J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCann, E. M.
Right arrow Articles by Bell, A. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCann, E. M.
Right arrow Articles by Bell, A. I.
Agricola
Right arrow Articles by McCann, E. M.
Right arrow Articles by Bell, A. I.
Journal of General Virology (2001), 82, 3067-3079.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Genetic analysis of the Epstein–Barr virus-coded leader protein EBNA-LP as a co-activator of EBNA2 function

Eamon M. McCann1, Gemma L. Kelly1, Alan B. Rickinson1 and Andrew I. Bell1

CRC Institute for Cancer Studies, The University of Birmingham, Edgbaston, Birmingham B15 2TA, UK1

Author for correspondence: Andrew I. Bell. Fax +44 121 4486. e-mail a.i.bell{at}bham.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Co-operation between the Epstein–Barr virus (EBV)-coded leader protein EBNA-LP and the nuclear antigen EBNA2 appears to be critical for efficient virus-induced B cell transformation. Here we report the genetic analysis of EBNA-LP function using two transient co-transfection assays of co-operativity, activation of latent membrane protein 1 (LMP1) expression from a resident EBV genome in Akata-BL cells and activation of an EBNA2-responsive reporter construct. Small deletions were introduced into each of five conserved regions (CRs) of EBNA-LP sequence present in type 1 and type 2 EBV strains and in several primate lymphocryptovirus EBNA-LP homologues. Deletions within all three CRs in the EBNA-LP W1W2 repeat domain completely abrogated function, through inhibition of nuclear localization in the cases of CR1 and CR2 but not of CR3; deletions within CR4 and CR5 in the Y1Y2 unique domain had relatively little effect, yet loss of the whole Y2 sequence blocked activity. Alanine substitution of serine residues within potential phosphorylation sites identified two mutants of particular interest. Substitution of three such residues (S34,36,63) within W1W2 not only abrogated EBNA-LP activity but was associated with a complete loss of EBNA2 detectability in co-transfected cells, implying possible destabilization of the co-expressed EBNA2 protein. More importantly the individual substitution of S36 completely blocked EBNA-LP/EBNA2 co-operativity while retaining EBNA2 expression. We infer critical roles for the CR3 domain and for the S36 residue in EBNA-LP’s co-operative function.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr Virus (EBV), a human lymphocryptovirus (LCV), transforms resting human B cells into permanent lymphoblastoid cell lines (LCLs) constitutively expressing six viral nuclear antigens, EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C and EBNA-leader protein (EBNA-LP), and three latent membrane proteins, LMP1, LMP2A and LMP2B (Kieff, 1996Down ). From work with EBV recombinants, at least five of these proteins, EBNA1, EBNA2, EBNA3A, EBNA3C and LMP1, are essential for the transformation process and a sixth, EBNA-LP, is essential for optimal transforming activity (Cohen et al., 1989Down ; Hammerschmidt & Sugden, 1989Down ; Mannick et al., 1991Down ; Tomkinson et al., 1993Down ; Lee et al., 1999Down ). EBNA1 is principally required for virus genome maintenance whereas the other EBNAs act as transcriptional regulators. In particular, EBNA2 transactivates the viral BamHI C (Cp) and LMP promoters (Sung et al., 1991Down ; Zimber-Strobl et al., 1991Down ; Laux et al., 1994bDown ) as well as key B cell growth-related cellular genes such as CD21, CD23, c-fgr and c-myc (Cordier et al., 1990Down ; Knutson, 1990Down ; Kaiser et al., 1999Down ). These activities are mediated via EBNA2’s interaction with sequence-specific DNA binding proteins such as RBP-J{kappa} and PU.1 (Zimber-Strobl et al., 1994Down ; Henkel et al., 1994Down ; Grossman et al., 1994Down ; Laux et al., 1994aDown ); indeed, competition for RBP-J{kappa} binding appears to underlie the ability of EBNA3A and EBNA3C to act as regulators of EBNA2 function (Robertson et al., 1995Down ; Zhao et al., 1996Down ). The LMP1 protein, whose expression in freshly infected B cells is dependent upon EBNA2 (Wang et al., 1990Down ; Abbot et al., 1990Down ), has intrinsic transforming activity, mediating numerous cellular phenotypic changes at least in part by mimicking the function of a constitutively activated TNF receptor family member, CD40 (reviewed in Young et al., 2000Down ).

In contrast to the above, relatively little is known about the function or mechanism of action of EBNA-LP. However, this protein is clearly important since viral recombinants incapable of expressing full-length EBNA-LP show grossly impaired transforming activity, giving rise to small numbers of foci which are extremely difficult to expand to permanent cell lines (Hammerschmidt & Sugden, 1989Down ; Mannick et al., 1991Down ). EBNA-LP contains multiple copies of an N-terminal 66-amino-acid repeat domain encoded by two exons (W1 and W2) found within each of the BamHI W repeats, and a unique C-terminal 45-amino-acid domain encoded by the Y1 and Y2 exons within the downstream BamHI Y fragment of the viral genome (Sample et al., 1986Down ). Interestingly, both the repeat and unique domains contain serine residues which appear to be targets of cell cycle-regulated phosphorylation (Kitay & Rowe, 1996aDown ). EBNA-LP is strongly and selectively expressed, along with EBNA2, at the initiation of the transformation process (Alfieri et al., 1991Down ; Sinclair et al., 1994Down ), and indeed has been found to co-operate with EBNA2 in activating cyclin D2 expression in resting B cells (Sinclair et al., 1994Down ) and in activating LMP1 expression in Burkitt’s lymphoma (BL) cell lines (Nitsche et al., 1997Down ). Co-operation has also been observed in reporter assays with synthetic promoters containing either LMP1/LMP2B regulatory elements or multimerized Cp sequences, where augmentation of EBNA2 transcriptional activity appeared to require only the W1W2 repeat domain of EBNA-LP (Harada & Kieff, 1997Down ).

These systems open the way for a genetic analysis of EBNA-LP co-operative function which we have pursued in the present work, focussing particular attention on sequences which are conserved between EBNA-LP and its homologues in other primate LCVs, and also on conserved serine residues which represent potentially important phosphorylation targets.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cell lines and culture.
Akata-BL and Eli-BL are BL lines carrying type 1 and type 2 EBV strains respectively; X50-7 is a reference EBV-carrying LCL, BJAB and DG75 are EBV-negative B lymphoma lines and HeLa is an EBV-negative epithelial line. Simian lines containing homologues of EBV (Rabin et al., 1980Down ; Moghaddam et al., 1998Down ) included Austin (Pongine herpesvirus 1 or herpesvirus pan – H.pan), Machi (Pongine herpesvirus 3 or herpesvirus gorilla – H.gorilla), 594S (Cercopithicine herpesvirus 12 or herpesvirus papio – H.papio) and LCL278 (Cercopithicine herpesvirus 15 or rhesus HHV-4-like virus; referred to here as herpesvirus rhesus – H.rhesus for consistency). All lines were maintained in medium (RPMI 1640 for B cell lines, Dulbecco’s modified Eagle’s medium for HeLa line) containing 10% foetal calf serum, 2 mM glutamine and 8 mg/l gentamycin.

{blacksquare} Plasmid constructs.
The EBNA2-responsive reporter plasmid (BamCp8LUC) containing eight copies of the 100 bp EBNA2 Cp enhancer, and the expression vectors for EBNA2 and for EBNA-LP (the latter with two W1W2 repeats and the unique Y1Y2 domain) have been described (Nitsche et al., 1997Down ; Peng et al., 2000aDown ); all contain sequences from the B95.8 type 1 strain.

Site-specific mutants of EBNA-LP were generated by standard methods (Kunkel et al., 1987Down ) following subcloning of the above wild-type sequence into M13 as an EcoRI–BamHI fragment. Single mutants (where necessary targeting both W repeats) were introduced using appropriate oligonucleotides. Mutants with triple substitutions (W-S34,36,63-A and W-S34,36,63-E) were created using two oligonucleotides in the same reaction, the first to substitute residues 34 and 36, and the second to substitute residue 63. Deletions {Delta}CR1 to {Delta}CR5 and {Delta}Y1 were created with oligonucleotides flanking the points of deletion whereas {Delta}Y2 was created by introducing a stop codon at the end of Y1. All mutant constructs were confirmed by sequencing, both in M13mp18 and following their subsequent subcloning into the pSG5 expression vector as EcoRI–BamHI fragments. Mutant {Delta}Y1Y2 was generated by PCR amplification from the wild-type EBNA-LP template using oligonucleotides 5' AAAAGAATTCATGGGAGACCGAAGTGAAGGCC 3', which is complementary to the initial 5' sequence of W1 and contains an in-frame ATG initiation codon (underlined), and 5' GCGAGGATCCTGGCCGTAGTTACCCTGAAGG 3', which is complementary to the terminal 3' sequence of W2 and contains an in-frame stop codon (underlined). A product of the appropriate size to contain two W1W2 repeats was gel-purified, digested with EcoRI and BamHI and cloned into pSG5. The insert sequence was confirmed by DNA sequencing.

{blacksquare} Cloning and analysis of EBNA-LP homologues.
Genomic DNA from human and simian LCV-positive LCLs was PCR amplified using oligonucleotides 5' GGGGGTCTTCTACCTCTCCCTAGCCC 3' and 5' CGGGGACGGAGGGGGCCTGAAGCCCGG 3', complementary to intronic sequences flanking the W1 and W2 exons of B95.8 (co-ordinates 14417–14442 and 15013–14987 respectively in the first W repeat) and with oligonucleotides 5' GTTAACTTTCTCCCCTTGTATTTGC 3' and 5' CCTAACAAGCGGAGGCTGGGAAAGC 3', complementary to intronic sequences flanking the Y1 and Y2 exons of B95.8 (co-ordinates 47687–47711 and 48065–48041 respectively). All PCR products of the appropriate size were gel-purified, cloned into the pGEM-T easy vector (Promega) and the nucleotide sequence was determined for at least three independent clones of each PCR product. The predicted amino acid sequences were aligned using the Pileup program of the Wisconsin Package version 10.2, Genetics Computer Group (GCG), Madison, WI, USA. Nucleotide sequences for the W1W2 and Y1Y2 protein translations presented in Fig. 3 have been deposited in the EMBL database and assigned accession numbers AJ311190, AJ311191, AJ311192, AJ311193, AJ311194, AJ311195, AJ311196, AJ311197, AJ311198 and AJ311199.

{blacksquare} Transient transfection and reporter gene assays.
B cell lines were transfected by electroporation as described (Nitsche et al., 1997Down ) using the combinations of plasmids indicated; where necessary, the total amount of DNA per transfection was equalized using empty pSG5 vector DNA. For measurement of LMP1 induction, Akata-BL cells were harvested at 48 h post-transfection and were analysed by immunoblotting. For reporter assays BJAB cells were harvested at 24 h post-transfection and luciferase activity in total cell extracts was measured as described (Bell et al., 1998Down ). For EBNA-LP immunofluorescence, HeLa cells were transfected in six-well plates with 2 µg of plasmid DNA using the FuGENE 6 lipid-based transfection reagent (Roche) according to the manufacturer’s protocol.

{blacksquare} Immunoblotting.
JF186, PE2 and CS1 to CS4 monoclonal antibodies (MAbs) were used to detect EBNA-LP, EBNA2 and LMP1 expression respectively in transfected cells. Methods were essentially as described (Nitsche et al., 1997Down ) except that now a goat anti-mouse IgG–peroxidase conjugate (Sigma) was used as a second step and an enhanced chemiluminescence detection kit (ECL; Amersham) was used as a third step. For quantification, duplicate blots were probed with rabbit anti-mouse IgG (DAKO) as a second step and 125I-labelled protein A (Amersham) as a third step, prior to analysis using a Molecular Dynamics Phosphorimager. Autoradiographs presented in Figs 1Down, 2(A)Down, 4 and 6 were scanned using a UMAX Astra 2000U with Adobe Photoshop 5.0.2 software and were assembled using Microsoft PowerPoint.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. EBNA-LP stimulates EBNA2-mediated LMP1 induction over a wide range of EBNA2 expression levels. Akata-BL cells were transfected with various amounts of an EBNA2 expression plasmid (indicated above each track as µg of plasmid), either with or without 10 µg of an expression plasmid encoding a two-repeat version of EBNA-LP, i.e. (W1W2)2Y1Y2. Cells were harvested at 48 h post-transfection and analysed by SDS–PAGE and immunoblotting as described in Methods. For EBNA2 and LMP1 detection (upper blot) 100 µg of protein extract was loaded onto 7·5% gels and filters were probed with a mixture of MAbs to EBNA2 and LMP1 as indicated. For EBNA-LP detection (lower blot) 75 µg of protein extract was loaded onto 15% gels and filters were probed with a MAb to EBNA-LP. The track marked LCL represents control protein extracts prepared from the reference type 1 EBV-transformed LCL X50-7; see Fig. 4Down. for detection of the larger EBNA-LP species encoded by this virus. The molecular masses (in kDa) of known marker proteins are indicated to the left of each blot.

 


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 4. Conserved regions within EBNA-LP are required for the co-activating function. Expression plasmids (10 µg) encoding either the wild-type EBNA-LP protein (WT-LP) or the indicated CR deletion mutants were co-transfected into Akata-BL cells with 20 µg of EBNA2 expression vector (tracks marked +EBNA2). In the track marked with an asterisk 20 µg of EBNA-LP expression construct was used in the co-transfection. The standard LCL positive control and controls of Akata-BL cells individually transfected with EBNA2 (20 µg) or empty pSG5 vector (30 µg) constructs are included in the indicated tracks. Expression of EBNA2 and LMP1 (upper blot) or EBNA-LP (lower blot) was determined by SDS–PAGE and immunoblotting as described in Fig. 1Up. A schematic illustration of the wild-type and mutant proteins is shown to the right of the blots, depicting the exon boundaries in WT-LP and the regions deleted in each of the mutant proteins.

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. The Y2 exon of the wild-type (W1W2)2Y1Y2 species of EBNA-LP (WT-LP) is required for the co-activating function. (A) Effect of Y exon deletions of WT-LP on LMP1 induction mediated by co-transfected EBNA2. Expression plasmids (10 µg) encoding either WT-LP or the indicated mutants were co-transfected into Akata-BL cells with 20 µg of EBNA2 expression plasmid (tracks marked +EBNA2); in tracks marked with an asterisk 20 µg of EBNA-LP expression plasmid was used in the co-transfection. Controls include the standard LCL described in Fig. 1Down and Akata-BL cells individually transfected with expression plasmids for either EBNA2 (20 µg), or WT-LP (10 µg) or with empty pSG5 vector (30 µg). Expression of EBNA2 and LMP1 (upper blot) or EBNA-LP (lower blot) was determined by SDS–PAGE and immunoblotting as described in Fig. 1.(B)Down Y exon deletion mutants of EBNA-LP show normal nuclear localization. HeLa cells were transfected with expression plasmids for WT-LP or the indicated mutants. Cells were fixed 24 h post-transfection and EBNA-LP expression was detected by indirect immunofluorescence using MAb JF186 as a primary antibody and an FITC-conjugated goat anti-mouse MAb as a secondary antibody. Fluorescent images were viewed and acquired using a Zeiss Axioskop microscope. Schematics of the exon structure for the respective proteins are given above each image.

 
{blacksquare} Immunofluorescence.
HeLa cells were trypsinized 24 h post-transfection, spotted onto SM-011 slides (Hendley-Essex) at 5x103 cells per well in 30 µl medium, and grown on the slides (in humidified Petri dishes) for a further 24 h. Slides were then washed in PBS, fixed in methanol–acetone (1:1, v/v) for 5 min at -20 °C and the cells were subsequently rehydrated in PBS containing 20% heat-inactivated goat serum (HINGS). EBNA-LP was detected with MAb JF186 (diluted 1:10 in PBS–20% HINGS) as a first step, and goat anti-mouse IgG–fluorescein isothiocyanate (FITC) conjugate (diluted 1:50 in PBS–20% HINGS) as a second step. Slides were mounted in 1,4-diazabicyclo[2.2.2]octane (DABCO) and cells were viewed by both phase and fluorescent microscopy using a Zeiss Axioskop confocal microscope linked to the Openlab 2.2.4 software from Improvision. Figs 2(B)Up and 5 were prepared from directly imported images using Adobe Photoshop to generate pseudocolour for the FITC channel and Microsoft PowerPoint to assemble the final figures.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Titration of EBNA2 co-activation using a minimal EBNA-LP construct
The wild-type isoform of EBNA-LP (WT-LP) used in the present study encodes two copies of the W1W2 repeat linked to the unique Y1Y2 region, i.e. (W1W2)2Y1Y2. Earlier work identified this EBNA-LP species as the minimal isoform capable of co-operating with EBNA2 in a co-transfection assay in the EBV-positive Akata-BL cell line to induce LMP1 expression from the resident EBV genome (Nitsche et al., 1997Down ). We first carried out titrations of the EBNA2 and EBNA-LP expression plasmids in the Akata-BL assay to quantify the dose-dependence of the co-operative effect. Fig. 1Up shows the results of a typical experiment in which EBNA2 plasmid input was titrated across a 5 to 80 µg range in the presence or absence of a standard input (10 µg) of EBNA-LP plasmid. Protein extracts of Akata-BL cells 48 h post-transfection were analysed for the expression of EBNA2 and EBNA-LP from the input plasmids and of LMP1 from the endogenous EBV genome. The gels clearly show dose-dependent expression levels of EBNA2 but, in the absence of EBNA-LP, there is very little if any activation of LMP1 expression; trace levels of LMP1 are detectable only at the highest EBNA2 input dose. By contrast, when EBNA2 and EBNA-LP are co-expressed, there is a marked induction of LMP1 (to greater than LCL reference levels) even at the lowest EBNA2 input dose. Note that transfection of EBNA-LP alone never had any LMP1-inducing effect in this system (Nitsche et al., 1997Down , and see later figures). As is apparent from Fig. 1Up, we frequently observed that EBNA2 expression levels from plasmid inputs in the 5–20 µg range were increased by a factor of 2- to 4-fold when these had been co-transfected with the EBNA-LP plasmid. However, from the present titration data, the modest increase in EBNA2 levels seen with EBNA2/EBNA-LP co-transfection is clearly insufficient on its own to account for the marked LMP1 induction. In other experiments titrating EBNA-LP input, we found that the co-operative effect was already optimal at a 10 µg dose (data not shown). In subsequent experiments, we routinely used a 20 µg dose of the EBNA2 expression plasmid and, unless otherwise stated, a 10 µg dose of the wild-type and mutant EBNA-LP plasmids.

Deletion analysis of the Y1Y2 exons in the minimal EBNA-LP construct
The requirement for at least two copies of the W1W2 repeat for EBNA-LP co-activating function is well documented (Nitsche et al., 1997Down ; Harada & Kieff, 1997Down ). Prior to initiating a more detailed genetic analysis of the two repeat construct, we sought to determine the importance of the unique Y1Y2 domain in this construct by constructing mutants which lacked the Y1 exon-coded sequences, the Y2 exon-coded sequences or the entire Y1Y2 domain ({Delta}Y1, {Delta}Y2 and {Delta}Y1Y2 respectively). Fig. 2(A)Up shows the results from a typical experiment involving co-transfection of these mutant constructs along with the EBNA2 plasmid into Akata-BL cells. The lower gel shows that all of the mutant EBNA-LP proteins were stably expressed and migrated at the expected size relative to WT-LP. Mutants {Delta}Y2 and {Delta}Y1Y2 showed a slight but consistent reduction in their level of expression compared to the WT-LP, for which we compensated by increasing plasmid input from 10 to 20 µg (tracks marked by an asterisk in Fig. 2AUp). The upper gel shows the same extracts analysed for the presence of EBNA2 and LMP1 proteins. Cells co-transfected with EBNA2 and the {Delta}Y1 mutant of EBNA-LP showed LMP1 levels equal to those in cells co-transfected with EBNA2 and WT-LP, indicating that the Y1 exon is dispensable for co-activation with EBNA2. However deletion of the Y2 exon, either alone or together with Y1, led to a complete loss of co-operative activity (see mutants {Delta}Y2 and {Delta}Y1Y2 in Fig. 2AUp). These results suggest that the Y2 exon is essential for the co-activating function in the context of the (W1W2)2Y1Y2 EBNA-LP isoform.

The defective phenotypes of the {Delta}Y1 and {Delta}Y1Y2 mutants could result from aberrant cellular localization of the respective proteins. To examine this possibility we used immunofluorescence to study the subcellular localization of the mutants following transfection both in B cells and in HeLa cells. Similar results were obtained in both cell types but for clarity are illustrated in the epithelial (HeLa) cell background. From Fig. 2(B)Up, the WT-LP protein and also all three mutants ({Delta}Y1, {Delta}Y2 and {Delta}Y1Y2) demonstrated a diffuse but exclusively nuclear staining.

Sequence conservation among EBNA-LP homologues
Having established that genetic analysis of EBNA-LP function would need to examine the unique as well as the repeat domains, we sought to determine the sequence of the W1, W2, Y1 and Y2 exons of EBNA-LP homologues in simian LCVs. Amplifications of W1W2 sequence were obtained from the LCV genomes of gorilla (H.gorilla), chimpanzee (H.pan), baboon (H.papio) and rhesus (H.rhesus) origin and amplifications of Y1Y2 sequences were obtained in two of these cases (H.gorilla and H.pan). The predicted amino acid sequences of the EBNA-LP homologues are shown in Fig. 3Down alongside the standard B95.8 EBV sequence and sequences obtained in parallel from the type 1 EBV strain Akata and from the type 2 EBV strain Eli; for completeness we also include published Y1Y2 sequences for baboon and rhesus LCVs (Peng et al., 2000aDown ). The W1W2 domain sequences are numbered from the initial proline residue present in all internal repeat domains, and vary in length from 65 to 70 residues. The Y1Y2 domains are numbered separately and vary in length from 44 to 46 residues. These data, which extend previously published results (Peng et al., 2000aDown ), identify five major conserved regions of interest, CR1–CR5, within EBNA-LP and its homologues. Of these, CR1 lies at the N terminus of the W1W2 repeat (and includes the JF186 MAb epitope), CR2 and CR3 lie within W2 and CR4 and CR5 lie within Y2. Conserved positions are identified where in at least six of the seven cases the residues are identical (dark shading) or involve similar amino acids by group (light shading). Serine residues that are potential targets for kinases known to phosphorylate B958 EBNA-LP in vitro (Kitay & Rowe, 1996aDown ) are marked by asterisks above the sequence. The three serine residues identified in W2 (S34, S36 and S63) lie within potential p34cdc2 sites (minimally SP) and the residue identified in Y2 (S12) lies within a potential casein kinase II site ([S/T]XX[D/E]); of these, W-S36 and Y-S12 are completely conserved.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. Alignment of predicted EBNA-LP amino acid sequences from human and simian LCVs. Origins of the viral isolates compared (designated to the left of the respective sequence) are described in the text. For simplicity a single internal W1W2 repeat is shown and is numbered separately from the unique C-terminal Y1Y2 region of the protein. Note that the proline and arginine residues (PR) shown at the start of the internal W1W2 repeat are replaced by a methionine residue in the first W1W2 repeat of the protein (following alternative splicing of the pre-mRNA). The boundaries of the W1, W2, Y1 and Y2 exons are shown above the sequences. Amino acid residues that are identical in six of the seven compared sequences are indicated by dark shading whilst amino acid residues conserved by residue group in six of the seven sequences are indicated by lighter shading. Conserved regions (CR) are indicated by the brackets above the sequence alignment and are numbered CR1 to CR5. Deletion mutants of the conserved regions ({Delta}CR1–{Delta}CR5) are shown as open boxes below the sequences and indicate the residues removed in each of the respective mutants. Serine residues that were targeted for mutagenic analysis are indicated by asterisks above the respective residues in the B95.8 sequence. The peptide originally used to generate the JF186 MAb (residues 1–18 within the internal repeat sequence of B95.8 EBNA-LP) is indicated by the black box shown below the alignment.

 
Deletion analysis within conserved regions of EBNA-LP
Conserved regions CR1 to CR5 were disrupted by introducing small deletions of 4 to 9 amino acids within these regions as detailed in Fig. 3Up. For CR1 to CR3, deletions were introduced into both copies of the W1W2 repeats of the WT-LP sequence, the deletion within CR1 being positioned so as not to disturb the JF186 epitope. These mutant constructs were then co-expressed with EBNA2 in Akata-BL cells and assayed for their ability to co-activate LMP1 expression. Results of a representative experiment are illustrated in Fig. 4Up.

Immunoblotting with JF186 showed that the majority of the mutants produced an EBNA-LP protein of the expected size, with the exception of {Delta}CR2 which migrated like WT-LP despite the deletion. From the analysis of LMP1 induction in co-transfected Akata cells, both mutants carrying deletions within the Y2 domain retained detectable activity; the {Delta}CR4 mutant was as active as WT-LP whereas the {Delta}CR5 mutant reproducibly showed around 50% WT-LP activity. By contrast the {Delta}CR1, {Delta}CR2 and {Delta}CR3 mutants within W2 were completely inactive. Of these CR3 was expressed at lower than wild-type levels but remained inactive even when levels were increased by increasing the input plasmid dose (track marked with an asterisk in Fig. 4Up). Interestingly, in cells co-transfected with the defective {Delta}CR1 mutant, EBNA2 levels were consistently much lower (in the range 5–20% over several experiments) than EBNA2 levels observed in co-transfections with any other LP construct. However, by comparison with the dose response assay shown in Fig. 1Up, even these reduced amounts of EBNA2 should have been sufficient to achieve full LMP1 induction in the presence of a fully active EBNA-LP.

The localization of these deletion mutant EBNA-LPs was analysed by transfection into HeLa cells and the results of immunofluorescence assays are shown in Fig. 5Down. The active {Delta}CR4 and the partially active {Delta}CR5 mutant showed a clear nuclear localization. Of the mutants which lacked activity, {Delta}CR1 was predominantly found in cytoplasmic or perinuclear locations in most of the cells examined, and {Delta}CR2 showed an even clearer segregation to cytoplasmic areas; atypical localization of these mutants most likely explains their defective co-operation with EBNA2. In contrast the {Delta}CR3 mutant did show nuclear localization, implying that this deletion had affected EBNA-LP function through some mechanism other than simple nuclear import.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 5. Location of EBNA-LP mutants in transiently transfected cells. HeLa cells were transfected with expression constructs encoding either WT-LP or the mutant proteins indicated below each image. At 48 h post-transfection subcellular sites of EBNA-LP expression were visualized by indirect immunofluorescence as described in Fig. 2(B)Up.

 
Mutation of selected serine residues within EBNA-LP
To examine the functional importance of the three EBNA-LP serine residues in W2 that could act as potential targets for the p34cdc2 kinase (S34, S36 and S63), we mutated all three target serines in both W repeats of WT-LP either to alanine (W-S34,36,63-A) or to glutamic acid (W-S34,36,63-E). In parallel, the conserved serine in Y2, a potential substrate for casein kinase II, was substituted to either alanine (Y-S12-A) or glutamic acid (Y-S12-E). Fig. 6(A)Down shows the results of functional analysis of these mutants in the EBNA2 co-transfection assay in Akata-BL cells.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of EBNA-LP serine mutants for co-activating function. (A) Mutants targeting potential kinase sites in either W2 or Y2. (B) Mutants targeting individual serine residues in W2. Expression plasmids (10 µg) encoding either the wild-type EBNA-LP protein (WT-LP) or the individual serine substitution mutants were co-transfected into Akata-BL cells with the indicated amounts of EBNA2 expression plasmid (tracks marked +EBNA2). LCL and individually transfected control samples are as described for Fig. 2Up. Expression of EBNA-LP, EBNA2 and LMP1 was determined by SDS–PAGE and immunoblotting as described in Fig. 1Up. A schematic illustration of the wild-type and mutant proteins is shown to the right of the blots, depicting the location of the targeted serines in the WT-LP and the nature of the substitution in each of the mutant proteins.

 
All four of the mutants were stably expressed at similar levels to WT-LP, as judged by immunoblotting with JF168 (Fig. 6AUp – lower panel), and showed typical nuclear localization when analysed by immunofluorescence (Fig. 5Up and data not shown). Both types of substitution at S12 in Y2 did not affect activity as judged by the level of LMP1 induction (Fig. 6AUp – upper panel). Similarly, the mutant W-S34,36,63-E, in which all three serine residues in W2 were replaced by glutamic acids, was as active as WT-LP. By contrast alanine substitution of the same three W2 serine residues (mutant W-S34,36,63-A) abrogated activity; however we observed that the co-expression of this mutant also caused a dramatic and unexpected decrease in the level of EBNA2 detectable in co-transfected cells (Fig. 6AUp).

Since the above findings suggest that one or more serine residues in W2 are of critical importance for EBNA-LP function in this assay, we next examined the role of S34, S36 and S63 in more detail, by mutating each residue individually in both copies of W2 to create the mutants W-S34-A, W-S36-A and W-S63-A respectively. All three individual mutants were found to have normal nuclear localization (Fig. 5Up and data not shown). Fig. 6(B)Up shows the results of analysis of these mutants in the EBNA2 co-transfection assay in Akata-BL cells. The W-S63-A mutant gave rise to similar LMP1 levels as those seen in the presence of WT-LP. By contrast, the W-S34-A mutant typically showed a 5- to 10-fold drop in the level of LMP1 induction, while the mutant W-S36-A failed to induce any LMP1, indicating a complete loss of co-operative function. Since cells co-transfected with W-S34-A, and to a lesser extent W-S36-A, also showed a small but reproducible decrease in the level of EBNA2 protein compared to cells co-transfected with WT-LP, we carried out an additional experiment in which EBNA2 expression plasmid input was increased from 20 to 60 µg. Even under these conditions where the levels of EBNA2 expression were forced to be equivalent (Fig. 6BUp – right-hand blots), the W-S34-A mutant still caused a 3- to 4-fold drop in the level of LMP1 induction while the W-S36-A mutant gave rise to barely detectable levels of LMP1.

Analysis of the EBNA-LP mutants using a luciferase reporter assay
Finally, in order to establish if the EBNA2 co-activation phenotypes of the WT-LP and the EBNA-LP mutants were reproducible in a different cellular background and at a different EBNA2-responsive promoter, we performed transient transfection assays using a luciferase reporter construct, BamCp8LUC, carrying multimerized copies of the Cp EBNA2 responsive element.

Fig. 7Down shows the mean results of several assays done in BJAB cells and involving the co-transfection of the reporter with EBNA2 and/or the relevant EBNA-LP expression construct. As observed in other studies with such a reporter (Harada & Kieff, 1997Down ; Peng et al., 2000aDown ), WT-LP had no effect on promoter activity whereas EBNA2 alone caused a 10-fold increase, and the combination of EBNA2 and WT-LP caused a 70- to 130-fold increase. The data in Fig. 7Down show that the co-activation function of the EBNA-LP mutants in this second assay, quantified using the activity of EBNA2 as a baseline, broadly reflects the pattern of results noted in the Akata-BL assay. Thus the {Delta}Y1 mutant retained wild-type activity whereas the {Delta}Y2 and {Delta}Y1Y2 mutants were inactive. Furthermore the {Delta}CR4 and {Delta}CR5 deletion mutants in Y2 did not significantly affect activity, whereas all three deletion mutants in W2, {Delta}CR1, {Delta}CR2 and {Delta}CR3, were again inactive. The triple serine mutant W-S34,36,63-A had no co-operative function but was again associated with reduced, though in this case still detectable, EBNA2 levels in co-transfected cells (data not shown). Of the individual serine mutants, changes at the S63 residue in W2 and the S12 residue in Y2 again had no significant effect, whereas alanine substitution of the S34 residue severely reduced activity (in this case with only marginal reduction in EBNA2 levels) and alanine substitution of S36 completely abrogated function. Essentially similar results were obtained on repeating the luciferase reporter assay in a second B cell line, DG75 (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7. Co-activation of EBNA2 by wild-type and mutant EBNA-LP proteins in a Cp-based reporter assay. BJAB cells were transfected with a luciferase reporter construct driven by eight copies of the EBNA2-enhancer element from the viral Cp promoter (BamCp8LUC). Expression plasmids for the indicated proteins were included in the co-transfection, using 5 µg of the EBNA2 expression construct and 10 µg of the EBNA-LP expression constructs. Luciferase activity in the co-transfections was measured at 24 h post-transfection and the results are expressed as -fold activation over the luciferase activity seen with EBNA2 alone. The results shown are an average of three experiments; the T bars indicate the standard errors of the means.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The observation that EBNA-LP co-operates with EBNA2 in short-term transfection assays involving the activation of Cp reporter constructs and of LMP1 expression from an endogenous EBV genome provided systems for a genetic analysis of this co-operative function. Our present study was guided by the results of sequencing EBNA-LP and its homologues in different EBV strains and in the LCVs of Old World primates. The conserved domains shown in Fig. 3Up are analogous to the CR domains proposed by Peng et al. (2000a)Down ; however, our expanded analysis has allowed us to identify more extended CR2 and CR4 domains, and to redefine the CR1 domain to include the entire W1 exon and the first 11 amino acids of the W2 exon. Small differences between the sequences reported in the two studies may reflect a degree of variation between different strains of the same LCV. Such variation is indeed apparent among the different EBV isolates analysed in Fig. 3Up and, interestingly, is especially marked between the Y1Y2 sequences of type 1 versus type 2 EBV strains. This raises the possibility that the unique exons of EBNA-LP show type-specific polymorphism as do the EBNA2, 3A, 3B and 3C open reading frames (Sample et al., 1990Down ). Two of the conserved regions, CR4 and CR5, were nevertheless situated in the Y2 unique domain. It was interesting in this context that the initial deletion analyses described in Fig. 2Up clearly implied a role for Y2 in EBNA-LP co-operative function. A similar observation had also been made in earlier work with Y2 deletions from an EBNA-LP construct with four repeat domains but there, in contrast to the present work, extending the deletion to include the whole Y1Y2 domain restored activity (Nitsche et al., 1997Down ; Harada & Kieff, 1997Down ). The present two-repeat domain WT-LP may represent a more relevant template for dissecting EBNA-LP function since, from experiments with recombinant viruses, it is clear that the Y1Y2 domain is critical for EBNA-LP’s contribution to B cell growth transformation (Hammerschmidt & Sugden, 1989Down ; Mannick et al., 1991Down ). We therefore introduced small deletions into the CR4 and CR5 regions of Y2 but neither was found to completely block EBNA-LP activity (Figs 4Up and 7Up). Deletion within the CR4 region had no detectable effect; note that this deletion removed the S12 residue in Y2 which substitution analysis (Fig. 6AUp) independently confirmed to be neutral in functional assays. In the more physiological LMP1 induction assay there was a partial effect of deleting the four conserved glutamic acid residues within CR5 near the EBNA-LP C terminus, but this did not reproduce the total inhibition of activity observed when mutants lacking the C-terminal 10 residues were tested in reporter gene assays (Harada & Kieff, 1997Down ). Further studies will be needed to map the important functional residues within the Y1Y2 unique domain.

By contrast, all three deletions made in the CR1, CR2 and CR3 regions of the W1W2 repeat domain severely affected EBNA-LP function (Figs 4Up and 7Up). In the case of the {Delta}CR1 and {Delta}CR2 mutants, loss of activity correlated with a failure of nuclear localization (Fig. 5Up). This is consistent with a recent report suggesting that these two domains constitute a bipartite nuclear localization signal (NLS) for EBNA-LP (Peng et al., 2000 bDown ). In this context the region deleted in CR1 contains at least three basic residues in all LCVs studied with the exception of H.gorilla, while the stronger CR2 NLS always contains four or more basic residues including a fully conserved RRRV motif previously noted to be similar to the PRRRV NLS motif of Semliki Forest virus nsp2 protein (Rikkonen et al., 1992Down ; Szekely et al., 1995Down ). EBNA-LP is known to bind cellular hsp70 (Mannick et al., 1995Down ; Kitay & Rowe, 1996bDown ) and it would be of interest to determine if either of these mutants retained this interaction since certain hsp70 binding peptides are similar to known NLS elements (Fourie et al., 1994Down ). It is even possible that EBNA-LP accesses the nucleus through this interaction and indeed the region deleted in the CR1 mutation has previously been proposed to be a potential mediator of hsp70 binding (Mannick et al., 1995Down ).

More importantly, deletion of the CR3 domain within W2 completely abrogated function in both assays without affecting nuclear localization. At least three adjacent acidic residues are found at this location in the EBNA-LP homologues of all LCVs studied to date, as is a well-conserved serine (at position 61 in B95.8). Interestingly, in another study substitutions replacing either the three acidic residues within CR3 or replacing S61 and its adjacent residues had relatively little effect on EBNA-LP function (Peng et al., 2000bDown ). The present data therefore represent the first indication that the CR3 domain is critical for function. Although such a deletion may have allosteric effects on the EBNA-LP molecule, it is possible that the CR3 region directly mediates protein–protein interactions necessary for EBNA-LP’s co-operation with EBNA2. It would therefore be interesting to examine the capacity of CR3 mutant proteins to interact with reported EBNA-LP binding proteins, such as DNA-PKcs, HA95, hsp70 and HAX-1, to ask whether any of these interactions co-segregates with EBNA-LP’s co-operative function (Mannick et al., 1995Down ; Kitay & Rowe, 1996bDown ; Kawaguchi et al., 2000Down ; Dufva et al., 2001Down ; Han et al., 2001Down ).

Previous work has shown that EBNA-LP is progressively phosphorylated on serine residues with cell cycle transit and has speculated on the potential importance of three serine residues within W2, S34, S36 and S63, which represent potential consensus sites for p34cdc2 phosphorylation (Kitay & Rowe, 1996aDown ). Of these, mutation of S63 to alanine had no effect upon EBNA-LP function whereas mutation of S34 caused an 80–90% inhibition and mutation of S36 completely abrogated co-operativity with EBNA2, both in the LMP1 induction assay (Fig. 6BUp) and in the reporter construct assay (Fig. 7Up). Such loss of activity could not be explained by effects on nuclear localization nor, at least in the case of S36, by effects on available EBNA2 levels in co-transfected cells. Interestingly, S36 is the only one of the three serine residues which is perfectly conserved among all LCV isolates and represents the best match for the extended p34cdc2 consensus motif of [S/T]PX[K/R] (Holmes & Solomon, 1996Down ). We therefore infer a critical role for the S36 residue in EBNA-LP co-operative function; recent studies have also made a similar suggestion although in that report the effect of S36 mutation was less marked (Peng et al., 2000bDown ). Interestingly, we noted that mutation of S36 to glutamic acid in the context of triple mutant W-S34,36,63-E did not disrupt EBNA-LP co-operative function in either Akata-BL or reporter gene assays. Since substitution with glutamic acid is known to mimic the functional effects of constitutive phosphorylation, while alanine substitution blocks any such modification, we speculate that active phosphorylation of S36 is required for EBNA-LP activity. This hypothesis is supported by the recent findings of Yokoyama et al. (2001)Down , who reported that S36 is the major phosphorylation site in EBNA-LP. From the present data we do not yet know whether the milder inhibitory effect of mutating S34 to alanine might be explained through altering the conformation of the nearby S36 residue, or reflects a direct role for S34 as a second regulatory site; on this point, it is interesting to note that a fragment corresponding to the W2 domain of EBNA-LP has been shown to be weakly phosphorylated even in the presence of the S36A substitution (Yokoyama et al., 2001Down ).

Finally, the serine mutant analysis provided the most extreme example of an unexpected feature of these experiments, which was that certain EBNA-LP mutants were consistently associated with lower levels of EBNA2 protein being observed in co-transfected cells, especially in the Akata-based assay. Thus the triple serine mutant W-S34,36,63-A, in which all three W2 serines were mutated to alanines, was well expressed post-transfection yet EBNA2 was either completely undetectable (in Akata-BL cells; Fig. 6AUp) or much reduced (in BJAB and DG75 cells; data not shown). Interestingly, two other constructs, the W-S34-A substitution and the {Delta}CR1 deletion mutants, were also associated with reduced EBNA2 levels which in the Akata-BL system had fallen to approximately 30% and 5–20% respectively of those seen in cells co-transfected with EBNA2 and WT-LP. The mechanism underlying these effects is not yet understood but seems unlikely to involve an inhibition of transcription from the pSG5 vector used to express EBNA2 in these experiments. Thus the EBNA-LP mutants were themselves expressed from a similar pSG5-based construct. Also, we found no comparable effects of the above EBNA-LP mutants on levels of EBNA1 or LMP1 proteins expressed from pSG5 vectors in Akata-BL, BJAB or DG75 cells (data not shown). One interesting possibility is that wild-type EBNA-LP functionally co-operates with EBNA2 via a direct or indirect interaction and that certain mutants of EBNA-LP can alter the complex in such a way as to target EBNA2 for degradation.

It is known that EBNA2 can interact with a range of transcription factors including RBP-J{kappa}, PU.1 and the ATF-2/c-Jun heterodimer, all of which are thought to be important in targeting the viral protein to particular promoters. In addition, the C-terminal acidic activation domain of EBNA2 can interact with various subunits of the basal RNA polymerase II transcription complex (TAF40, TFIIB, TFIIH), with the novel TFIIE-contacting protein p100 and with the histone acetyltransferases p300 and CBP (Tong et al., 1995aDown , bDown , cDown ; Jayachandra et al., 1999Down ; Wang et al., 2000Down ). The fact that the co-operative function of EBNA-LP, as measured in reporter assays, appears to be specific for the above EBNA2 C-terminal domain (Harada & Kieff, 1997Down ) suggests that EBNA-LP may act by increasing the recruitment or affinity of transcription components at that domain. Consistent with this idea is the recent observation that overexpression of one of these recruited proteins, p300, can substitute for EBNA-LP in the Akata cell assay of LMP1 induction (Wang et al., 2000Down ). In identifying specific EBNA-LP mutations which abrogate co-operative function, the present paper provides important tools with which to investigate further the biochemical basis of EBNA-LP/EBNA2 co-activation.


   Acknowledgments
 
This work was funded by the Cancer Research Campaign (CRC), London, UK; G.K. holds a CRC-funded PhD studentship. We would like to thank Paul Ling (Division of Virology, Baylor College of Medicine, Houston, Texas, USA) for kindly providing the BamCp8LUC reporter plasmid. We are also grateful to Chris Dawson and Meryn Griffiths for invaluable help with immunofluorescence and microscopy.


   Footnotes
 
EMBL accession numbers for the EBNA-LP exon sequences presented in this report are AJ311190 and AJ311191 (Akata-EBV), AJ311192 and AJ311193 (Eli-EBV), AJ311194 and AJ311195 (Pongine herpesvirus 3), AJ311196 and AJ311197 (Pongine herpesvirus 1), AJ311198 (Cercopithicine herpesvirus 12) and AJ311199 (Cercopithicine herpesvirus 15).


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Abbot, S. D., Rowe, M., Cadwallader, K., Ricksten, A., Gordon, J., Wang, F., Rymo, L. & Rickinson, A. B. (1990). Epstein–Barr virus nuclear antigen 2 induces expression of the virus-encoded latent membrane protein. Journal of Virology 64, 2126-2134.[Abstract/Free Full Text]

Alfieri, C., Birkenbach, M. & Kieff, E. (1991). Early events in Epstein–Barr virus infection of human B lymphocytes. Virology 181, 595-608.[Medline]

Bell, A. I., Skinner, J., Kirby, H. & Rickinson, A. (1998). Characterization of regulatory sequences at the Epstein–Barr virus BamHI W promoter. Virology 252, 149-161.[Medline]

Cohen, J. I., Wang, F., Mannick, J. & Kieff, E. (1989). Epstein–Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proceedings of the National Academy of Sciences, USA 86, 9558-9562.[Abstract/Free Full Text]

Cordier, M., Calender, A., Billaud, M., Zimber, U., Rousselet, G., Pavlish, O., Banchereau, J., Tursz, T., Bornkamm, G. & Lenoir, G. M. (1990). Stable transfection of Epstein–Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23. Journal of Virology 64, 1002-1013.[Abstract/Free Full Text]

Dufva, M., Olsson, M. & Rymo, L. (2001). Epstein–Barr virus nuclear antigen 5 interacts with HAX-1, a possible component of the B cell receptor signalling pathway. Journal of General Virology 82, 1581-1587.[Abstract/Free Full Text]

Fourie, A. M., Sambrook, J. F. & Gething, M. J. (1994). Common and divergent peptide binding specificities of hsp70 molecular chaperones. Journal of Biological Chemistry 269, 30470-30478.[Abstract/Free Full Text]

Grossman, S. R., Johannsen, E., Tong, X., Yalamanchili, R. & Kieff, E. (1994). The Epstein–Barr virus nuclear antigen 2 transactivator is directed to response elements by the J kappa recombination signal binding protein. Proceedings of the National Academy of Sciences, USA 91, 7568-7572.[Abstract/Free Full Text]

Hammerschmidt, W. & Sugden, B. (1989). Genetic analysis of immortalizing functions of Epstein–Barr virus in human B lymphocytes. Nature 340, 393-397.[Medline]

Han, I., Harada, S., Weaver, D., Xue, Y., Lane, W., Orstavik, S., Skalhegg, B. & Kieff, E. (2001). EBNA-LP associates with cellular proteins including DNA-PK and HA95. Journal of Virology 75, 2475-2481.[Abstract/Free Full Text]

Harada, S. & Kieff, E. (1997). Epstein–Barr virus nuclear protein LP stimulates EBNA-2 acidic domain-mediated transcriptional activation. Journal of Virology 71, 6611-6618.[Abstract]

Henkel, T., Ling, P. D., Hayward, S. D. & Peterson, M. G. (1994). Mediation of Epstein–Barr virus EBNA2 transactivation by recombination signal-binding protein J kappa. Science 265, 92-95.[Abstract/Free Full Text]

Holmes, J. K. & Solomon, M. J. (1996). A predictive scale for evaluating cyclin-dependent kinase substrates. A comparison of p34cdc2 and p33cdk2. Journal of Biological Chemistry 271, 25240-25246.[Abstract/Free Full Text]

Jayachandra, S., Low, K. G., Thlick, A. E., Yu, J., Ling, P. D., Chang, Y. & Moore, P. S. (1999). Three unrelated viral transforming proteins (vIRF, EBNA2, and E1A) induce the MYC oncogene through the interferon-responsive PRF element by using different transcription coadaptors. Proceedings of the National Academy of Sciences, USA 96, 11566-11571.[Abstract/Free Full Text]

Kaiser, C., Laux, G., Eick, D., Jochner, N., Bornkamm, G. W. & Kempkes, B. (1999). The proto-oncogene c-myc is a direct target gene of Epstein–Barr virus nuclear antigen 2. Journal of Virology 73, 4481-4484.[Abstract/Free Full Text]

Kawaguchi, Y., Nakajima, K., Igarashi, M., Morita, T., Tanaka, M., Suzuki, M., Yokoyama, A., Matsuda, G., Kato, K., Kanamori, M. & Hirai, K. (2000). Interaction of Epstein–Barr virus nuclear antigen leader protein (EBNA-LP) with HS1-associated protein X-1: implication of cytoplasmic function of EBNA-LP. Journal of Virology 74, 10104-10111.[Abstract/Free Full Text]

Kieff, E. (1996). Epstein–Barr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Kitay, M. K. & Rowe, D. T. (1996a). Cell cycle stage-specific phosphorylation of the Epstein–Barr virus immortalization protein EBNA-LP. Journal of Virology 70, 7885-7893.[Abstract]

Kitay, M. K. & Rowe, D. T. (1996b). Protein–protein interactions between Epstein–Barr virus nuclear antigen-LP and cellular gene products: binding of 70-kilodalton heat shock proteins. Virology 220, 91-99.[Medline]

Knutson, J. C. (1990). The level of c-fgr RNA is increased by EBNA-2, an Epstein–Barr virus gene required for B-cell immortalization. Journal of Virology 64, 2530-2536.[Abstract/Free Full Text]

Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]

Laux, G., Adam, B., Strobl, L. J. & Moreaugachelin, F. (1994a). The Spi-1/Pu.1 and Spi-B Ets family transcription factors and the recombination signal binding-protein RBP-J-Kappa interact with an Epstein–Barr-virus nuclear antigen-2 responsive cis-element. EMBO Journal 13, 5624-5632.[Medline]

Laux, G., Dugrillon, F., Eckert, C., Adam, B., Zimber-Strobl, U. & Bornkamm, G. W. (1994b). Identification and characterization of an Epstein–Barr-virus nuclear antigen 2-responsive cis-element in the bidirectional promoter region of latent membrane-protein and terminal protein-2 genes. Journal of Virology 68, 6947-6958.[Abstract/Free Full Text]

Lee, M. A., Diamond, M. E. & Yates, J. L. (1999). Genetic evidence that EBNA-1 is needed for efficient, stable latent infection by Epstein–Barr virus. Journal of Virology 73, 2974-2982.[Abstract/Free Full Text]

Mannick, J. B., Cohen, J. I., Birkenbach, M., Marchini, A. & Kieff, E. (1991). The Epstein–Barr virus nuclear protein encoded by the leader of the EBNA RNAs is important in B-lymphocyte transformation. Journal of Virology 65, 6826-6837.[Abstract/Free Full Text]

Mannick, J. B., Tong, X., Hemnes, A. & Kieff, E. (1995). The Epstein–Barr virus nuclear antigen leader protein associates with hsp72/hsc73. Journal of Virology 69, 8169-8172.[Abstract]

Moghaddam, A., Koch, J., Annis, B. & Wang, F. (1998). Infection of human B lymphocytes with lymphocryptoviruses related to Epstein–Barr virus. Journal of Virology 72, 3205-3212.[Abstract/Free Full Text]

Nitsche, F., Bell, A. I. & Rickinson, A. (1997). Epstein–Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. Journal of Virology 71, 6619-6628.[Abstract]

Peng, R., Gordadze, A. V., Fuentes-Panana, E. M., Wang, F., Zong, J., Hayward, G. S., Tan, J. & Ling, P. D. (2000a). Sequence and functional analysis of EBNA-LP and EBNA2 proteins from nonhuman primate lymphocryptoviruses. Journal of Virology 74, 379-389.[Abstract/Free Full Text]

Peng, R., Tan, J. & Ling, P. D. (2000b). Conserved regions in the Epstein–Barr virus leader protein define distinct domains required for nuclear localization and transcriptional cooperation with EBNA2. Journal of Virology 74, 9953-9963.[Abstract/Free Full Text]

Rabin, H., Strnad, B. C., Neubauer, R. H., Brown, A. M., Hopkins, R. F. & Mazur, R. A. (1980). Comparisons of nuclear antigens of Epstein–Barr virus (EBV) and EBV-like simian viruses. Journal of General Virology 48, 265-272.[Abstract/Free Full Text]

Rikkonen, M., Peranen, J. & Kaariainen, L. (1992). Nuclear and nucleolar targeting signals of Semliki Forest virus nonstructural protein nsP2. Virology 189, 462-473.[Medline]

Robertson, E. S., Grossman, S. R., Johannsen, E., Miller, C., Lin, J., Tomkinson, B. & Kieff, E. (1995). Epstein–Barr-virus nuclear-protein 3C modulates transcription through interaction with the sequence-specific DNA-binding protein J-Kappa. Journal of Virology 69, 3108-3116.[Abstract]

Sample, J., Hummel, M., Braun, D., Birkenbach, M. & Kieff, E. (1986). Nucleotide sequences of mRNAs encoding Epstein–Barr virus nuclear proteins: a probable transcriptional initiation site. Proceedings of the National Academy of Sciences, USA 83, 5096-5100.[Abstract/Free Full Text]

Sample, J., Young, L., Martin, B., Chatman, T., Kieff, E. & Rickinson, A. (1990). Epstein–Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. Journal of Virology 64, 4084-4092.[Abstract/Free Full Text]

Sinclair, A. J., Palmero, I., Peters, G. & Farrell, P. J. (1994). EBNA-2 and EBNA-LP cooperate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by Epstein–Barr virus. EMBO Journal 13, 3321-3328.[Medline]

Sung, N. S., Kenney, S., Gutsch, D. E. & Pagano, J. S. (1991). EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of Epstein–Barr virus. Journal of Virology 65, 2164-2169.[Abstract/Free Full Text]

Szekely, L., Jiang, W. Q., Pokrovskaja, K., Wiman, K. G., Klein, G. & Ringertz, N. (1995). Reversible nucleolar translocation of Epstein–Barr virus-encoded EBNA-5 and hsp70 proteins after exposure to heat shock or cell density congestion. Journal of General Virology 76, 2423-2432.[Abstract/Free Full Text]

Tomkinson, B., Robertson, E. & Kieff, E. (1993). Epstein–Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. Journal of Virology 67, 2014-2025.[Abstract/Free Full Text]

Tong, X., Drapkin, R., Yalamanchili, R., Mosialos, G. & Kieff, E. (1995a). The Epstein–Barr virus nuclear protein 2 acidic domain forms a complex with a novel cellular coactivator that can interact with TFIIE. Molecular and Cellular Biology 15, 4735-4744.[Abstract]

Tong, X., Drapkin, R., Reinberg, D. & Kieff, E. (1995b). The 62-Kda and 80-Kda subunits of transcription factor IIH mediate the interaction with Epstein–Barr virus nuclear protein-2. Proceedings of the National Academy of Sciences, USA 92, 3259-3263.[Abstract/Free Full Text]

Tong, X., Wang, F., Thut, C. J. & Kieff, E. (1995c). The Epstein–Barr virus nuclear protein 2 acidic domain can interact with TFIIB, TAF40, and RPA70 but not with TATA-binding protein. Journal of Virology 69, 585-588.[Abstract]

Wang, F., Tsang, S. F., Kurilla, M. G., Cohen, J. I. & Kieff, E. (1990). Epstein–Barr virus nuclear antigen 2 transactivates latent membrane protein LMP1. Journal of Virology 64, 3407-3416.[Abstract/Free Full Text]

Wang, L., Grossman, S. R. & Kieff, E. (2000). Epstein-Barr virus nuclear protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in activation of the LMP1 promoter. Proceedings of the National Academy of Sciences, USA 97, 430-435.[Abstract/Free Full Text]

Yokoyama, A., Tanaka, M., Matsuda, G., Kato, K., Kanamori, M., Kawasaki, H., Hirano, H., Kitabayashi, I., Ohki, M., Hirai, K. & Kawaguchi, Y. (2001). Identification of major phosphorylation sites of Epstein–Barr virus nuclear antigen leader protein (EBNA-LP): ability of EBNA-LP to induce latent membrane protein 1 cooperatively with EBNA2 is regulated by phosphorylation. Journal of Virology 75, 5119-5128.[Abstract/Free Full Text]

Young, L. S., Dawson, C. W. & Eliopoulos, A. G. (2000). The expression and function of Epstein–Barr virus encoded latent genes. Journal of Clinical Pathology: Molecular Pathology 53, 238-247.

Zhao, B., Marshall, D. R. & Sample, C. E. (1996). A conserved domain of the Epstein–Barr virus nuclear antigens 3A and 3C binds to a discrete domain of J kappa. Journal of Virology 70, 4228-4236.[Abstract]

Zimber-Strobl, U., Suentzenich, K. O., Laux, G., Eick, D., Cordier, M., Calender, A., Billaud, M., Lenoir, G. M. & Bornkamm, G. W. (1991). Epstein–Barr virus nuclear antigen 2 activates transcription of the terminal protein gene. Journal of Virology 65, 415-423.[Abstract/Free Full Text]

Zimber-Strobl, U., Strobl, L. J., Meitinger, C., Hinrichs, R., Sakai, T., Furukawa, T., Honjo, T. & Bornkamm, G. W. (1994). Epstein–Barr virus nuclear antigen 2 exerts its transactivating function through interaction with recombination signal binding-protein RBP-J-Kappa, the homolog of Drosophila Suppressor of Hairless. EMBO Journal 13, 4973-4982.[Medline]

Received 23 May 2001; accepted 5 September 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
P. D. Ling, J. Tan, and R. Peng
Nuclear-Cytoplasmic Shuttling Is Not Required for the Epstein-Barr Virus EBNA-LP Transcriptional Coactivation Function
J. Virol., July 15, 2009; 83(14): 7109 - 7116.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Lucchesi, G. Brady, O. Dittrich-Breiholz, M. Kracht, R. Russ, and P. J. Farrell
Differential Gene Regulation by Epstein-Barr Virus Type 1 and Type 2 EBNA2
J. Virol., August 1, 2008; 82(15): 7456 - 7466.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Tierney, J. Nagra, I. Hutchings, C. Shannon-Lowe, M. Altmann, W. Hammerschmidt, A. Rickinson, and A. Bell
Epstein-Barr Virus Exploits BSAP/Pax5 To Achieve the B-Cell Specificity of Its Growth-Transforming Program
J. Virol., September 15, 2007; 81(18): 10092 - 10100.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Garibal, E. Hollville, A. I. Bell, G. L. Kelly, B. Renouf, Y. Kawaguchi, A. B. Rickinson, and J. Wiels
Truncated Form of the Epstein-Barr Virus Protein EBNA-LP Protects against Caspase-Dependent Apoptosis by Inhibiting Protein Phosphatase 2A
J. Virol., July 15, 2007; 81(14): 7598 - 7607.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C.-W. Peng, B. Zhao, H.-C. Chen, M.-L. Chou, C.-Y. Lai, S.-Z. Lin, H.-Y. Hsu, and E. Kieff
Hsp72 up-regulates Epstein-Barr virus EBNALP coactivation with EBNA2
Blood, June 15, 2007; 109(12): 5447 - 5454.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Portal, A. Rosendorff, and E. Kieff
Epstein-Barr nuclear antigen leader protein coactivates transcription through interaction with histone deacetylase 4
PNAS, December 19, 2006; 103(51): 19278 - 19283.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. H. Fogg, A. Kaur, Y.-G. Cho, and F. Wang
The CD8+ T-Cell Response to an Epstein-Barr Virus-Related Gammaherpesvirus Infecting Rhesus Macaques Provides Evidence for Immune Evasion by the EBNA-1 Homologue
J. Virol., October 15, 2005; 79(20): 12681 - 12691.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S.-H. Chiou, K.-C. Chow, C.-H. Yang, S.-F. Chiang, and C.-H. Lin
Discovery of Epstein-Barr virus (EBV)-encoded RNA signal and EBV nuclear antigen leader protein DNA sequence in pet dogs
J. Gen. Virol., April 1, 2005; 86(4): 899 - 905.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Peng, S. C. Moses, J. Tan, E. Kremmer, and P. D. Ling
The Epstein-Barr Virus EBNA-LP Protein Preferentially Coactivates EBNA2-Mediated Stimulation of Latent Membrane Proteins Expressed from the Viral Divergent Promoter
J. Virol., April 1, 2005; 79(7): 4492 - 4505.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C.-W. Peng, B. Zhao, and E. Kieff
Four EBNA2 Domains Are Important for EBNALP Coactivation
J. Virol., October 15, 2004; 78(20): 11439 - 11442.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Kanamori, S. Watanabe, R. Honma, M. Kuroda, S. Imai, K. Takada, N. Yamamoto, Y. Nishiyama, and Y. Kawaguchi
Epstein-Barr Virus Nuclear Antigen Leader Protein Induces Expression of Thymus- and Activation-Regulated Chemokine in B Cells
J. Virol., April 15, 2004; 78(8): 3984 - 3993.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Kato, A. Yokoyama, Y. Tohya, H. Akashi, Y. Nishiyama, and Y. Kawaguchi
Identification of protein kinases responsible for phosphorylation of Epstein-Barr virus nuclear antigen leader protein at serine-35, which regulates its coactivator function
J. Gen. Virol., December 1, 2003; 84(12): 3381 - 3392.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Ning, A. M. Hahn, L. E. Huye, and J. S. Pagano
Interferon Regulatory Factor 7 Regulates Expression of Epstein-Barr Virus Latent Membrane Protein 1: a Regulatory Circuit
J. Virol., September 1, 2003; 77(17): 9359 - 9368.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Igarashi, Y. Kawaguchi, K. Hirai, and F. Mizuno
Physical interaction of Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) with human oestrogen-related receptor 1 (hERR1): hERR1 interacts with a conserved domain of EBNA-LP that is critical for EBV-induced B-cell immortalization
J. Gen. Virol., January 1, 2003; 84(2): 319 - 327.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCann, E. M.
Right arrow Articles by Bell, A. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCann, E. M.
Right arrow Articles by Bell, A. I.
Agricola
Right arrow Articles by McCann, E. M.
Right arrow Articles by Bell, A. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS