|
|
||||||||
Animal: DNA Viruses |
CRC Institute for Cancer Studies, The University of Birmingham, Edgbaston, Birmingham B15 2TA, UK1
Author for correspondence: Andrew I. Bell. Fax +44 121 4486. e-mail a.i.bell{at}bham.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
and PU.1 (Zimber-Strobl et al., 1994
binding appears to underlie the ability of EBNA3A and EBNA3C to act as regulators of EBNA2 function (Robertson et al., 1995
In contrast to the above, relatively little is known about the function or mechanism of action of EBNA-LP. However, this protein is clearly important since viral recombinants incapable of expressing full-length EBNA-LP show grossly impaired transforming activity, giving rise to small numbers of foci which are extremely difficult to expand to permanent cell lines (Hammerschmidt & Sugden, 1989
; Mannick et al., 1991
). EBNA-LP contains multiple copies of an N-terminal 66-amino-acid repeat domain encoded by two exons (W1 and W2) found within each of the BamHI W repeats, and a unique C-terminal 45-amino-acid domain encoded by the Y1 and Y2 exons within the downstream BamHI Y fragment of the viral genome (Sample et al., 1986
). Interestingly, both the repeat and unique domains contain serine residues which appear to be targets of cell cycle-regulated phosphorylation (Kitay & Rowe, 1996a
). EBNA-LP is strongly and selectively expressed, along with EBNA2, at the initiation of the transformation process (Alfieri et al., 1991
; Sinclair et al., 1994
), and indeed has been found to co-operate with EBNA2 in activating cyclin D2 expression in resting B cells (Sinclair et al., 1994
) and in activating LMP1 expression in Burkitts lymphoma (BL) cell lines (Nitsche et al., 1997
). Co-operation has also been observed in reporter assays with synthetic promoters containing either LMP1/LMP2B regulatory elements or multimerized Cp sequences, where augmentation of EBNA2 transcriptional activity appeared to require only the W1W2 repeat domain of EBNA-LP (Harada & Kieff, 1997
).
These systems open the way for a genetic analysis of EBNA-LP co-operative function which we have pursued in the present work, focussing particular attention on sequences which are conserved between EBNA-LP and its homologues in other primate LCVs, and also on conserved serine residues which represent potentially important phosphorylation targets.
| Methods |
|---|
|
|
|---|
Cell lines and culture.
Plasmid constructs.
The EBNA2-responsive reporter plasmid (BamCp8LUC) containing eight copies of the 100 bp EBNA2 Cp enhancer, and the expression vectors for EBNA2 and for EBNA-LP (the latter with two W1W2 repeats and the unique Y1Y2 domain) have been described (Nitsche et al., 1997
; Peng et al., 2000a
); all contain sequences from the B95.8 type 1 strain.
Site-specific mutants of EBNA-LP were generated by standard methods (Kunkel et al., 1987
) following subcloning of the above wild-type sequence into M13 as an EcoRIBamHI fragment. Single mutants (where necessary targeting both W repeats) were introduced using appropriate oligonucleotides. Mutants with triple substitutions (W-S34,36,63-A and W-S34,36,63-E) were created using two oligonucleotides in the same reaction, the first to substitute residues 34 and 36, and the second to substitute residue 63. Deletions
CR1 to
CR5 and
Y1 were created with oligonucleotides flanking the points of deletion whereas
Y2 was created by introducing a stop codon at the end of Y1. All mutant constructs were confirmed by sequencing, both in M13mp18 and following their subsequent subcloning into the pSG5 expression vector as EcoRIBamHI fragments. Mutant
Y1Y2 was generated by PCR amplification from the wild-type EBNA-LP template using oligonucleotides 5' AAAAGAATTCATGGGAGACCGAAGTGAAGGCC 3', which is complementary to the initial 5' sequence of W1 and contains an in-frame ATG initiation codon (underlined), and 5' GCGAGGATCCTGGCCGTAGTTACCCTGAAGG 3', which is complementary to the terminal 3' sequence of W2 and contains an in-frame stop codon (underlined). A product of the appropriate size to contain two W1W2 repeats was gel-purified, digested with EcoRI and BamHI and cloned into pSG5. The insert sequence was confirmed by DNA sequencing.
Cloning and analysis of EBNA-LP homologues.
Genomic DNA from human and simian LCV-positive LCLs was PCR amplified using oligonucleotides 5' GGGGGTCTTCTACCTCTCCCTAGCCC 3' and 5' CGGGGACGGAGGGGGCCTGAAGCCCGG 3', complementary to intronic sequences flanking the W1 and W2 exons of B95.8 (co-ordinates 1441714442 and 1501314987 respectively in the first W repeat) and with oligonucleotides 5' GTTAACTTTCTCCCCTTGTATTTGC 3' and 5' CCTAACAAGCGGAGGCTGGGAAAGC 3', complementary to intronic sequences flanking the Y1 and Y2 exons of B95.8 (co-ordinates 4768747711 and 4806548041 respectively). All PCR products of the appropriate size were gel-purified, cloned into the pGEM-T easy vector (Promega) and the nucleotide sequence was determined for at least three independent clones of each PCR product. The predicted amino acid sequences were aligned using the Pileup program of the Wisconsin Package version 10.2, Genetics Computer Group (GCG), Madison, WI, USA. Nucleotide sequences for the W1W2 and Y1Y2 protein translations presented in Fig. 3 have been deposited in the EMBL database and assigned accession numbers AJ311190, AJ311191, AJ311192, AJ311193, AJ311194, AJ311195, AJ311196, AJ311197, AJ311198 and AJ311199.
Transient transfection and reporter gene assays.
B cell lines were transfected by electroporation as described (Nitsche et al., 1997
) using the combinations of plasmids indicated; where necessary, the total amount of DNA per transfection was equalized using empty pSG5 vector DNA. For measurement of LMP1 induction, Akata-BL cells were harvested at 48 h post-transfection and were analysed by immunoblotting. For reporter assays BJAB cells were harvested at 24 h post-transfection and luciferase activity in total cell extracts was measured as described (Bell et al., 1998
). For EBNA-LP immunofluorescence, HeLa cells were transfected in six-well plates with 2 µg of plasmid DNA using the FuGENE 6 lipid-based transfection reagent (Roche) according to the manufacturers protocol.
Immunoblotting.
JF186, PE2 and CS1 to CS4 monoclonal antibodies (MAbs) were used to detect EBNA-LP, EBNA2 and LMP1 expression respectively in transfected cells. Methods were essentially as described (Nitsche et al., 1997
) except that now a goat anti-mouse IgGperoxidase conjugate (Sigma) was used as a second step and an enhanced chemiluminescence detection kit (ECL; Amersham) was used as a third step. For quantification, duplicate blots were probed with rabbit anti-mouse IgG (DAKO) as a second step and 125I-labelled protein A (Amersham) as a third step, prior to analysis using a Molecular Dynamics Phosphorimager. Autoradiographs presented in Figs 1
, 2(A)
, 4 and 6 were scanned using a UMAX Astra 2000U with Adobe Photoshop 5.0.2 software and were assembled using Microsoft PowerPoint.
|
|
|
Immunofluorescence.| Results |
|---|
|
|
|---|
Deletion analysis of the Y1Y2 exons in the minimal EBNA-LP construct
The requirement for at least two copies of the W1W2 repeat for EBNA-LP co-activating function is well documented (Nitsche et al., 1997
; Harada & Kieff, 1997
). Prior to initiating a more detailed genetic analysis of the two repeat construct, we sought to determine the importance of the unique Y1Y2 domain in this construct by constructing mutants which lacked the Y1 exon-coded sequences, the Y2 exon-coded sequences or the entire Y1Y2 domain (
Y1,
Y2 and
Y1Y2 respectively). Fig. 2(A)
shows the results from a typical experiment involving co-transfection of these mutant constructs along with the EBNA2 plasmid into Akata-BL cells. The lower gel shows that all of the mutant EBNA-LP proteins were stably expressed and migrated at the expected size relative to WT-LP. Mutants
Y2 and
Y1Y2 showed a slight but consistent reduction in their level of expression compared to the WT-LP, for which we compensated by increasing plasmid input from 10 to 20 µg (tracks marked by an asterisk in Fig. 2A
). The upper gel shows the same extracts analysed for the presence of EBNA2 and LMP1 proteins. Cells co-transfected with EBNA2 and the
Y1 mutant of EBNA-LP showed LMP1 levels equal to those in cells co-transfected with EBNA2 and WT-LP, indicating that the Y1 exon is dispensable for co-activation with EBNA2. However deletion of the Y2 exon, either alone or together with Y1, led to a complete loss of co-operative activity (see mutants
Y2 and
Y1Y2 in Fig. 2A
). These results suggest that the Y2 exon is essential for the co-activating function in the context of the (W1W2)2Y1Y2 EBNA-LP isoform.
The defective phenotypes of the
Y1 and
Y1Y2 mutants could result from aberrant cellular localization of the respective proteins. To examine this possibility we used immunofluorescence to study the subcellular localization of the mutants following transfection both in B cells and in HeLa cells. Similar results were obtained in both cell types but for clarity are illustrated in the epithelial (HeLa) cell background. From Fig. 2(B)
, the WT-LP protein and also all three mutants (
Y1,
Y2 and
Y1Y2) demonstrated a diffuse but exclusively nuclear staining.
Sequence conservation among EBNA-LP homologues
Having established that genetic analysis of EBNA-LP function would need to examine the unique as well as the repeat domains, we sought to determine the sequence of the W1, W2, Y1 and Y2 exons of EBNA-LP homologues in simian LCVs. Amplifications of W1W2 sequence were obtained from the LCV genomes of gorilla (H.gorilla), chimpanzee (H.pan), baboon (H.papio) and rhesus (H.rhesus) origin and amplifications of Y1Y2 sequences were obtained in two of these cases (H.gorilla and H.pan). The predicted amino acid sequences of the EBNA-LP homologues are shown in Fig. 3
alongside the standard B95.8 EBV sequence and sequences obtained in parallel from the type 1 EBV strain Akata and from the type 2 EBV strain Eli; for completeness we also include published Y1Y2 sequences for baboon and rhesus LCVs (Peng et al., 2000a
). The W1W2 domain sequences are numbered from the initial proline residue present in all internal repeat domains, and vary in length from 65 to 70 residues. The Y1Y2 domains are numbered separately and vary in length from 44 to 46 residues. These data, which extend previously published results (Peng et al., 2000a
), identify five major conserved regions of interest, CR1CR5, within EBNA-LP and its homologues. Of these, CR1 lies at the N terminus of the W1W2 repeat (and includes the JF186 MAb epitope), CR2 and CR3 lie within W2 and CR4 and CR5 lie within Y2. Conserved positions are identified where in at least six of the seven cases the residues are identical (dark shading) or involve similar amino acids by group (light shading). Serine residues that are potential targets for kinases known to phosphorylate B958 EBNA-LP in vitro (Kitay & Rowe, 1996a
) are marked by asterisks above the sequence. The three serine residues identified in W2 (S34, S36 and S63) lie within potential p34cdc2 sites (minimally SP) and the residue identified in Y2 (S12) lies within a potential casein kinase II site ([S/T]XX[D/E]); of these, W-S36 and Y-S12 are completely conserved.
|
Immunoblotting with JF186 showed that the majority of the mutants produced an EBNA-LP protein of the expected size, with the exception of
CR2 which migrated like WT-LP despite the deletion. From the analysis of LMP1 induction in co-transfected Akata cells, both mutants carrying deletions within the Y2 domain retained detectable activity; the
CR4 mutant was as active as WT-LP whereas the
CR5 mutant reproducibly showed around 50% WT-LP activity. By contrast the
CR1,
CR2 and
CR3 mutants within W2 were completely inactive. Of these CR3 was expressed at lower than wild-type levels but remained inactive even when levels were increased by increasing the input plasmid dose (track marked with an asterisk in Fig. 4
). Interestingly, in cells co-transfected with the defective
CR1 mutant, EBNA2 levels were consistently much lower (in the range 520% over several experiments) than EBNA2 levels observed in co-transfections with any other LP construct. However, by comparison with the dose response assay shown in Fig. 1
, even these reduced amounts of EBNA2 should have been sufficient to achieve full LMP1 induction in the presence of a fully active EBNA-LP.
The localization of these deletion mutant EBNA-LPs was analysed by transfection into HeLa cells and the results of immunofluorescence assays are shown in Fig. 5
. The active
CR4 and the partially active
CR5 mutant showed a clear nuclear localization. Of the mutants which lacked activity,
CR1 was predominantly found in cytoplasmic or perinuclear locations in most of the cells examined, and
CR2 showed an even clearer segregation to cytoplasmic areas; atypical localization of these mutants most likely explains their defective co-operation with EBNA2. In contrast the
CR3 mutant did show nuclear localization, implying that this deletion had affected EBNA-LP function through some mechanism other than simple nuclear import.
|
|
Since the above findings suggest that one or more serine residues in W2 are of critical importance for EBNA-LP function in this assay, we next examined the role of S34, S36 and S63 in more detail, by mutating each residue individually in both copies of W2 to create the mutants W-S34-A, W-S36-A and W-S63-A respectively. All three individual mutants were found to have normal nuclear localization (Fig. 5
and data not shown). Fig. 6(B)
shows the results of analysis of these mutants in the EBNA2 co-transfection assay in Akata-BL cells. The W-S63-A mutant gave rise to similar LMP1 levels as those seen in the presence of WT-LP. By contrast, the W-S34-A mutant typically showed a 5- to 10-fold drop in the level of LMP1 induction, while the mutant W-S36-A failed to induce any LMP1, indicating a complete loss of co-operative function. Since cells co-transfected with W-S34-A, and to a lesser extent W-S36-A, also showed a small but reproducible decrease in the level of EBNA2 protein compared to cells co-transfected with WT-LP, we carried out an additional experiment in which EBNA2 expression plasmid input was increased from 20 to 60 µg. Even under these conditions where the levels of EBNA2 expression were forced to be equivalent (Fig. 6B
right-hand blots), the W-S34-A mutant still caused a 3- to 4-fold drop in the level of LMP1 induction while the W-S36-A mutant gave rise to barely detectable levels of LMP1.
Analysis of the EBNA-LP mutants using a luciferase reporter assay
Finally, in order to establish if the EBNA2 co-activation phenotypes of the WT-LP and the EBNA-LP mutants were reproducible in a different cellular background and at a different EBNA2-responsive promoter, we performed transient transfection assays using a luciferase reporter construct, BamCp8LUC, carrying multimerized copies of the Cp EBNA2 responsive element.
Fig. 7
shows the mean results of several assays done in BJAB cells and involving the co-transfection of the reporter with EBNA2 and/or the relevant EBNA-LP expression construct. As observed in other studies with such a reporter (Harada & Kieff, 1997
; Peng et al., 2000a
), WT-LP had no effect on promoter activity whereas EBNA2 alone caused a 10-fold increase, and the combination of EBNA2 and WT-LP caused a 70- to 130-fold increase. The data in Fig. 7
show that the co-activation function of the EBNA-LP mutants in this second assay, quantified using the activity of EBNA2 as a baseline, broadly reflects the pattern of results noted in the Akata-BL assay. Thus the
Y1 mutant retained wild-type activity whereas the
Y2 and
Y1Y2 mutants were inactive. Furthermore the
CR4 and
CR5 deletion mutants in Y2 did not significantly affect activity, whereas all three deletion mutants in W2,
CR1,
CR2 and
CR3, were again inactive. The triple serine mutant W-S34,36,63-A had no co-operative function but was again associated with reduced, though in this case still detectable, EBNA2 levels in co-transfected cells (data not shown). Of the individual serine mutants, changes at the S63 residue in W2 and the S12 residue in Y2 again had no significant effect, whereas alanine substitution of the S34 residue severely reduced activity (in this case with only marginal reduction in EBNA2 levels) and alanine substitution of S36 completely abrogated function. Essentially similar results were obtained on repeating the luciferase reporter assay in a second B cell line, DG75 (data not shown).
|
| Discussion |
|---|
|
|
|---|
By contrast, all three deletions made in the CR1, CR2 and CR3 regions of the W1W2 repeat domain severely affected EBNA-LP function (Figs 4
and 7
). In the case of the
CR1 and
CR2 mutants, loss of activity correlated with a failure of nuclear localization (Fig. 5
). This is consistent with a recent report suggesting that these two domains constitute a bipartite nuclear localization signal (NLS) for EBNA-LP (Peng et al., 2000 b
). In this context the region deleted in CR1 contains at least three basic residues in all LCVs studied with the exception of H.gorilla, while the stronger CR2 NLS always contains four or more basic residues including a fully conserved RRRV motif previously noted to be similar to the PRRRV NLS motif of Semliki Forest virus nsp2 protein (Rikkonen et al., 1992
; Szekely et al., 1995
). EBNA-LP is known to bind cellular hsp70 (Mannick et al., 1995
; Kitay & Rowe, 1996b
) and it would be of interest to determine if either of these mutants retained this interaction since certain hsp70 binding peptides are similar to known NLS elements (Fourie et al., 1994
). It is even possible that EBNA-LP accesses the nucleus through this interaction and indeed the region deleted in the CR1 mutation has previously been proposed to be a potential mediator of hsp70 binding (Mannick et al., 1995
).
More importantly, deletion of the CR3 domain within W2 completely abrogated function in both assays without affecting nuclear localization. At least three adjacent acidic residues are found at this location in the EBNA-LP homologues of all LCVs studied to date, as is a well-conserved serine (at position 61 in B95.8). Interestingly, in another study substitutions replacing either the three acidic residues within CR3 or replacing S61 and its adjacent residues had relatively little effect on EBNA-LP function (Peng et al., 2000b
). The present data therefore represent the first indication that the CR3 domain is critical for function. Although such a deletion may have allosteric effects on the EBNA-LP molecule, it is possible that the CR3 region directly mediates proteinprotein interactions necessary for EBNA-LPs co-operation with EBNA2. It would therefore be interesting to examine the capacity of CR3 mutant proteins to interact with reported EBNA-LP binding proteins, such as DNA-PKcs, HA95, hsp70 and HAX-1, to ask whether any of these interactions co-segregates with EBNA-LPs co-operative function (Mannick et al., 1995
; Kitay & Rowe, 1996b
; Kawaguchi et al., 2000
; Dufva et al., 2001
; Han et al., 2001
).
Previous work has shown that EBNA-LP is progressively phosphorylated on serine residues with cell cycle transit and has speculated on the potential importance of three serine residues within W2, S34, S36 and S63, which represent potential consensus sites for p34cdc2 phosphorylation (Kitay & Rowe, 1996a
). Of these, mutation of S63 to alanine had no effect upon EBNA-LP function whereas mutation of S34 caused an 8090% inhibition and mutation of S36 completely abrogated co-operativity with EBNA2, both in the LMP1 induction assay (Fig. 6B
) and in the reporter construct assay (Fig. 7
). Such loss of activity could not be explained by effects on nuclear localization nor, at least in the case of S36, by effects on available EBNA2 levels in co-transfected cells. Interestingly, S36 is the only one of the three serine residues which is perfectly conserved among all LCV isolates and represents the best match for the extended p34cdc2 consensus motif of [S/T]PX[K/R] (Holmes & Solomon, 1996
). We therefore infer a critical role for the S36 residue in EBNA-LP co-operative function; recent studies have also made a similar suggestion although in that report the effect of S36 mutation was less marked (Peng et al., 2000b
). Interestingly, we noted that mutation of S36 to glutamic acid in the context of triple mutant W-S34,36,63-E did not disrupt EBNA-LP co-operative function in either Akata-BL or reporter gene assays. Since substitution with glutamic acid is known to mimic the functional effects of constitutive phosphorylation, while alanine substitution blocks any such modification, we speculate that active phosphorylation of S36 is required for EBNA-LP activity. This hypothesis is supported by the recent findings of Yokoyama et al. (2001)
, who reported that S36 is the major phosphorylation site in EBNA-LP. From the present data we do not yet know whether the milder inhibitory effect of mutating S34 to alanine might be explained through altering the conformation of the nearby S36 residue, or reflects a direct role for S34 as a second regulatory site; on this point, it is interesting to note that a fragment corresponding to the W2 domain of EBNA-LP has been shown to be weakly phosphorylated even in the presence of the S36A substitution (Yokoyama et al., 2001
).
Finally, the serine mutant analysis provided the most extreme example of an unexpected feature of these experiments, which was that certain EBNA-LP mutants were consistently associated with lower levels of EBNA2 protein being observed in co-transfected cells, especially in the Akata-based assay. Thus the triple serine mutant W-S34,36,63-A, in which all three W2 serines were mutated to alanines, was well expressed post-transfection yet EBNA2 was either completely undetectable (in Akata-BL cells; Fig. 6A
) or much reduced (in BJAB and DG75 cells; data not shown). Interestingly, two other constructs, the W-S34-A substitution and the
CR1 deletion mutants, were also associated with reduced EBNA2 levels which in the Akata-BL system had fallen to approximately 30% and 520% respectively of those seen in cells co-transfected with EBNA2 and WT-LP. The mechanism underlying these effects is not yet understood but seems unlikely to involve an inhibition of transcription from the pSG5 vector used to express EBNA2 in these experiments. Thus the EBNA-LP mutants were themselves expressed from a similar pSG5-based construct. Also, we found no comparable effects of the above EBNA-LP mutants on levels of EBNA1 or LMP1 proteins expressed from pSG5 vectors in Akata-BL, BJAB or DG75 cells (data not shown). One interesting possibility is that wild-type EBNA-LP functionally co-operates with EBNA2 via a direct or indirect interaction and that certain mutants of EBNA-LP can alter the complex in such a way as to target EBNA2 for degradation.
It is known that EBNA2 can interact with a range of transcription factors including RBP-J
, PU.1 and the ATF-2/c-Jun heterodimer, all of which are thought to be important in targeting the viral protein to particular promoters. In addition, the C-terminal acidic activation domain of EBNA2 can interact with various subunits of the basal RNA polymerase II transcription complex (TAF40, TFIIB, TFIIH), with the novel TFIIE-contacting protein p100 and with the histone acetyltransferases p300 and CBP (Tong et al., 1995a
, b
, c
; Jayachandra et al., 1999
; Wang et al., 2000
). The fact that the co-operative function of EBNA-LP, as measured in reporter assays, appears to be specific for the above EBNA2 C-terminal domain (Harada & Kieff, 1997
) suggests that EBNA-LP may act by increasing the recruitment or affinity of transcription components at that domain. Consistent with this idea is the recent observation that overexpression of one of these recruited proteins, p300, can substitute for EBNA-LP in the Akata cell assay of LMP1 induction (Wang et al., 2000
). In identifying specific EBNA-LP mutations which abrogate co-operative function, the present paper provides important tools with which to investigate further the biochemical basis of EBNA-LP/EBNA2 co-activation.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Alfieri, C., Birkenbach, M. & Kieff, E. (1991). Early events in EpsteinBarr virus infection of human B lymphocytes. Virology 181, 595-608.[Medline]
Bell, A. I., Skinner, J., Kirby, H. & Rickinson, A. (1998). Characterization of regulatory sequences at the EpsteinBarr virus BamHI W promoter. Virology 252, 149-161.[Medline]
Cohen, J. I., Wang, F., Mannick, J. & Kieff, E. (1989). EpsteinBarr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proceedings of the National Academy of Sciences, USA 86, 9558-9562.
Cordier, M., Calender, A., Billaud, M., Zimber, U., Rousselet, G., Pavlish, O., Banchereau, J., Tursz, T., Bornkamm, G. & Lenoir, G. M. (1990). Stable transfection of EpsteinBarr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23. Journal of Virology 64, 1002-1013.
Dufva, M., Olsson, M. & Rymo, L. (2001). EpsteinBarr virus nuclear antigen 5 interacts with HAX-1, a possible component of the B cell receptor signalling pathway. Journal of General Virology 82, 1581-1587.
Fourie, A. M., Sambrook, J. F. & Gething, M. J. (1994). Common and divergent peptide binding specificities of hsp70 molecular chaperones. Journal of Biological Chemistry 269, 30470-30478.
Grossman, S. R., Johannsen, E., Tong, X., Yalamanchili, R. & Kieff, E. (1994). The EpsteinBarr virus nuclear antigen 2 transactivator is directed to response elements by the J kappa recombination signal binding protein. Proceedings of the National Academy of Sciences, USA 91, 7568-7572.
Hammerschmidt, W. & Sugden, B. (1989). Genetic analysis of immortalizing functions of EpsteinBarr virus in human B lymphocytes. Nature 340, 393-397.[Medline]
Han, I., Harada, S., Weaver, D., Xue, Y., Lane, W., Orstavik, S., Skalhegg, B. & Kieff, E. (2001). EBNA-LP associates with cellular proteins including DNA-PK and HA95. Journal of Virology 75, 2475-2481.
Harada, S. & Kieff, E. (1997). EpsteinBarr virus nuclear protein LP stimulates EBNA-2 acidic domain-mediated transcriptional activation. Journal of Virology 71, 6611-6618.[Abstract]
Henkel, T., Ling, P. D., Hayward, S. D. & Peterson, M. G. (1994). Mediation of EpsteinBarr virus EBNA2 transactivation by recombination signal-binding protein J kappa. Science 265, 92-95.
Holmes, J. K. & Solomon, M. J. (1996). A predictive scale for evaluating cyclin-dependent kinase substrates. A comparison of p34cdc2 and p33cdk2. Journal of Biological Chemistry 271, 25240-25246.
Jayachandra, S., Low, K. G., Thlick, A. E., Yu, J., Ling, P. D., Chang, Y. & Moore, P. S. (1999). Three unrelated viral transforming proteins (vIRF, EBNA2, and E1A) induce the MYC oncogene through the interferon-responsive PRF element by using different transcription coadaptors. Proceedings of the National Academy of Sciences, USA 96, 11566-11571.
Kaiser, C., Laux, G., Eick, D., Jochner, N., Bornkamm, G. W. & Kempkes, B. (1999). The proto-oncogene c-myc is a direct target gene of EpsteinBarr virus nuclear antigen 2. Journal of Virology 73, 4481-4484.
Kawaguchi, Y., Nakajima, K., Igarashi, M., Morita, T., Tanaka, M., Suzuki, M., Yokoyama, A., Matsuda, G., Kato, K., Kanamori, M. & Hirai, K. (2000). Interaction of EpsteinBarr virus nuclear antigen leader protein (EBNA-LP) with HS1-associated protein X-1: implication of cytoplasmic function of EBNA-LP. Journal of Virology 74, 10104-10111.
Kieff, E. (1996). EpsteinBarr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Kitay, M. K. & Rowe, D. T. (1996a). Cell cycle stage-specific phosphorylation of the EpsteinBarr virus immortalization protein EBNA-LP. Journal of Virology 70, 7885-7893.[Abstract]
Kitay, M. K. & Rowe, D. T. (1996b). Proteinprotein interactions between EpsteinBarr virus nuclear antigen-LP and cellular gene products: binding of 70-kilodalton heat shock proteins. Virology 220, 91-99.[Medline]
Knutson, J. C. (1990). The level of c-fgr RNA is increased by EBNA-2, an EpsteinBarr virus gene required for B-cell immortalization. Journal of Virology 64, 2530-2536.
Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]
Laux, G., Adam, B., Strobl, L. J. & Moreaugachelin, F. (1994a). The Spi-1/Pu.1 and Spi-B Ets family transcription factors and the recombination signal binding-protein RBP-J-Kappa interact with an EpsteinBarr-virus nuclear antigen-2 responsive cis-element. EMBO Journal 13, 5624-5632.[Medline]
Laux, G., Dugrillon, F., Eckert, C., Adam, B., Zimber-Strobl, U. & Bornkamm, G. W. (1994b). Identification and characterization of an EpsteinBarr-virus nuclear antigen 2-responsive cis-element in the bidirectional promoter region of latent membrane-protein and terminal protein-2 genes. Journal of Virology 68, 6947-6958.
Lee, M. A., Diamond, M. E. & Yates, J. L. (1999). Genetic evidence that EBNA-1 is needed for efficient, stable latent infection by EpsteinBarr virus. Journal of Virology 73, 2974-2982.
Mannick, J. B., Cohen, J. I., Birkenbach, M., Marchini, A. & Kieff, E. (1991). The EpsteinBarr virus nuclear protein encoded by the leader of the EBNA RNAs is important in B-lymphocyte transformation. Journal of Virology 65, 6826-6837.
Mannick, J. B., Tong, X., Hemnes, A. & Kieff, E. (1995). The EpsteinBarr virus nuclear antigen leader protein associates with hsp72/hsc73. Journal of Virology 69, 8169-8172.[Abstract]
Moghaddam, A., Koch, J., Annis, B. & Wang, F. (1998). Infection of human B lymphocytes with lymphocryptoviruses related to EpsteinBarr virus. Journal of Virology 72, 3205-3212.
Nitsche, F., Bell, A. I. & Rickinson, A. (1997). EpsteinBarr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. Journal of Virology 71, 6619-6628.[Abstract]
Peng, R., Gordadze, A. V., Fuentes-Panana, E. M., Wang, F., Zong, J., Hayward, G. S., Tan, J. & Ling, P. D. (2000a). Sequence and functional analysis of EBNA-LP and EBNA2 proteins from nonhuman primate lymphocryptoviruses. Journal of Virology 74, 379-389.
Peng, R., Tan, J. & Ling, P. D. (2000b). Conserved regions in the EpsteinBarr virus leader protein define distinct domains required for nuclear localization and transcriptional cooperation with EBNA2. Journal of Virology 74, 9953-9963.
Rabin, H., Strnad, B. C., Neubauer, R. H., Brown, A. M., Hopkins, R. F. & Mazur, R. A. (1980). Comparisons of nuclear antigens of EpsteinBarr virus (EBV) and EBV-like simian viruses. Journal of General Virology 48, 265-272.
Rikkonen, M., Peranen, J. & Kaariainen, L. (1992). Nuclear and nucleolar targeting signals of Semliki Forest virus nonstructural protein nsP2. Virology 189, 462-473.[Medline]
Robertson, E. S., Grossman, S. R., Johannsen, E., Miller, C., Lin, J., Tomkinson, B. & Kieff, E. (1995). EpsteinBarr-virus nuclear-protein 3C modulates transcription through interaction with the sequence-specific DNA-binding protein J-Kappa. Journal of Virology 69, 3108-3116.[Abstract]
Sample, J., Hummel, M., Braun, D., Birkenbach, M. & Kieff, E. (1986). Nucleotide sequences of mRNAs encoding EpsteinBarr virus nuclear proteins: a probable transcriptional initiation site. Proceedings of the National Academy of Sciences, USA 83, 5096-5100.
Sample, J., Young, L., Martin, B., Chatman, T., Kieff, E. & Rickinson, A. (1990). EpsteinBarr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. Journal of Virology 64, 4084-4092.
Sinclair, A. J., Palmero, I., Peters, G. & Farrell, P. J. (1994). EBNA-2 and EBNA-LP cooperate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by EpsteinBarr virus. EMBO Journal 13, 3321-3328.[Medline]
Sung, N. S., Kenney, S., Gutsch, D. E. & Pagano, J. S. (1991). EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of EpsteinBarr virus. Journal of Virology 65, 2164-2169.
Szekely, L., Jiang, W. Q., Pokrovskaja, K., Wiman, K. G., Klein, G. & Ringertz, N. (1995). Reversible nucleolar translocation of EpsteinBarr virus-encoded EBNA-5 and hsp70 proteins after exposure to heat shock or cell density congestion. Journal of General Virology 76, 2423-2432.
Tomkinson, B., Robertson, E. & Kieff, E. (1993). EpsteinBarr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. Journal of Virology 67, 2014-2025.
Tong, X., Drapkin, R., Yalamanchili, R., Mosialos, G. & Kieff, E. (1995a). The EpsteinBarr virus nuclear protein 2 acidic domain forms a complex with a novel cellular coactivator that can interact with TFIIE. Molecular and Cellular Biology 15, 4735-4744.[Abstract]
Tong, X., Drapkin, R., Reinberg, D. & Kieff, E. (1995b). The 62-Kda and 80-Kda subunits of transcription factor IIH mediate the interaction with EpsteinBarr virus nuclear protein-2. Proceedings of the National Academy of Sciences, USA 92, 3259-3263.
Tong, X., Wang, F., Thut, C. J. & Kieff, E. (1995c). The EpsteinBarr virus nuclear protein 2 acidic domain can interact with TFIIB, TAF40, and RPA70 but not with TATA-binding protein. Journal of Virology 69, 585-588.[Abstract]
Wang, F., Tsang, S. F., Kurilla, M. G., Cohen, J. I. & Kieff, E. (1990). EpsteinBarr virus nuclear antigen 2 transactivates latent membrane protein LMP1. Journal of Virology 64, 3407-3416.
Wang, L., Grossman, S. R. & Kieff, E. (2000). Epstein-Barr virus nuclear protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in activation of the LMP1 promoter. Proceedings of the National Academy of Sciences, USA 97, 430-435.
Yokoyama, A., Tanaka, M., Matsuda, G., Kato, K., Kanamori, M., Kawasaki, H., Hirano, H., Kitabayashi, I., Ohki, M., Hirai, K. & Kawaguchi, Y. (2001). Identification of major phosphorylation sites of EpsteinBarr virus nuclear antigen leader protein (EBNA-LP): ability of EBNA-LP to induce latent membrane protein 1 cooperatively with EBNA2 is regulated by phosphorylation. Journal of Virology 75, 5119-5128.
Young, L. S., Dawson, C. W. & Eliopoulos, A. G. (2000). The expression and function of EpsteinBarr virus encoded latent genes. Journal of Clinical Pathology: Molecular Pathology 53, 238-247.
Zhao, B., Marshall, D. R. & Sample, C. E. (1996). A conserved domain of the EpsteinBarr virus nuclear antigens 3A and 3C binds to a discrete domain of J kappa. Journal of Virology 70, 4228-4236.[Abstract]
Zimber-Strobl, U., Suentzenich, K. O., Laux, G., Eick, D., Cordier, M., Calender, A., Billaud, M., Lenoir, G. M. & Bornkamm, G. W. (1991). EpsteinBarr virus nuclear antigen 2 activates transcription of the terminal protein gene. Journal of Virology 65, 415-423.
Zimber-Strobl, U., Strobl, L. J., Meitinger, C., Hinrichs, R., Sakai, T., Furukawa, T., Honjo, T. & Bornkamm, G. W. (1994). EpsteinBarr virus nuclear antigen 2 exerts its transactivating function through interaction with recombination signal binding-protein RBP-J-Kappa, the homolog of Drosophila Suppressor of Hairless. EMBO Journal 13, 4973-4982.[Medline]
Received 23 May 2001;
accepted 5 September 2001.
This article has been cited by other articles:
![]() |
P. D. Ling, J. Tan, and R. Peng Nuclear-Cytoplasmic Shuttling Is Not Required for the Epstein-Barr Virus EBNA-LP Transcriptional Coactivation Function J. Virol., July 15, 2009; 83(14): 7109 - 7116. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Lucchesi, G. Brady, O. Dittrich-Breiholz, M. Kracht, R. Russ, and P. J. Farrell Differential Gene Regulation by Epstein-Barr Virus Type 1 and Type 2 EBNA2 J. Virol., August 1, 2008; 82(15): 7456 - 7466. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tierney, J. Nagra, I. Hutchings, C. Shannon-Lowe, M. Altmann, W. Hammerschmidt, A. Rickinson, and A. Bell Epstein-Barr Virus Exploits BSAP/Pax5 To Achieve the B-Cell Specificity of Its Growth-Transforming Program J. Virol., September 15, 2007; 81(18): 10092 - 10100. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Garibal, E. Hollville, A. I. Bell, G. L. Kelly, B. Renouf, Y. Kawaguchi, A. B. Rickinson, and J. Wiels Truncated Form of the Epstein-Barr Virus Protein EBNA-LP Protects against Caspase-Dependent Apoptosis by Inhibiting Protein Phosphatase 2A J. Virol., July 15, 2007; 81(14): 7598 - 7607. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Peng, B. Zhao, H.-C. Chen, M.-L. Chou, C.-Y. Lai, S.-Z. Lin, H.-Y. Hsu, and E. Kieff Hsp72 up-regulates Epstein-Barr virus EBNALP coactivation with EBNA2 Blood, June 15, 2007; 109(12): 5447 - 5454. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Portal, A. Rosendorff, and E. Kieff Epstein-Barr nuclear antigen leader protein coactivates transcription through interaction with histone deacetylase 4 PNAS, December 19, 2006; 103(51): 19278 - 19283. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Fogg, A. Kaur, Y.-G. Cho, and F. Wang The CD8+ T-Cell Response to an Epstein-Barr Virus-Related Gammaherpesvirus Infecting Rhesus Macaques Provides Evidence for Immune Evasion by the EBNA-1 Homologue J. Virol., October 15, 2005; 79(20): 12681 - 12691. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Chiou, K.-C. Chow, C.-H. Yang, S.-F. Chiang, and C.-H. Lin Discovery of Epstein-Barr virus (EBV)-encoded RNA signal and EBV nuclear antigen leader protein DNA sequence in pet dogs J. Gen. Virol., April 1, 2005; 86(4): 899 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Peng, S. C. Moses, J. Tan, E. Kremmer, and P. D. Ling The Epstein-Barr Virus EBNA-LP Protein Preferentially Coactivates EBNA2-Mediated Stimulation of Latent Membrane Proteins Expressed from the Viral Divergent Promoter J. Virol., April 1, 2005; 79(7): 4492 - 4505. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Peng, B. Zhao, and E. Kieff Four EBNA2 Domains Are Important for EBNALP Coactivation J. Virol., October 15, 2004; 78(20): 11439 - 11442. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kanamori, S. Watanabe, R. Honma, M. Kuroda, S. Imai, K. Takada, N. Yamamoto, Y. Nishiyama, and Y. Kawaguchi Epstein-Barr Virus Nuclear Antigen Leader Protein Induces Expression of Thymus- and Activation-Regulated Chemokine in B Cells J. Virol., April 15, 2004; 78(8): 3984 - 3993. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kato, A. Yokoyama, Y. Tohya, H. Akashi, Y. Nishiyama, and Y. Kawaguchi Identification of protein kinases responsible for phosphorylation of Epstein-Barr virus nuclear antigen leader protein at serine-35, which regulates its coactivator function J. Gen. Virol., December 1, 2003; 84(12): 3381 - 3392. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ning, A. M. Hahn, L. E. Huye, and J. S. Pagano Interferon Regulatory Factor 7 Regulates Expression of Epstein-Barr Virus Latent Membrane Protein 1: a Regulatory Circuit J. Virol., September 1, 2003; 77(17): 9359 - 9368. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Igarashi, Y. Kawaguchi, K. Hirai, and F. Mizuno Physical interaction of Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) with human oestrogen-related receptor 1 (hERR1): hERR1 interacts with a conserved domain of EBNA-LP that is critical for EBV-induced B-cell immortalization J. Gen. Virol., January 1, 2003; 84(2): 319 - 327. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |