J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horser, C. L.
Right arrow Articles by Dale, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horser, C. L.
Right arrow Articles by Dale, J. L.
Agricola
Right arrow Articles by Horser, C. L.
Right arrow Articles by Dale, J. L.
Journal of General Virology (2001), 82, 459-464.
© 2001 Society for General Microbiology


Plant

Banana bunchy top nanovirus DNA-1 encodes the ‘master’ replication initiation protein

Cathryn L. Horserb,1, Robert M. Harding1 and James L. Dale1

Centre for Molecular Biotechnology, Queensland University of Technology, GPO Box 2434, Brisbane, 4001 Queensland, Australia1

Author for correspondence: James Dale. Fax +61 7 3864 1534. e-mail j.dale{at}qut.edu.au


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Banana bunchy top nanovirus has a multicomponent, circular single-stranded DNA genome comprising at least six integral components, BBTV DNA-1 to -6, which have been consistently associated with bunchy top disease worldwide. At least three other components, BBTV S1, S2 and Y, which have been isolated from Taiwanese BBTV isolates, do not appear to be integral components. We show here that both BBTV DNA-1 and S1, which encode replication initiation (Rep) proteins, were capable of self-replication when bombarded into banana embryogenic cell suspensions. However, only BBTV DNA-1 was capable of directing the replication of two other BBTV genomic components, namely BBTV DNA-3 which encodes the coat protein, and DNA-5 which encodes a retinoblastoma binding-like protein. These results indicate that (i) BBTV DNA-1 is the minimal replicative unit of BBTV and encodes the ‘master’ viral Rep and (ii) BBTV S1 is possibly a satellite DNA which is unable to replicate integral BBTV components.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Banana bunchy top nanovirus (BBTV) has a genome comprising at least six components of circular single-stranded DNA (BBTV DNA-1 to -6) (Harding et al., 1993Down ; Burns et al., 1995Down ). The components are approximately 1 kb and share a common genome organization; all have a conserved major common region (CR-M) and stem–loop common region (CR-SL), a potential TATA box 3' of the stem–loop, at least one major gene in the virion sense and a polyadenylation signal associated with each gene (Burns et al., 1995Down ; Beetham et al., 1997Down , 1999Down ). The major gene of BBTV DNA-1 also contains a smaller internal gene in a +2 reading frame (Beetham et al., 1997Down ). There are two groups of BBTV, the South Pacific group (isolates from Australia, Burundi, Egypt, Fiji, India, Tonga and Western Samoa) and the Asian group (Vietnam, Philippines and Taiwan), based on sequence analysis of BBTV DNA-1, -3 and -6 (Karan et al., 1994Down , 1997Down ; Wanitchakorn et al., 2000bDown ). These two groups differ by an average of 9·6% (DNA-1), 11·86% (DNA-3) and 14·5% (DNA-6) over the entire nucleotide sequence with an average difference of 32% (DNA-1), 38·6% (DNA-3) and 27% (DNA-6) within the CR-M (Karan et al., 1994Down , 1997Down ; Wanitchakorn et al., 2000bDown ).

Hafner et al. (1997b)Down have demonstrated that the major gene of DNA-1 encodes a replication initiation protein (Rep) while Wanitchakorn et al. (1997)Down have shown that DNA-3 encodes the viral coat protein. Recently, the BBTV DNA-5 gene product has been shown to contain an LXCXE motif and to have retinoblastoma protein (Rb)-binding activity (Wanitchakorn et al., 2000aDown ). Wanitchakorn et al. (2000aDown ) have suggested that the gene product of BBTV DNA-5 is produced very early in the infection cycle and is responsible for switching the first infected cells to S-phase in preparation for virus replication. This is supported by the results of Hafner et al. (1997a)Down who showed that BBTV DNA-5 is the most efficiently self-primed of the BBTV DNA components. One component of another nanovirus, faba bean necrotic yellows virus (FBNYV) (FBNYV DNA-10), has been shown to encode a protein called Clink (cell cycle link) which is capable of binding human Rb and enhancing replication of FBNYV Rep proteins when co-infected (Aronson et al., 2000Down ). Since BBTV DNA-5 shares similar motifs with FBNYV DNA-10, it is likely that gene products of these components fulfil similar functions. BBTV DNA-4 and -6 appear to encode movement and nuclear shuttle proteins (Wanitchakorn et al., 2000aDown ), respectively, while the functions of the gene products of DNA-2 and the small internal gene of BBTV DNA-1 are unknown.

BBTV DNA-1 to -6 have been consistently associated with BBTV worldwide, suggesting they are integral components of the BBTV genome (Karan et al., 1997Down ). Recently, two new BBTV-associated sequences, BBTV S1 and S2, have been characterized. Unlike BBTV DNA-1 to -6, S1 and S2 appear to vary in distribution with a high prevalence in Asian group isolates and a low prevalence or absence in South Pacific isolates (Horser et al., 2000Down ). These two sequences, like BBTV DNA-1, putatively encode Rep proteins but, unlike BBTV DNA-1, neither BBTV S1 nor S2 contain the small internal gene (Beetham et al., 1997Down ). Based on their restricted distribution and different genome organization, it is probable that BBTV S1 and S2 represent satellite DNAs and that the Rep proteins encoded by these components are not necessary for BBTV replication. Several additional Rep protein-encoding components have been associated with FBNYV but only one component, FBNYV DNA-2, is capable of self replication as well as initiating replication of the non-Rep protein-encoding components of this virus. A similar phenomenon has been observed for the two other nanoviruses, milk vetch dwarf virus (MDV) and subterranean clover stunt virus (SCSV), giving rise to the Master Rep concept (Timchenko et al., 1999Down , 2000Down ). In this study, we investigated whether the Rep proteins encoded by BBTV DNA-1 and S1 could direct self replication and/or replication of other BBTV components.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Nucleic acid extraction.
Nucleic acid was extracted from Australian and Taiwanese BBTV-infected material and from banana embryogenic cell suspensions essentially as described (Stewart & Via, 1993Down ).

{blacksquare} Generation of BBTV 1.1 mers.
The 1.1 mers of BBTV DNA-1, -3, -5 and S1 were generated by a PCR-based strategy using primers designed from the sequences of BBTV DNA-1, -3, -5 (Harding et al., 1993Down ; Burns et al., 1995Down ) and BBTV S1 (GenBank accession no. AF216221; Horser et al., 2000Down ) (Table 1Down). PCR mixes comprised 20 pmol of each primer, 10 mM dNTPs, 1 U Taq DNA polymerase (Roche) and 1 µl of total nucleic acid extract (diluted 1/10 or 1/100 in TE buffer, pH 8). The reaction mixes were denatured at 94 °C for 4 min followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min followed by 1 cycle of 72 °C for 10 min. Following amplification, PCR products were purified using a High Pure PCR Purification kit (Roche), and were digested at 37 °C for 2 h with AvaII, HinfI, BglII and XbaI for BBTV DNA-1, -3, -5 and S1, respectively. The digested products were purified using High Pure columns (Roche) and were ligated into pGEM-T (Promega) at 4 °C overnight using 2 U T4 DNA ligase (Roche). The ligations were then electroporated into E. coli DH5. Selected clones were sequenced using automated sequencing and Big Dye Termination Cycle Sequencing Ready Reaction (PE Applied Biosystems). Primers used for sequencing were either universal sequencing primers (US Biochemical) or primers designed from published BBTV sequences.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used in the construction of BBTV 1.1 mers

 
{blacksquare} Microprojectile bombardment.
Bluggoe (Musa spp. ABB group) embryogenic suspension cultures were maintained and harvested essentially as described by Dugdale et al. (1998)Down except that cells were harvested 4 days post-subculture and were bombarded between 24 h and 4 days post-plating. Plasmid 1.1mer constructs for bombardment were purified using a Bresa-pure Maxi-prep Plasmid Purification kit (Geneworks). Bluggoe embryogenic cells were bombarded with various combinations of 1.1 mers using a particle inflow gun and gold microcarriers (Bio-Rad). Gold was prepared essentially as described by Mahon et al. (1996)Down ; a 40 µl suspension (containing 3 mg gold) was coated with 2 pmol of DNA and 4 µl of the suspension was used per bombardment. All gold preparations were supplemented with ‘stuffer DNA’ (comprising 900 bp of 5' untranslatable flanking sequence of the sugarcane actin gene) to ensure each treatment contained the same molar concentration of DNA. Each treatment was sampled at zero (i.e. immediately after bombardment), 4 and 8 days post-bombardment, and embryogenic cells were stored at -20 °C until analysed.

{blacksquare} Analysis of bombarded embryos
PCR.
To determine whether the bombarded BBTV 1.1 mers had been excised from the plasmid vector and recircularized into double-stranded monomers, a PCR-based strategy employing immediately adjacent, outwardly extending component-specific primers was used. Cycling conditions were as previously outlined. The primers were BBTV DNA-1 (BT1-947F 5' GTTGGTTTCTTGCTGAACAAG 3'; 30merF3 5'GGAAGAAGCCTCTCATCTGCTTCAGAGAGC 3'), BBTV DNA-3 (3-HinfIF and 3-HinfIR; Table 1Up), BBTV DNA-5 (BT5-726F 5' TGTAATATCCATTATCATCAATAA 3'; BT5-239R 5' TTCTCTTCCGACGAGTGATTTCGGAAA 3'), BBTV S1 (S1T1F and S1T1R; Table 1Up).

Southern blotting and hybridization.
Nucleic acid extracts (up to 60 µg) were electrophoresed through 1·5% agarose gels in TAE buffer, pH 7·8, and stained with ethidium bromide. Full-length or partial clones of BBTV DNA-1, -3, -5 and S1, as well as extracts from an Australian BBTV isolate, were used as positive controls. Nucleic acids were transferred to positively charged nylon membranes (Roche) as described by Southern (1985)Down . Digoxigenin (DIG)-labelled component-specific probes were generated using PCR and DIG-11-dUTP (9:1) as per the manufacturer‘s protocol (Roche). Primers were designed to amplify the complete ORF of BBTV DNA-1 (ORF1 BamF 5' TTGGATCCATGGCGCGATTGTGGTATGCTGGATGTTC 3'; ORF1 SacR 5' TTTAAAGAGCTCTCAGCAAAACATTTCGATC 3'), BBTV DNA-3 (BT3-13F 5' ATGTTCAGACAAGAAATGGCTAGG 3'; BT3-740R TCAAACATGATATGTAATTCTGTTCTGG 3'), BBTV DNA-5 (BT5-240F 5' ATGAGTTCTGGGAATCGTCTGCCATG 3'; BT5-725R 5' TTAGAGTAATGTTACATAATCTG 3') and BBTV S1 (S163F 5' ATGTCATCTTTTAAATGGTGCTTCA 3'; S1ORF 5' TTAACAATAAATAATCTTTATTCTATCTTC 3'). Membranes were prehybridized in DIG Easy Hybe (Roche) for 1–2 h, and denatured probes were added directly to the prehybridization solution and hybridized for 12–16 h at 42 °C. Membranes were then subjected to high stringency washes (0·1x SSC, 0·1% SDS) at 65 °C prior to development as per the manufacturer‘s instructions (Roche).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In vitro excision of BBTV 1.1 mers
Banana embryogenic cell suspensions were bombarded with BBTV 1.1 mers both individually and in various combinations. To detect the excision and recircularization of the 1.1 mers, DNA was extracted from the bombarded banana embryogenic cell suspensions and used in a PCR using immediately adjacent, outwardly extending component-specific primers. These primers were designed in such a way that amplification would only occur if the 1.1 mers had been nicked at each stem–loop and recircularized into a single monomeric unit. When analysed at day zero for DNA-1, -3, -5 and S1, no PCR products were amplified from any of the bombarded cells (Table 2Down). However, at 4 days post-bombardment, PCR products of the size expected for BBTV DNA-1 and S1 were amplified from embryogenic cells bombarded with 1.1 mers of BBTV DNA-1 and BBTV S1 alone, respectively, as was also the case for the embryogenic cells bombarded with these components in combination with BBTV DNA-3 and/or DNA-5. PCR products of the sizes expected for BBTV DNA-3 and -5 were only amplified from embryogenic cells which had been co-bombarded with BBTV DNA-1; BBTV DNA-3 and -5 were not detected in embryogenic cells co-bombarded with BBTV S1, except for the combination of BBTV DNA-1, -3, -5 and S1, in which BBTV DNA-1 was also present. These results indicated that while both BBTV DNA-1 and S1 were capable of initiating self-replication, only BBTV DNA-1 was capable of initiating replication of BBTV DNA-3 and -5.


View this table:
[in this window]
[in a new window]
 
Table 2. PCR results for excision and recircularization of BBTV components

 
Replication of BBTV components
Initially, experiments were designed to obtain further evidence that BBTV DNA-1 encoded the viral Rep and to examine the effect of DNA-5, the Rb-binding-like protein, on replication levels. To determine whether replication of BBTV genomic components had occurred, DNA was extracted from the banana embryos at days 0, 4 and 8 post-bombardment and hybridized with probes specific for BBTV DNA-1 and -5. Replication was assessed by the presence of (i) different conformational forms of BBTV genomic DNA and/or (ii) multimeric forms of BBTV DNA produced during rolling circle replication.

When 1.1 mers of DNA-1 alone were bombarded into the embryogenic cells, no replication products were observed in any of the bombarded embryogenic cells at day 0, with hybridization only occurring with the higher molecular mass input plasmid DNA (Fig. 1Down). At day 4, however, BBTV DNA-1-specific bands of approximately 1 kbp, representing supercoiled, linear and open-circular forms of BBTV genomic DNA, were detected in embryogenic cells, indicating that replication of this component had occurred. While the intensity of the DNA-1-specific bands appeared to decrease slightly after 8 days, this observation was not consistent in all subsequent experiments. When 1.1 mers of DNA-5 alone were bombarded into the banana embryogenic cells, no replication products were observed at either 0, 4 or 8 days post-bombardment, indicating that this component was not able to self-replicate (Fig. 1Down). However, when 1.1 mers of DNA-1 and -5 were co-bombarded, BBTV DNA-5-specific bands were observed in the cells at days 4 and 8 post-bombardment, showing that this component was replicated in the presence of DNA-1.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 1. Replication of BBTV DNA-1 and -5 in bombarded banana embryogenic cell suspensions. Cloned 1.1 mers of BBTV DNA-1 and/or DNA-5 were bombarded into banana embryogenic cell suspensions and replication was examined at days 0, 4 and 8 post-bombardment by Southern analysis using BBTV DNA-1- and DNA-5-specific probes as indicated on the right of each panel. Input plasmid as well as BBTV replicative intermediates [supercoiled (sc), linear (lin) and open circular (oc)] are indicated. D and U represent nucleic acids extracted from diseased and uninfected tissue, respectively, while 1 and 5 indicate component-specific controls for BBTV DNA-1 and -5, respectively.

 
Based on this result, we examined whether DNA-1 was able to replicate another BBTV genomic component, the coat protein-encoding DNA-3, and also to determine the replicative capability of BBTV S1, the Rep protein-encoding, putative satellite component. Using DNA-1 as a probe, replication products were detected in cells bombarded with DNA-1, -3 and -5, with or without BBTV S1, at both 4 and 8 days post-bombardment (Fig. 2Down). However, DNA-1 appeared to replicate at slightly lower levels in the presence of BBTV S1. When DNA-3 was used as a probe, this component was also shown to replicate in the presence of DNA-1 and -5 (Fig. 2Down). In contrast to DNA-1, however, no replication of DNA-3 was observed in cells co-bombarded with DNA-3 and BBTV S1. Further, no replication of DNA-3 occurred in the absence of DNA-1 (Fig. 2Down). The results obtained using DNA-5 as a probe were essentially similar to those with DNA-3; DNA-5 required the presence of DNA-1 for replication and was able to replicate in the presence of DNA-1 and -3 but not in the presence of BBTV S1 (Fig. 2Down). Finally, when BBTV S1 was used as a probe, self-replication of BBTV S1 was observed in bombarded cells (result not shown). Replication of BBTV S1 was also detected in cells co-bombarded with DNA-3, while increased levels of replication were observed in cells co-bombarded with DNA-3 and -5 (Fig. 2Down). This level of replication was further increased in the presence of DNA-1 (Fig. 2Down).



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 2. Replication of BBTV DNA-1, -3, -5 and S1 in bombarded banana embryogenic cell suspensions. Cloned 1.1 mers of these components were bombarded into banana embryogenic cell suspensions in various combinations and replication was examined at 0, 4 and 8 days post-bombardment by Southern analysis using component-specific probes as indicated on the left of each panel. D and U represent nucleic acids extracted from diseased and uninfected tissue, respectively, while 1, 3, 5 and S1 indicate component-specific controls for BBTV DNA-1, -3, -5 and S1, respectively.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
BBTV DNA-1 to -6 have been consistently associated with banana bunchy top disease worldwide in all geographical isolates tested (Karan et al., 1994Down , 1997Down ) although it has yet to be confirmed that these components represent the complete infectious unit of BBTV. We have now demonstrated that the minimal replicative unit of BBTV consists of BBTV DNA-1, which encodes the Rep protein and a 5 kDa protein of unknown function, since this component alone was able to self-replicate at low levels when bombarded into banana embryogenic cells and direct the replication of other BBTV DNA components. Furthermore, we have shown that BBTV DNA-1, but not BBTV S1, can direct the replication of a DNA component which has no obvious role in BBTV replication, namely the coat protein-encoding BBTV DNA-3. These results indicate that BBTV DNA-1 encodes the ‘master’ Rep protein.

Three possible satellite DNAs have been isolated from BBTV infections; BBTV S1 (Horser et al., 2000Down ), BBTV Y/W1 (Yeh et al., 1994Down ; Wu et al., 1994Down ) and BBTV S2/W2 (Horser et al., 2000Down ; Wu et al., 1994Down ). The genome organization of these DNA components resembles that of BBTV DNA-1 in that they putatively encode Rep proteins and have a stem–loop structure that is probably the origin of replication. The demonstration that BBTV S1 was capable of self-replication but was not capable of replicating integral components of the BBTV genome provides further evidence that BBTV S1, and therefore probably S2 and Y1, are novel satellite components of BBTV with equivalents in FBNYV, MDV and SCSV. In the characterization of FBNYV, MDV and SCSV, among the first components to be isolated were the Rep-encoding component equivalents of BBTV S1 (Boevink et al., 1995Down ; Katul et al., 1995Down ; Sano et al., 1998Down ). Further, Timchenko et al. (1999)Down reported the presence of multiple Rep proteins associated with the FBNYV genome. They demonstrated that, of the five potential Rep-encoding components associated with FBNYV, only one component (DNA-2) was capable of replicating itself as well as the other six non-Rep-encoding FBNYV DNAs. The isolation of these additional Rep-encoding components before the ‘master’ Rep-encoding component suggests that the putative satellite Rep-encoding components occur in higher concentrations than the integral genomic components of these viruses. This hypothesis is supported by our results which showed that BBTV S1 was replicated to a very high level in the presence of the BBTV DNA-1, -3 and -5. Thus, like FBNYV, MDV and SCSV, BBTV has a single component that encodes the viral 'master' Rep protein that is responsible for directing the replication of all other integral viral genomic components. In contrast, additional Rep-encoding components that are often associated with nanovirus (and sometimes even with geminivirus) infections are capable of self-replication only. It is thus possible that these satellite Rep protein components depend on their helper virus (i) during early stages of infection through the expression of the virus-encoded Rb-binding-like protein, (ii) for nuclear shuttling, (iii) for cell-to-cell movement, (iv) for long-distance movement and (v) for plant-to-plant transmission.


   Acknowledgments
 
This work was funded by an Australian Research Council grant, and C.H. was supported by an Australian Postgraduate Research Award.


   Footnotes
 
b Present address: CSIRO Plant Industry, PO Box 1600, Canberra, ACT 2601, Australia. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Aronson, M. N., Meyer, A. D., Gyorgyey, J., Katul, L., Vetten, H. J., Gronenborn, B. & Timchenko, T.(2000). Clink, a nanovirus-encoded protein, binds both pRB and SKP1. Journal of Virology 74, 2967-2972.[Abstract/Free Full Text]

Beetham, P. R., Hafner, G. J., Harding, R. M. & Dale, J. L.(1997). Two mRNAs are transcribed from banana bunchy top virus DNA-1. Journal of General Virology 78, 229-236.[Abstract]

Beetham, P. R., Harding, R. M. & Dale, J. L.(1999). Banana bunchy top virus DNA-2 to 6 are monocistronic. Archives of Virology 144, 89-105.[Medline]

Boevink, P., Chu, P. W. G. & Keese, P.(1995). Sequence of subterranean clover stunt virus DNA: affinities with the geminiviruses. Virology 207, 354-361.[Medline]

Burns, T. M., Harding, R. M. & Dale, J. L.(1995). The genome organization of banana bunchy top virus: analysis of six ssDNA components. Journal of General Virology 76, 1471-1482.[Abstract/Free Full Text]

Dugdale, B., Becker, D. K., Harding, R. M. & Dale, J. L.(1998). Promoter activity associated with the intergenic regions of banana bunchy top virus DNA-1 to-6 in transgenic tobacco and banana cells. Journal of General Virology 79, 2301-2311.[Abstract]

Hafner, G. J., Harding, R. M. & Dale, J. L.(1997a). A DNA primer associated with banana bunchy top virus. Journal of General Virology 78, 479-486.[Abstract]

Hafner, G. J., Stafford, M. R., Wolter, L. C., Harding, R. M. & Dale, J. L.(1997b). Nicking and joining activity of banana bunchy top virus replication protein in vitro. Journal of General Virology 78, 1795-1799.[Abstract]

Harding, R. M., Burns, T. M., Hafner, G. J., Dietzgen, R. G. & Dale, J. L.(1993). Nucleotide sequence of one component of the banana bunchy top virus genome contains a putative replicase. Journal of General Virology 74, 323-328.[Abstract/Free Full Text]

Horser, C. L., Karan, M., Harding, R. M. & Dale, J. L.(2000). Additional Rep-encoding DNAs associated with banana bunchy top virus. Archives of Virology 145, 1-6.[Medline]

Karan, M., Harding, R. M. & Dale, J. L.(1994). Evidence for two groups of banana bunchy top virus isolates. Journal of General Virology 75, 3541-3546.[Abstract/Free Full Text]

Karan, M., Harding, R. M. & Dale, J. L. (1997). Association of banana bunchy top virus DNA components 2 to 6 with banana bunchy top disease. Molecular Plant Pathology On-line [http://www.bspp.org.uk/mppol/].

Katul, L., Maiss, E. & Vetten, H. J.(1995). Sequence analysis of a faba bean necrotic yellows virus DNA component containing a putative replicase gene. Journal of General Virology 76, 475-479.[Abstract/Free Full Text]

Mahon, R. E., Bateson, M. F., Chamberlain, D. A., Higgins, C. M., Drew, R. A. & Dale, J. L.(1996). Transformation of an Australian variety of Carica papaya using microprojectile bombardment. Australian Journal of Plant Physiology 23, 679-685.

Sano, Y., Wada, M., Hashimoto, Y., Matsumoto, T. & Kojima, M.(1998). Sequences of ten circular ssDNA components associated with the milk vetch dwarf virus genome. Journal of General Virology 79, 3111-3118.[Abstract]

Southern, E.(1985). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-517.

Stewart, C. N. & Via, L. E.(1993). A rapid CTAB DNA isolation technique for RAPD fingerprint and PCR applications. BioTechniques 14, 748-750.[Medline]

Timchenko, T., Kouchkovsky, F., Katul, L., David, C., Vetten, H. J. & Gronenborn, B.(1999). A single Rep protein initiates replication of multiple genome components of faba bean necrotic yellows virus, a single-stranded DNA virus of plants. Journal of Virology 73, 10173-10182.[Abstract/Free Full Text]

Timchenko, T., Katul, L., Sano, Y., Kouchkovsky, F., Vetten, H. J. & Gronenborn, B. (2000). The master Rep concept in nanovirus replication: identification of missing genome components and potential for natural genetic reassortment. Virology 274, 189–195.[Medline]

Wanitchakorn, R., Harding, R. M. & Dale, J. L.(1997). Banana bunchy top virus DNA-3 encodes the viral coat protein. Archives of Virology 142, 1673-1680.[Medline]

Wanitchakorn, R., Hafner, G. J., Harding, R. M. & Dale, J. L.(2000a). Functional analysis of proteins encoded by banana bunchy top virus DNA-4 to -6. Journal of General Virology 81, 299-306.[Abstract/Free Full Text]

Wanitchakorn, R., Harding, R. M. & Dale, J. L.(2000b). Sequence variability in the coat protein gene of two groups of banana bunchy top isolates. Archives of Virology 145, 1-10.

Wu, R. Y., You, L. R. & Soong, T. S.(1994). Nucleotide sequence of two circular single-stranded DNA‘s associated with banana bunchy top virus. Phytopathology 84, 952-958.

Yeh, H., Su, H. J. & Chao, Y.(1994). Genome characterization and identification of viral-associated dsDNA component of banana bunchy top virus. Virology 198, 645-652.[Medline]

Received 21 July 2000; accepted 23 October 2000.


This article has been cited by other articles:


Home page
J. Virol.Home page
I. Grigoras, T. Timchenko, L. Katul, A. Grande-Perez, H.-J. Vetten, and B. Gronenborn
Reconstitution of Authentic Nanovirus from Multiple Cloned DNAs
J. Virol., October 15, 2009; 83(20): 10778 - 10787.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
I. Grigoras, T. Timchenko, and B. Gronenborn
Transcripts encoding the nanovirus master replication initiator proteins are terminally redundant
J. Gen. Virol., February 1, 2008; 89(2): 583 - 593.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J.-M. Hu, H.-C. Fu, C.-H. Lin, H.-J. Su, and H.-H. Yeh
Reassortment and Concerted Evolution in Banana Bunchy Top Virus Genomes
J. Virol., February 15, 2007; 81(4): 1746 - 1761.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. A. Herrera-Valencia, B. Dugdale, R. M. Harding, and J. L. Dale
An iterated sequence in the genome of Banana bunchy top virus is essential for efficient replication.
J. Gen. Virol., November 1, 2006; 87(Pt 11): 3409 - 3412.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Timchenko, L. Katul, M. Aronson, J. C. Vega-Arreguin, B. C. Ramirez, H. J. Vetten, and B. Gronenborn
Infectivity of nanovirus DNAs: induction of disease by cloned genome components of Faba bean necrotic yellows virus
J. Gen. Virol., June 1, 2006; 87(6): 1735 - 1743.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. C. Vega-Arreguin, T. Timchenko, B. Gronenborn, and B. C. Ramirez
A Functional Histidine-Tagged Replication Initiator Protein: Implications for the Study of Single-Stranded DNA Virus Replication In Planta
J. Virol., July 1, 2005; 79(13): 8422 - 8430.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Shirasawa-Seo, Y. Sano, S. Nakamura, T. Murakami, S. Seo, Y. Ohashi, Y. Hashimoto, and T. Matsumoto
Characteristics of the promoters derived from the single-stranded DNA components of Milk vetch dwarf virus in transgenic tobacco
J. Gen. Virol., June 1, 2005; 86(6): 1851 - 1860.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Saunders, I. D. Bedford, and J. Stanley
Adaptation from whitefly to leafhopper transmission of an autonomously replicating nanovirus-like DNA component associated with ageratum yellow vein disease
J. Gen. Virol., April 1, 2002; 83(4): 907 - 913.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horser, C. L.
Right arrow Articles by Dale, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horser, C. L.
Right arrow Articles by Dale, J. L.
Agricola
Right arrow Articles by Horser, C. L.
Right arrow Articles by Dale, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS