|
|
||||||||
Plant |
Centre for Molecular Biotechnology, Queensland University of Technology, GPO Box 2434, Brisbane, 4001 Queensland, Australia1
Author for correspondence: James Dale. Fax +61 7 3864 1534. e-mail j.dale{at}qut.edu.au
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Hafner et al. (1997b)
have demonstrated that the major gene of DNA-1 encodes a replication initiation protein (Rep) while Wanitchakorn et al. (1997)
have shown that DNA-3 encodes the viral coat protein. Recently, the BBTV DNA-5 gene product has been shown to contain an LXCXE motif and to have retinoblastoma protein (Rb)-binding activity (Wanitchakorn et al., 2000a
). Wanitchakorn et al. (2000a
) have suggested that the gene product of BBTV DNA-5 is produced very early in the infection cycle and is responsible for switching the first infected cells to S-phase in preparation for virus replication. This is supported by the results of Hafner et al. (1997a)
who showed that BBTV DNA-5 is the most efficiently self-primed of the BBTV DNA components. One component of another nanovirus, faba bean necrotic yellows virus (FBNYV) (FBNYV DNA-10), has been shown to encode a protein called Clink (cell cycle link) which is capable of binding human Rb and enhancing replication of FBNYV Rep proteins when co-infected (Aronson et al., 2000
). Since BBTV DNA-5 shares similar motifs with FBNYV DNA-10, it is likely that gene products of these components fulfil similar functions. BBTV DNA-4 and -6 appear to encode movement and nuclear shuttle proteins (Wanitchakorn et al., 2000a
), respectively, while the functions of the gene products of DNA-2 and the small internal gene of BBTV DNA-1 are unknown.
BBTV DNA-1 to -6 have been consistently associated with BBTV worldwide, suggesting they are integral components of the BBTV genome (Karan et al., 1997
). Recently, two new BBTV-associated sequences, BBTV S1 and S2, have been characterized. Unlike BBTV DNA-1 to -6, S1 and S2 appear to vary in distribution with a high prevalence in Asian group isolates and a low prevalence or absence in South Pacific isolates (Horser et al., 2000
). These two sequences, like BBTV DNA-1, putatively encode Rep proteins but, unlike BBTV DNA-1, neither BBTV S1 nor S2 contain the small internal gene (Beetham et al., 1997
). Based on their restricted distribution and different genome organization, it is probable that BBTV S1 and S2 represent satellite DNAs and that the Rep proteins encoded by these components are not necessary for BBTV replication. Several additional Rep protein-encoding components have been associated with FBNYV but only one component, FBNYV DNA-2, is capable of self replication as well as initiating replication of the non-Rep protein-encoding components of this virus. A similar phenomenon has been observed for the two other nanoviruses, milk vetch dwarf virus (MDV) and subterranean clover stunt virus (SCSV), giving rise to the Master Rep concept (Timchenko et al., 1999
, 2000
). In this study, we investigated whether the Rep proteins encoded by BBTV DNA-1 and S1 could direct self replication and/or replication of other BBTV components.
| Methods |
|---|
|
|
|---|
Nucleic acid extraction.
Generation of BBTV 1.1 mers.
The 1.1 mers of BBTV DNA-1, -3, -5 and S1 were generated by a PCR-based strategy using primers designed from the sequences of BBTV DNA-1, -3, -5 (Harding et al., 1993
; Burns et al., 1995
) and BBTV S1 (GenBank accession no. AF216221; Horser et al., 2000
) (Table 1
). PCR mixes comprised 20 pmol of each primer, 10 mM dNTPs, 1 U Taq DNA polymerase (Roche) and 1 µl of total nucleic acid extract (diluted 1/10 or 1/100 in TE buffer, pH 8). The reaction mixes were denatured at 94 °C for 4 min followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min followed by 1 cycle of 72 °C for 10 min. Following amplification, PCR products were purified using a High Pure PCR Purification kit (Roche), and were digested at 37 °C for 2 h with AvaII, HinfI, BglII and XbaI for BBTV DNA-1, -3, -5 and S1, respectively. The digested products were purified using High Pure columns (Roche) and were ligated into pGEM-T (Promega) at 4 °C overnight using 2 U T4 DNA ligase (Roche). The ligations were then electroporated into E. coli DH5. Selected clones were sequenced using automated sequencing and Big Dye Termination Cycle Sequencing Ready Reaction (PE Applied Biosystems). Primers used for sequencing were either universal sequencing primers (US Biochemical) or primers designed from published BBTV sequences.
|
Microprojectile bombardment.
Analysis of bombarded embryos
PCR.
To determine whether the bombarded BBTV 1.1 mers had been excised from the plasmid vector and recircularized into double-stranded monomers, a PCR-based strategy employing immediately adjacent, outwardly extending component-specific primers was used. Cycling conditions were as previously outlined. The primers were BBTV DNA-1 (BT1-947F 5' GTTGGTTTCTTGCTGAACAAG 3'; 30merF3 5'GGAAGAAGCCTCTCATCTGCTTCAGAGAGC 3'), BBTV DNA-3 (3-HinfIF and 3-HinfIR; Table 1
), BBTV DNA-5 (BT5-726F 5' TGTAATATCCATTATCATCAATAA 3'; BT5-239R 5' TTCTCTTCCGACGAGTGATTTCGGAAA 3'), BBTV S1 (S1T1F and S1T1R; Table 1
).
Southern blotting and hybridization.
Nucleic acid extracts (up to 60 µg) were electrophoresed through 1·5% agarose gels in TAE buffer, pH 7·8, and stained with ethidium bromide. Full-length or partial clones of BBTV DNA-1, -3, -5 and S1, as well as extracts from an Australian BBTV isolate, were used as positive controls. Nucleic acids were transferred to positively charged nylon membranes (Roche) as described by Southern (1985)
. Digoxigenin (DIG)-labelled component-specific probes were generated using PCR and DIG-11-dUTP (9:1) as per the manufacturers protocol (Roche). Primers were designed to amplify the complete ORF of BBTV DNA-1 (ORF1 BamF 5' TTGGATCCATGGCGCGATTGTGGTATGCTGGATGTTC 3'; ORF1 SacR 5' TTTAAAGAGCTCTCAGCAAAACATTTCGATC 3'), BBTV DNA-3 (BT3-13F 5' ATGTTCAGACAAGAAATGGCTAGG 3'; BT3-740R TCAAACATGATATGTAATTCTGTTCTGG 3'), BBTV DNA-5 (BT5-240F 5' ATGAGTTCTGGGAATCGTCTGCCATG 3'; BT5-725R 5' TTAGAGTAATGTTACATAATCTG 3') and BBTV S1 (S163F 5' ATGTCATCTTTTAAATGGTGCTTCA 3'; S1ORF 5' TTAACAATAAATAATCTTTATTCTATCTTC 3'). Membranes were prehybridized in DIG Easy Hybe (Roche) for 12 h, and denatured probes were added directly to the prehybridization solution and hybridized for 1216 h at 42 °C. Membranes were then subjected to high stringency washes (0·1x SSC, 0·1% SDS) at 65 °C prior to development as per the manufacturers instructions (Roche).
| Results |
|---|
|
|
|---|
|
When 1.1 mers of DNA-1 alone were bombarded into the embryogenic cells, no replication products were observed in any of the bombarded embryogenic cells at day 0, with hybridization only occurring with the higher molecular mass input plasmid DNA (Fig. 1
). At day 4, however, BBTV DNA-1-specific bands of approximately 1 kbp, representing supercoiled, linear and open-circular forms of BBTV genomic DNA, were detected in embryogenic cells, indicating that replication of this component had occurred. While the intensity of the DNA-1-specific bands appeared to decrease slightly after 8 days, this observation was not consistent in all subsequent experiments. When 1.1 mers of DNA-5 alone were bombarded into the banana embryogenic cells, no replication products were observed at either 0, 4 or 8 days post-bombardment, indicating that this component was not able to self-replicate (Fig. 1
). However, when 1.1 mers of DNA-1 and -5 were co-bombarded, BBTV DNA-5-specific bands were observed in the cells at days 4 and 8 post-bombardment, showing that this component was replicated in the presence of DNA-1.
|
|
| Discussion |
|---|
|
|
|---|
Three possible satellite DNAs have been isolated from BBTV infections; BBTV S1 (Horser et al., 2000
), BBTV Y/W1 (Yeh et al., 1994
; Wu et al., 1994
) and BBTV S2/W2 (Horser et al., 2000
; Wu et al., 1994
). The genome organization of these DNA components resembles that of BBTV DNA-1 in that they putatively encode Rep proteins and have a stemloop structure that is probably the origin of replication. The demonstration that BBTV S1 was capable of self-replication but was not capable of replicating integral components of the BBTV genome provides further evidence that BBTV S1, and therefore probably S2 and Y1, are novel satellite components of BBTV with equivalents in FBNYV, MDV and SCSV. In the characterization of FBNYV, MDV and SCSV, among the first components to be isolated were the Rep-encoding component equivalents of BBTV S1 (Boevink et al., 1995
; Katul et al., 1995
; Sano et al., 1998
). Further, Timchenko et al. (1999)
reported the presence of multiple Rep proteins associated with the FBNYV genome. They demonstrated that, of the five potential Rep-encoding components associated with FBNYV, only one component (DNA-2) was capable of replicating itself as well as the other six non-Rep-encoding FBNYV DNAs. The isolation of these additional Rep-encoding components before the master Rep-encoding component suggests that the putative satellite Rep-encoding components occur in higher concentrations than the integral genomic components of these viruses. This hypothesis is supported by our results which showed that BBTV S1 was replicated to a very high level in the presence of the BBTV DNA-1, -3 and -5. Thus, like FBNYV, MDV and SCSV, BBTV has a single component that encodes the viral 'master' Rep protein that is responsible for directing the replication of all other integral viral genomic components. In contrast, additional Rep-encoding components that are often associated with nanovirus (and sometimes even with geminivirus) infections are capable of self-replication only. It is thus possible that these satellite Rep protein components depend on their helper virus (i) during early stages of infection through the expression of the virus-encoded Rb-binding-like protein, (ii) for nuclear shuttling, (iii) for cell-to-cell movement, (iv) for long-distance movement and (v) for plant-to-plant transmission.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Beetham, P. R., Hafner, G. J., Harding, R. M. & Dale, J. L.(1997). Two mRNAs are transcribed from banana bunchy top virus DNA-1. Journal of General Virology 78, 229-236.[Abstract]
Beetham, P. R., Harding, R. M. & Dale, J. L.(1999). Banana bunchy top virus DNA-2 to 6 are monocistronic. Archives of Virology 144, 89-105.[Medline]
Boevink, P., Chu, P. W. G. & Keese, P.(1995). Sequence of subterranean clover stunt virus DNA: affinities with the geminiviruses. Virology 207, 354-361.[Medline]
Burns, T. M., Harding, R. M. & Dale, J. L.(1995). The genome organization of banana bunchy top virus: analysis of six ssDNA components. Journal of General Virology 76, 1471-1482.
Dugdale, B., Becker, D. K., Harding, R. M. & Dale, J. L.(1998). Promoter activity associated with the intergenic regions of banana bunchy top virus DNA-1 to-6 in transgenic tobacco and banana cells. Journal of General Virology 79, 2301-2311.[Abstract]
Hafner, G. J., Harding, R. M. & Dale, J. L.(1997a). A DNA primer associated with banana bunchy top virus. Journal of General Virology 78, 479-486.[Abstract]
Hafner, G. J., Stafford, M. R., Wolter, L. C., Harding, R. M. & Dale, J. L.(1997b). Nicking and joining activity of banana bunchy top virus replication protein in vitro. Journal of General Virology 78, 1795-1799.[Abstract]
Harding, R. M., Burns, T. M., Hafner, G. J., Dietzgen, R. G. & Dale, J. L.(1993). Nucleotide sequence of one component of the banana bunchy top virus genome contains a putative replicase. Journal of General Virology 74, 323-328.
Horser, C. L., Karan, M., Harding, R. M. & Dale, J. L.(2000). Additional Rep-encoding DNAs associated with banana bunchy top virus. Archives of Virology 145, 1-6.[Medline]
Karan, M., Harding, R. M. & Dale, J. L.(1994). Evidence for two groups of banana bunchy top virus isolates. Journal of General Virology 75, 3541-3546.
Karan, M., Harding, R. M. & Dale, J. L. (1997). Association of banana bunchy top virus DNA components 2 to 6 with banana bunchy top disease. Molecular Plant Pathology On-line [http://www.bspp.org.uk/mppol/].
Katul, L., Maiss, E. & Vetten, H. J.(1995). Sequence analysis of a faba bean necrotic yellows virus DNA component containing a putative replicase gene. Journal of General Virology 76, 475-479.
Mahon, R. E., Bateson, M. F., Chamberlain, D. A., Higgins, C. M., Drew, R. A. & Dale, J. L.(1996). Transformation of an Australian variety of Carica papaya using microprojectile bombardment. Australian Journal of Plant Physiology 23, 679-685.
Sano, Y., Wada, M., Hashimoto, Y., Matsumoto, T. & Kojima, M.(1998). Sequences of ten circular ssDNA components associated with the milk vetch dwarf virus genome. Journal of General Virology 79, 3111-3118.[Abstract]
Southern, E.(1985). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-517.
Stewart, C. N. & Via, L. E.(1993). A rapid CTAB DNA isolation technique for RAPD fingerprint and PCR applications. BioTechniques 14, 748-750.[Medline]
Timchenko, T., Kouchkovsky, F., Katul, L., David, C., Vetten, H. J. & Gronenborn, B.(1999). A single Rep protein initiates replication of multiple genome components of faba bean necrotic yellows virus, a single-stranded DNA virus of plants. Journal of Virology 73, 10173-10182.
Timchenko, T., Katul, L., Sano, Y., Kouchkovsky, F., Vetten, H. J. & Gronenborn, B. (2000). The master Rep concept in nanovirus replication: identification of missing genome components and potential for natural genetic reassortment. Virology 274, 189195.[Medline]
Wanitchakorn, R., Harding, R. M. & Dale, J. L.(1997). Banana bunchy top virus DNA-3 encodes the viral coat protein. Archives of Virology 142, 1673-1680.[Medline]
Wanitchakorn, R., Hafner, G. J., Harding, R. M. & Dale, J. L.(2000a). Functional analysis of proteins encoded by banana bunchy top virus DNA-4 to -6. Journal of General Virology 81, 299-306.
Wanitchakorn, R., Harding, R. M. & Dale, J. L.(2000b). Sequence variability in the coat protein gene of two groups of banana bunchy top isolates. Archives of Virology 145, 1-10.
Wu, R. Y., You, L. R. & Soong, T. S.(1994). Nucleotide sequence of two circular single-stranded DNAs associated with banana bunchy top virus. Phytopathology 84, 952-958.
Yeh, H., Su, H. J. & Chao, Y.(1994). Genome characterization and identification of viral-associated dsDNA component of banana bunchy top virus. Virology 198, 645-652.[Medline]
Received 21 July 2000;
accepted 23 October 2000.
This article has been cited by other articles:
![]() |
I. Grigoras, T. Timchenko, and B. Gronenborn Transcripts encoding the nanovirus master replication initiator proteins are terminally redundant J. Gen. Virol., February 1, 2008; 89(2): 583 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Hu, H.-C. Fu, C.-H. Lin, H.-J. Su, and H.-H. Yeh Reassortment and Concerted Evolution in Banana Bunchy Top Virus Genomes J. Virol., February 15, 2007; 81(4): 1746 - 1761. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Herrera-Valencia, B. Dugdale, R. M. Harding, and J. L. Dale An iterated sequence in the genome of Banana bunchy top virus is essential for efficient replication. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3409 - 3412. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Timchenko, L. Katul, M. Aronson, J. C. Vega-Arreguin, B. C. Ramirez, H. J. Vetten, and B. Gronenborn Infectivity of nanovirus DNAs: induction of disease by cloned genome components of Faba bean necrotic yellows virus J. Gen. Virol., June 1, 2006; 87(6): 1735 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Vega-Arreguin, T. Timchenko, B. Gronenborn, and B. C. Ramirez A Functional Histidine-Tagged Replication Initiator Protein: Implications for the Study of Single-Stranded DNA Virus Replication In Planta J. Virol., July 1, 2005; 79(13): 8422 - 8430. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shirasawa-Seo, Y. Sano, S. Nakamura, T. Murakami, S. Seo, Y. Ohashi, Y. Hashimoto, and T. Matsumoto Characteristics of the promoters derived from the single-stranded DNA components of Milk vetch dwarf virus in transgenic tobacco J. Gen. Virol., June 1, 2005; 86(6): 1851 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Saunders, I. D. Bedford, and J. Stanley Adaptation from whitefly to leafhopper transmission of an autonomously replicating nanovirus-like DNA component associated with ageratum yellow vein disease J. Gen. Virol., April 1, 2002; 83(4): 907 - 913. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |