstract/Free Full Text]

Gautheret-Dejean, A., Aubin, J. T., Poirel, L., Huraux, J. M., Nicolas, J. C., Rozenbaum, W. & Agut, H. (1997). Detection of human Betaherpesvirinae in saliva and urine from immunocompromised and immunocompetent subjects. Journal of Clinical Microbiology 35, 1600-1603.[Abstract]

Gessain, A., Mauclere, P., Froment, A., Biglione, M., Le Hesran, J. Y., Tekaia, F., Millan, J. & de The, G. (1995). Isolation and molecular characterization of a human T-cell lymphotropic virus type II (HTLV-II), subtype B, from a healthy Pygmy living in a remote area of Cameroon: an ancient origin for HTLV-II in Africa. Proceedings of the National Academy of Sciences, USA 92, 4041-4045.[Abstract/Free Full Text]

Isegawa, Y., Mukai, T., Nakano, K., Kagawa, M., Chen, J., Mori, Y., Sunagawa, T., Kawanishi, K., Sashihara, J., Hata, A., Zou, P., Kosuge, H. & Yamanishi, K. (1999). Comparison of the complete DNA sequences of human herpesvirus 6 variants A and B. Journal of Virology 73, 8053-8063.[Abstract/Free Full Text]

Lacoste, V., Kadyrova, E., Chistiakova, I., Gurtsevitch, V., Judde, J.-G. & Gessain, A. (2000). Molecular characterization of Kaposi’s sarcoma-associated herpesvirus/human herpesvirus-8 strains from Russia. Journal of General Virology 81, 1217-1222.[Abstract/Free Full Text]

Megaw, A. G., Rapaport, D., Avidor, B., Frenkel, N. & Davison, A. J. (1998). The DNA sequence of the RK strain of human herpesvirus 7. Virology 244, 119-132.[Medline]

Nicholas, J. (1996). Determination and analysis of the complete nucleotide sequence of human herpesvirus. Journal of Virology 70, 5975-5989.[Abstract]

Poirel, L., Aubin, J. T., Gautheret, A., Malet, I., Huraux, J. M. & Agut, H. (1997). Use of inverse polymerase chain reaction to characterize a novel human herpesvirus 7 isolate. Journal of Virological Methods 64, 197-203.[Medline]

Poole, L. J., Zong, J. C., Ciufo, D. M., Alcendor, D. J., Cannon, J. S., Ambinder, R., Orenstein, J. M., Reitz, M. S. & Hayward, G. S. (1999). Comparison of genetic variability at multiple loci across the genomes of the major subtypes of Kaposi’s sarcoma-associated herpesvirus reveals evidence for recombination and for two distinct types of open reading frame K15 alleles at the right-hand end. Journal of Virology 73, 6646-6660.[Abstract/Free Full Text]

Tanaka, K., Kondo, T., Torigoe, S., Okada, S., Mukai, T. & Yamanishi, K. (1994). Human herpesvirus 7: another causal agent for roseola (exanthem subitum). Journal of Pediatrics 125, 1-5.[Medline]

Ureta-Vidal, A., Angelin-Duclos, C., Tortevoye, P., Murphy, E., Lepere, J. F., Buigues, R. P., Jolly, N., Joubert, M., Carles, G., Pouliquen, J. F., de The, G., Moreau, J. P. & Gessain, A. (1999). Mother-to-child transmission of human T-cell-leukemia/lymphoma virus type I: implication of high antiviral antibody titer and high proviral load in carrier mothers. International Journal of Cancer 82, 832-836.

Wyatt, L. S. & Frenkel, N. (1992). Human herpesvirus 7 is a constitutive inhabitant of adult human saliva. Journal of Virology 66, 3206-3209.[Abstract/Free Full Text]

Zong, J. C., Metroka, C., Reitz, M. S., Nicholas, J. & Hayward, G. S. (1997). Strain variability among Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genomes: evidence that a large cohort of United States AIDS patients may have been infected by a single common isolate. Journal of Virology 71, 2505-2511.[Abstract]

Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S. (1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposi’s sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.[Abstract/Free Full Text]

Received 1 May 2001; accepted 22 August 2001.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Franti, M.
Right arrow Articles by Agut, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Franti, M.
Right arrow Articles by Agut, H.
Agricola
Right arrow Articles by Franti, M.
Right arrow Articles by Agut, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS