J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Soussan, P.
Right arrow Articles by Kremsdorf, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soussan, P.
Right arrow Articles by Kremsdorf, D.
Agricola
Right arrow Articles by Soussan, P.
Right arrow Articles by Kremsdorf, D.
Journal of General Virology (2001), 82, 367-371.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Vaccination of chronic hepatitis B virus carriers with preS2/S envelope protein is not associated with the emergence of envelope escape mutants

Patrick Soussan1, Stanislas Pol2, Florianne Garreau1, Christian Bréchot1,2 and Dina Kremsdorf1

INSERM U3701 and Liver Unit2, CHU Necker, Faculté de Médecine Necker Enfants-Malades, 156 rue de Vaugirard, 75015 Paris, France

Author for correspondence: Dina Kremsdorf. Fax +33 1 40 61 55 81. e-mail kremsdor{at}necker.fr


   Abstract
TOP
Abstract
Main text
References
 
PreS2/S vaccination of chronic hepatitis B virus (HBV) carriers led to a reduction in HBV replication or clearance of virus in 30% of treated patients. This study assessed whether vaccinotherapy of chronic HBV carriers induced the selection of escape mutants in the envelope ‘a’ determinant and whether envelope genetic variability might affect the response to vaccination. No amino acid differences were observed in the ‘a’ determinant between sequences obtained before and after treatment (five responders and seven non-responders). However, alignment with HBV prototype sequences revealed seven amino acid changes. Two mutations (T140S and P127L) diverged from subtype variations. In the complete envelope sequence (five non-responders and five responders), ten amino acid modifications were detected between sequences obtained before and after treatment. The absence of any common mutations did not enable the definition of a hot spot of mutations implicated in the response to vaccination. Moreover, vaccinotherapy does not induce the selection of escape mutants in the ‘a’ determinant.


   Main text
TOP
Abstract
Main text
References
 
The human hepatitis B virus (HBV) is a DNA virus that causes chronic infections that frequently lead to the development of cirrhosis and cellular hepatocellular carcinoma (Chisari & Ferrari, 1995Down ). Antiviral therapies such as interferon-{alpha} stably inhibit HBV replication in about 20–30% of chronic carriers (Niederau et al., 1996Down ; Wright & Lau, 1993Down ). Nucleoside analogues such as lamivudine have exhibited highly effective antiviral activity, but mutations in the viral genome are frequently associated with a recurrence of HBV replication (Fontaine et al., 1999Down ; Zoulim & Trepo, 1999Down ). In this context, a new approach to HBV treatment has been proposed, consisting of immunotherapy using vaccination with recombinant envelope proteins (Pol et al., 1994Down , 2000Down ). Clinical trials have suggested a reduction of at least 50% or clearance of HBV replication in about 30% of chronic HBV carriers 3 months after three monthly doses of S (Recombivax) or preS2/S (GenHevac B) vaccines (Pol et al., 1994Down , 2000Down ). This is reinforced further by an induction of the CD4+ T cell response during this treatment (Couillin et al., 1999Down ). Other vaccine strategies based on single-epitope CTL or HBV vaccine and anti-HBs complex have been also envisaged (Heathcote et al., 1999Down ; Wen et al., 1995Down ).

It is well established that HBV surface antigen (HBsAg) is a major target of the humoral and cellular immune response against HBV. Within HBsAg, the ‘a’ determinant is an important target of the humoral immune response (Brown et al., 1984Down ). The antigenic ‘a’ determinant (residues 124–147) has a highly conformational structure that consists of two loops held by disulphide bridges (cysteines 124–137 and 139–147) projecting from the virus surface (Brown et al., 1984Down ). In recent years, envelope mutants have been detected following vaccination or anti-HBs immunoglobulin therapy. Vaccine-associated HBsAg mutations have principally been identified in the ‘a’ determinant (Carman et al., 1993Down ). These mutants, possibly selected under vaccine pressure, may escape neutralization by vaccine-induced anti-HBs (Hsu et al., 1999Down ). However, such HBV mutants are also present in chronic, asymptomatic HBV carriers. The most frequently identified mutation is the glycine-to-arginine change at position 145 of HBsAg (Carman et al., 1990Down , 1993Down ). This mutation has, in particular, been identified in HBV-infected children vaccinated against HBV and living in regions of virus endemicity (Oon et al., 1995Down ). Amino acid changes have been also identified in the ‘a’ determinant in liver transplant recipients treated with monoclonal or polyclonal anti-HBs immunoglobulin (Carman et al., 1996Down ; McMahon et al., 1992Down ; Protzer-Knolle et al., 1998Down ).

HBV vaccination of chronic HBV carriers is a promising therapeutic strategy. However, an important issue when designing future trials is to assess whether vaccine therapy in HBV chronic carriers may induce the selection of escape mutants. In this context, the aim of this study was to determine whether the vaccination of chronic HBV carriers would induce the selection of a mutant in the antigenic ‘a’ determinant and whether HBV envelope genetic variability might affect the response of chronic carriers to vaccination.

The 19 patients investigated have participated in a pilot clinical study concerning the vaccination of 32 chronic HBV carriers with active HBV replication (Pol et al., 1994Down ). Vaccination consisted of three intramuscular injections of GenHevac B (HBsAg and pre-S2 protein, Pasteur-Mérieux) at 1-month intervals. The response to vaccinotherapy was defined by a reduction of at least 50% of serum HBV DNA 3 months after the last injection (tested by using the Quantiplex bDNA branch or Murex kit).

HBV serological markers, virus load and sequence analysis of the antigenic ‘a’ determinant were studied in 12 patients (five responders and seven non-responders) before and 6 and/or 12 months after vaccinotherapy (Table 1Down; Fig. 1Down). The HBV serological pattern of patients was assessed by using a standard enzyme immunoassay (Abbott). All patients were HBsAg- and hepatitis B e antigen (HBeAg)-positive before vaccinotherapy. Anti-HBe was detected in four of five responders (Table 1Down). For the last responder patient (no. 21), anti-HBe was detected 21 months after initiation of treatment (data not shown). HBV sequences of the antigenic ‘a’ determinant were compared first with HBV subtypes (Fig. 1Down). Eight of the sequences were related to the adw2 subtype (cases 3, 12, 17, 21, 22, 24, 29 and 30) and four to the ayw2 subtype (cases 5, 10, 16 and 50). A response to vaccination was observed in patients infected with the ayw (2/4) and adw (3/8) subtypes. Vaccine therapy was undertaken with the GenHevac B vaccine (Pasteur-Mérieux) containing HBs and preS2 proteins from the ayw subtype. The sequence data thus demonstrated that a response to vaccination was independent of the infecting strain. This agreed with previous findings, demonstrating that the epitopes recognized after vaccinotherapy are present in conserved regions of the proteins (Couillin et al., 1999Down ). No differences were observed in the sequences obtained before and after treatment from any of the patients, whether or not they responded to vaccination (Fig. 1Down). This result suggests that vaccinotherapy does not induce the emergence of escape mutants in the ‘a’ antigenic determinant.


View this table:
[in this window]
[in a new window]
 
Table 1. Virological features of HBV carriers during vaccinotherapy

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Amino acid sequences of the antigenic ‘a’ determinant of non-responder (NR) and responder (R) patients, before (M0) and 6 (M6) and/or 12 (M12) months after vaccination. After PCR amplification of the HBV envelope gene from serum with sense and antisense primers 5' CTGCAGGGGTCACCATATTCTTGG 3' (2812–2837) and 5' GACATACTTTCCAATCAATA 3' (895–876), direct sequencing was performed by using HBV envelope internal primers (Gerken et al., 1991Down ). Samples from three responders, obtained 1 year after vaccination, failed to be amplified. The sequence at the top corresponds to ayw2 or adw2 HBV and numbers indicate the amino acid position in the major S antigen. The single letter code for amino acids is used. Homologous amino acids from the M0 sequence are indicated by dashes. Underlined amino acids correspond to variations compared with HBV subtype ayw2 or adw2.

 
When the ‘a’ determinant sequences obtained before and after vaccination were compared with ayw2 and adw2 subtype sequences, amino acid variations were observed in the sequences of three non-responders (nos 5, 10 and 30) and one responder (no. 21) (Fig. 1Up). Five of seven substitutions corresponded to amino acid changes from subtype ayw2 to ayw3 or adw2 (M125T and P127T for patient 10; Y134F for patient 5) or from subtype adw2 to ayw (N131T for patients 21 and 30; T143S for patient 30). Amino acid changes P127T, N131T and Y134F have been described previously as being involved in d/y subtype specificity (Gerin et al., 1983Down ). Substitutions M125T and T143S have been described previously; however, these were not thought to be important for ayw/adw subtype specificity but, rather, to reflect genotype variations (Norder et al., 1993Down ; Protzer-Knolle et al., 1998Down ). In addition, P127T, Y134F and T143S substitutions were also observed in livers of transplanted patients reinfected despite hepatitis B immune globulin prophylaxis (Ghany et al., 1998Down ). In two non-responder patients (nos 5 and 30), the observed amino acid changes (T140S for both patients; P127L for patient 30) have not been assigned to subtype variations. However, these substitutions have been reported in E and F strains originating in aboriginal populations of Africa and the New World, respectively (Magnius & Norder, 1995Down ; Norder et al., 1993Down ; Protzer-Knolle et al., 1998Down ). In addition, substitution T140S has been defined previously as an escape mutant in transplanted HBV chronic carriers (McMahon et al., 1992Down ). In order to determine whether these two mutations (present in two of seven non-responders) could be implicated in a non-response phenotype, we performed sequence analyses on seven additional non-responder patients 1 year after the beginning of the trial. Neither the P127L and T140S substitutions, nor changes independent of subtype variation, were observed. Thus, these variations are probably not involved in the non-responder pattern. However, further study with a larger number of patients will be necessary to confirm this finding.

In order to investigate the potential role of HBV genetic variability outside the antigenic ‘a’ determinant in the response to vaccination, the complete sequences of the envelope proteins of five non-responders and five responders were obtained before and 6 months after vaccination. Table 2Down summarizes the genetic variations observed when the pre- and post-treatment sequences were compared. A total of ten amino acid changes were observed in six patients. These changes were detected regardless of the response to treatment. However, the same amino acid change was never seen in more than one patient. Thus, we could not define a specific domain implicated in the response to vaccinotherapy. In one patient, the mutation at position 216 in the S domain introduced a stop codon, deleting the last 11 amino acids of the envelope protein. Two substitutions (S115T in preS1 and T54P in preS2) corresponded to subtype variations. Amino acid changes G16D, T55A in preS1 and Q122K in the S domain corresponded to a reversion to a wild-type sequence. The variation at position 122 in the S domain has been described previously as being important for the recognition of antibodies against the d/y subtype epitope (Okamoto et al., 1989Down ). This type of reversion from mutated to wild-type HBsAg had been reported between a mother and her vaccinated child (Chong-Jin et al., 1999Down ). The last four mutations (H60P, Q89R and P96T in preS1 and E164G in S) did not correspond to subtype variations. Two of these substitutions (Q89R and P96T), identified in two responder patients, were located in preS1 domains involved in the B cell response. The E164G mutation located in the S domain was observed in a non-responder patient. The implications of this amino acid change as an escape mutant require further investigation.


View this table:
[in this window]
[in a new window]
 
Table 2. Amino acid substitutions in the HBV envelope protein before and 6 months after vaccination

 
In conclusion, our data highlight two important pieces of information. Firstly, vaccinotherapy did not select escape mutants in the antigenic ‘a’ determinant. However, it cannot be excluded that, in some patients, pre-existing mutations in the ‘a’ determinant may play a role in the response to vaccination. Secondly, outside the ‘a’ determinant, our study identified a number of amino acid substitutions (mostly located in preS1) following vaccination. The absence of common mutations did not allow us to define a hot spot for mutations implicated in the pattern of response to vaccinotherapy. The amino acid substitution pattern observed during this short period (6 months) in the complete envelope sequence could be consistent with an attempt by the virus to escape from the pressure induced after vaccination. Collectively, such investigations should contribute to the understanding of the basis of active immunotherapy of HBV chronic carriers.


   Acknowledgments
 
We would like to thank F. De Felice (Liver Unit, Necker, Paris, France) for technical assistance. This work was supported by grants from INSERM (Institut National de la Santé et de la Recherche Médicale) and ARC (Association pour la Recherche contre le Cancer). P.S. was also supported by INSERM.


   References
TOP
Abstract
Main text
References
 
Brown, S. E., Howard, C. R., Zuckerman, A. J. & Steward, M. W. (1984). Affinity of antibody responses in man to hepatitis B vaccine determined with synthetic peptides. Lancet ii, 184–187.

Carman, W. F., Zanetti, A. R., Karayiannis, P., Waters, J., Manzillo, G., Tanzi, E., Zuckerman, A. J. & Thomas, H. C.(1990). Vaccine-induced escape mutant of hepatitis B virus. Lancet 336, 325-329.[Medline]

Carman, W., Thomas, H. & Domingo, E.(1993). Viral genetic variation: hepatitis B virus as a clinical example. Lancet 341, 349-353.[Medline]

Carman, W. F., Trautwein, C., van Deursen, F. J., Colman, K., Dornan, E., McIntyre, G., Waters, J., Kliem, V., Muller, R., Thomas, H. C. & Manns, M. P.(1996). Hepatitis B virus envelope variation after transplantation with and without hepatitis B immune globulin prophylaxis. Hepatology 24, 489-493.[Medline]

Chisari, F. V. & Ferrari, C.(1995). Hepatitis B virus immunopathogenesis. Annual Review of Immunology 13, 29-60.[Medline]

Chong-Jin, O., Wei Ning, C., Shiuan, K. & Gek Keow, L.(1999). Identification of hepatitis B surface antigen variants with alterations outside the ‘a’ determinant in immunized Singapore infants. Journal of Infectious Diseases 179, 259-263.[Medline]

Couillin, I., Pol, S., Mancini, M., Driss, F., Brechot, C., Tiollais, P. & Michel, M. L.(1999). Specific vaccine therapy in chronic hepatitis B: induction of T cell proliferative responses specific for envelope antigens. Journal of Infectious Diseases 180, 15-26.[Medline]

Fontaine, H., Thiers, V. & Pol, S.(1999). Hepatitis B virus genotypic resistance to lamivudine. Annals of Internal Medicine 131, 716-717.[Free Full Text]

Gerin, J. L., Alexander, H., Shih, J. W. K., Purcell, R. H., Dapolito, G., Engle, R., Green, N., Sutcliffe, J. G., Shinnick, T. M. & Lerner, R. A.(1983). Chemically synthesized peptides of hepatitis B surface antigen duplicate the d/y specificities and induce subtype-specific antibodies in chimpanzees. Proceedings of the National Academy of Sciences, USA 80, 2365-2369.[Abstract/Free Full Text]

Gerken, G., Paterlini, P., Manns, M., Housset, C., Terre, S., Dienes, H. P., Hess, G., Gerlich, W. H., Berthelot, P., Meyer zum Büschenfelde, K. H. & Brechot, C.(1991). Assay of hepatitis B virus DNA by polymerase chain reaction and its relationship to pre-S- and S-encoded viral surface antigens. Hepatology 13, 158-166.[Medline]

Ghany, M. G., Ayola, B., Villamil, F. G., Gish, R. G., Rojter, S., Vierling, J. M. & Lok, A. S.(1998). Hepatitis B virus S mutants in liver transplant recipients who were reinfected despite hepatitis B immune globulin prophylaxis. Hepatology 27, 213-222.[Medline]

Heathcote, J., McHutchison, J., Lee, S., Tong, M., Benner, K., Minuk, G., Wright, T., Fikes, J., Livingston, B., Sette, A. & Chestnut, R.(1999). A pilot study of the CY-1899 T-cell vaccine in subjects chronically infected with hepatitis B virus. The CY1899 T Cell Vaccine Study Group. Hepatology 30, 531-536.[Medline]

Hsu, H. Y., Chang, M. H., Liaw, S. H., Ni, Y. H. & Chen, H. L.(1999). Changes of hepatitis B surface antigen variants in carrier children before and after universal vaccination in Taiwan. Hepatology 30, 1312-1317.[Medline]

McMahon, G., Ehrlich, P. H., Moustafa, Z. A., McCarthy, L. A., Dottavio, D., Tolpin, M. D., Nadler, P. I. & Östberg, L.(1992). Genetic alterations in the gene encoding the major HBsAg: DNA and immunological analysis of recurrent HBsAg derived from monoclonal antibody-treated liver transplant patients. Hepatology 15, 757-766.[Medline]

Magnius, L. O. & Norder, H.(1995). Subtypes, genotypes and molecular epidemiology of the hepatitis B virus as reflected by sequence variability of the S-gene. Intervirology 38, 24-34.[Medline]

Niederau, C., Heintges, T., Lange, S., Goldmann, G., Niederau, C. M., Mohr, L. & Haussinger, D.(1996). Long-term follow-up of HBeAg-positive patients treated with interferon alfa for chronic hepatitis B. New England Journal of Medicine 334, 1422-1427.[Abstract/Free Full Text]

Norder, H., Hammas, B., Lee, S.-D., Bile, K., Couroucé, A.-M., Mushahwar, I. K. & Magnius, L. O.(1993). Genetic relatedness of hepatitis B viral strains of diverse geographical origin and natural variations in the primary structure of the surface antigen. Journal of General Virology 74, 1341-1348.[Abstract/Free Full Text]

Okamoto, H., Omi, S., Wang, Y., Itoh, Y., Tsuda, F., Tanaka, T., Akahane, Y., Miyakawa, Y. & Mayumi, M.(1989). The loss of subtypic determinants in alleles, d/y or w/r, on hepatitis B surface antigen. Molecular Immunology 26, 197-205.[Medline]

Oon, C. J., Lim, G. K., Ye, Z., Goh, K. T., Tan, K. L., Yo, S. L., Hopes, E., Harrison, T. J. & Zuckerman, A. J.(1995). Molecular epidemiology of hepatitis B virus vaccine variants in Singapore. Vaccine 13, 699-702.[Medline]

Pol, S., Driss, F., Michel, M. L., Nalpas, B., Berthelot, P. & Brechot, C.(1994). Specific vaccine therapy in chronic hepatitis B infection. Lancet 344, 342.

Pol, S., Michel, M. L. & Brechot, C.(2000). Immune therapy of hepatitis B virus chronic infection. Hepatology 31, 548-549.[Medline]

Protzer-Knolle, U., Naumann, U., Bartenschlager, R., Berg, T., Hopf, U., Meyer zum Buschenfelde, K. H., Neuhaus, P. & Gerken, G.(1998). Hepatitis B virus with antigenically altered hepatitis B surface antigen is selected by high-dose hepatitis B immune globulin after liver transplantation. Hepatology 27, 254-263.[Medline]

Wen, Y. M., Wu, X. H., Hu, D. C., Zhang, Q. P. & Guo, S. Q.(1995). Hepatitis B vaccine and anti-HBs complex as approach for vaccine therapy. Lancet 345, 1575-1576.

Wright, T. L. & Lau, J. Y.(1993). Clinical aspects of hepatitis B virus infection. Lancet 342, 1340-1344.[Medline]

Zoulim, F. & Trepo, C.(1999). New antiviral agents for the therapy of chronic hepatitis B virus infection. Intervirology 42, 125-144.[Medline]

Received 31 May 2000; accepted 30 October 2000.


This article has been cited by other articles:


Home page
CarcinogenesisHome page
G. D. Kirk, E. Bah, and R. Montesano
Molecular epidemiology of human liver cancer: insights into etiology, pathogenesis and prevention from The Gambia, West Africa
Carcinogenesis, October 1, 2006; 27(10): 2070 - 2082.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Soussan, P.
Right arrow Articles by Kremsdorf, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soussan, P.
Right arrow Articles by Kremsdorf, D.
Agricola
Right arrow Articles by Soussan, P.
Right arrow Articles by Kremsdorf, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS