|
|
||||||||
Animal: RNA Viruses |
Division of Clinical Virology, Karolinska Institute, F68, Huddinge University Hospital, S-141 86 Huddinge, Stockholm, Sweden1
Department of Medical Biochemistry and Microbiology, BMC, Uppsala University, S-751 23 Uppsala, Sweden2
Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York 10021-6399, USA3
Author for correspondence: Mojgan H. Naghavi. Fax +46 8 585 87933. e-mail Mojgan.Naghavi{at}impi.ki.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Taken together, sequence polymorphisms defining subtypes are not neutral. For example, a higher transmission rate has been suggested for Thailand subtype E (Soto-Ramirez et al., 1996
). A preference for certain coreceptors has been observed for subtypes C and D (Tscherning et al., 1998
; Bjorndal et al., 1999
) and subtype A has recently been reported to be less pathogenic (Kanki et al., 1999
). In particular, subtype-specific polymorphisms in transcription factor-binding sites within the LTR have the potential to affect the rates of virus replication because the LTR directs transcription of the proviral genome. Indeed, even intra-subtype LTR polymorphism can have a profound effect on transcription directed from the LTR (Estable et al., 1996
, 1998a
).
The DNA sequences within the prototypical HIV-1 5'LTR can be divided into the negative regulatory element (NRE), the enhancer/promoter region and the sequences encoding a transcriptionally nascent RNA stemloop structure termed TAR. Although first described as a negative regulatory region, NRE also confers positive regulation and contains binding sites for many cellular transcription factors including upstream stimulating factor (USF), AP1, NFAT, hLEF (reviewed by Gaynor, 1992
), E26-specific (Ets) family members (Holzmeister et al., 1993
) and RBF-1 and -2 (Bell & Sadowski, 1996
; Estable et al., 1996
, 1998a
, 1999
). The enhancer/promoter region consists of two highly conserved NF
B sites, three Sp1-binding sites, a TATA box and an initiator element (Gaynor, 1992
). The NF
B sites convey activation of transcription in response to a large number of extracellular stimuli such as viral proteins, phorbol esters and multiple cytokines (Gaynor, 1992
). However, it is likely that for some of these effects, certainly Ras-responsiveness, other sequences are involved as well (Bell & Sadowski, 1996
). The TAR element in conjunction with the viral protein Tat confers critical regulation of transcription elongation. The TatTAR interaction in an apparent ternary complex with P-TEFb results in the phosphorylation of the Pol II CTD by the CDK9 component of P-TEFb (reviewed by Karn, 1999
).
Subtype-specific differences in the HIV-1 LTR of subtypes E and C have been associated with a higher promoter/enhancer activity as well as a faster spread of these viruses in southeast Asia (Thailand, HIV-1 subtype E) and sub-Saharan Africa (Zimbabwe, HIV-1 subtype C) (Montano et al., 1997
, 1998
). It has also been suggested that the conversion of an NF
B site, present in Thai HIV-1 subtype E, into an Ets transcription factor family member protein (GABP)-binding site may result in enhanced Tat trans-activation (Verhoef et al., 1999
). We have recently reported that subtype C promoter/enhancer activity was, on average, higher than the activities of the other subtypes and this correlated with the presence of a third potential NF
B site as well as an alternative core-NRE (position -174 to -163) (Naghavi et al., 1999a
, b
). The latter site contains a characteristic E-box motif, CAC(A/G)TG, which has been shown to be a target for USF (Sawadogo & Roeder, 1985a
, b
; Gregor et al., 1990
). USF is a member of the basic helix-loop-helix/leucine zipper family of transcription factors and is constitutively expressed in many tissues (Chodosh et al., 1986
; Sawadogo et al., 1988
). USF was initially characterized as a positive activator of major late promoter transcription of adenovirus type 2 (Carthew et al., 1985
; Miyamoto et al., 1985
; Sawadogo & Roeder, 1985b
). In the context of HIV-1, several studies have demonstrated both a negative (Lu et al., 1989
, 1990
; Giacca et al., 1992
) and a positive (Maekawa et al., 1991
; Zeichner et al., 1991
; Moses et al., 1994
; di Fagagna et al., 1995
; Sieweke et al., 1998
) effect of USF on HIV-1 subtype B LTR-directed transcription. Despite this, the impact of USF on LTR-directed transcription from different subtypes is unknown. However, it has been shown that the USF site in the core-NRE deviates from the E-box consensus in the majority of naturally occurring subtype B isolates (Estable et al., 1996
). This suggests that the effect of USF upon LTR-directed transcription will vary depending on the isolate or prototypical subtype sequences in the core-NRE USF site.
In this study, we have further investigated the functional importance of the core-NRE site from LTRs of HIV-1 subtypes A to E and G, both in T-cells and in epithelial cells, with respect to USF. Our results show that USF activates LTR-directed transcription in T-cells, while it functions as a transcription repressor of the HIV-1 LTR in epithelial cells. This dual tissue-specific effect of USF was unexpectedly subtype-independent despite variability within the core-NRE USF-binding site. The fact that the effects of USF are independent of the core-NRE USF site was corroborated by electrophoretic mobility shift assays (EMSAs) showing that USF binds strongly to subtype B, weakly to subtype C, but does not bind to the core-NRE of subtypes A, D, E or G. Taken together, our data show that USF affects HIV-1 LTR-directed transcription from all the subtypes tested and suggests that USF is acting through an unidentified element conserved in subtypes A to E and G.
| Methods |
|---|
|
|
|---|
Plasmid constructs.
USF, pCMVUSF was digested with NcoI and XhoI, blunt-ended with Klenow and ligated.
Mutant LTR.
To generate HIV-1 LTRs containing core-NRE deletions, pCR2.1 (Invitrogen) containing the LTR from subtype B (TA-SF2:1) was used as a template (Naghavi et al., 1999a
). PCR was performed in two separate reactions containing 1 µM each of oligonucleotides LTR1-SX and NRE-1 (mix I) or LTR3-SB and NRE-2 (mix II). As previously described (Naghavi et al., 1999b
), LTR1-SX contains StuI and XhoI cloning sites and LTR3-SB contains SalI and BamHI cloning sites. NRE-1 and NRE-2 primers are complementary and each contain a 12 bp deletion which removes the core-NRE (position -174 to -163). The sequences of these primers are NRE-1, 5' GCTCTCGGGCTGCTAGGAGG 3' and NRE-2, 5' CCTCCTAGCAGCCCGAGAGC 3'. Equal amounts of the two PCR fragments generated were mixed and used as template in a nested PCR reaction primed by the addition of oligonucleotides LTR1-SX and LTR3-SB as previously described (Naghavi et al., 1999b
). The XhoIBamHI PCR fragment was then transferred into pNLCATXSXB (Naghavi et al., 1999b
).
To generate a full-length HIV-1 clone with a deletion of the core-NRE, the resulting mutant LTR sequence was inserted as a AatIIBssHII fragment into pNL4-3 as previously described (Naghavi et al., 1999b
). The sequence of the core-NRE mutant (mSF2:1) was confirmed by sequencing.
Cells and transfections.
The human T-cell lymphoma line Jurkat (ATCC) was seeded at 1·5x106 cells per well in a 12-well dish. The next day, the cells were transfected using 2 µl FuGENE 6 transfection reagent (Boehringer Mannheim) per µg DNA. Transfection efficiency was normalized to human growth hormone (hGH) expressed from the cotransfected pCMVHGH plasmid, which was present in all transfections as described previously (Naghavi et al., 1999b
). A titration of various pCMVUSF plasmid concentrations (07 µg) against the pNLCATB plasmid was used as a control for the effect of USF at different concentrations. Each of the pNLCAT-derived plasmids (in 3 µl aliquots) were mixed with 1 µg pCMVHGH in the presence or absence of 1 µg pCMVtat and/or 7 µg pCMVUSF or pCMV
USF. The total amount of DNA in each transfection was adjusted to 12 µg by the addition of pBluescript DNA. The FuGENE transfection reagent was added into the DNA mix according to the standard protocol (Boehringer Mannheim). At 48 h post-transfection, cell lysates were obtained by suspending the cell pellets in 500 µl of lysis buffer (100 mM Tris, pH 7·6, and 1% Triton X-100), freezethawed three times and centrifuged at 15000 g for 15 min at 4 °C. CAT and hGH activity was measured as described below.
Transfection of HeLa cells was performed with the DNAcalcium phosphate coprecipitation technique as described previously (Naghavi et al., 1999b
). DNA was mixed exactly as for transfection of Jurkat cells except that the total amount of DNA was adjusted to 15 µg by the addition of pBluescript DNA. Cells were harvested and analysed 24 h post-transfection as described above. In order to analyse the effect of USF on the wt and core-NRE-deleted LTR from subtype B (TA-SF2:1), the respective pNL4-3-derived plasmid was included in the transfection of HeLa cells. The effect of USF at various concentrations was tested against pNL4-3:1B as described for pNLCATB. Cell culture supernatants were collected at various times post-transfection (0, 24, 48, 72 and 92 h) and the production of hGH and HIV-1 p24gag was measured as described below.
ELISA for CAT, hGH and p24gag.
Cell extracts and supernatants from the transfected cells were analysed for CAT and hGH by ELISA (Boehringer Mannheim), according to the manufacturers instructions. Each LTR plasmid was tested in duplicate or triplicate samples in at least two independent experiments. CAT values were normalized to hGH values. To monitor the p24gag production in transfections with pNL4-3-derived plasmids, cell culture supernatants were analysed in a p24gag antigen capture HIVAG-1 ELISA (Abbott), according to the manufacturers instructions.
Purification of recombinant USF43.
rUSF43 was expressed and purified by the FLAG epitope-tagging and peptide elution method as described previously (Chiang & Roeder, 1993
). The pFlagUSFpET-11d plasmid, which encodes the human USF43 protein (Kirschbaum et al., 1992
) fused to an eight amino acid FLAG peptide (Chiang & Roeder, 1993
), was expressed and purified by standard techniques using M2-agarose (Kodak). The FLAG fusion protein was eluted by incubating the M2-agarose with 500 µl (0·2 mg/ml) of the FLAG peptide (Chiang & Roeder, 1993
) at 4 °C for 20 min. Only one band was visible on Coomassie-stained gels after purification (not shown).
Electrophoretic mobility shift assays.
EMSAs were performed as previously described (Estable et al., 1999
). Nuclear extracts were prepared from HeLa cells and the human T-cell lymphoma line HUT-78 as previously described (Dignam et al., 1983
). Oligonucleotides containing consensus core-NRE for different LTR subtypes of HIV-1 (NRE-A, -B, -C, -D, -E and -G) were designed on the basis of previously reported sequences (Naghavi et al., 1999b
) and are shown aligned in Fig. 6(b
). Double-stranded oligonucleotides were end-labelled by filling in with Klenow. EMSAs were performed in 50 mM KCl, 5 mM MgCl2, 8% glycerol, 4 µg BSA, 10 mM HEPES, pH 7·9, 4 µg poly(dI-dC) (Pharmacia), 48 µg nuclear extract or 100 ng purified rUSF and 100 pmol 32P-labelled double-stranded probe in the absence or presence of 100 pmol competitor.
|
| Results |
|---|
|
|
|---|
7 µg of the pCMVUSF plasmid (Fig. 2e
USF, in which the USF ORF was deleted, was included in some of the cotransfections. No inhibition of LTR-mediated transcription was observed for pNLCATB in the presence of 7 µg pCMV
USF in HeLa cells (Fig. 2f
|
|
USF represses LTR-directed transcription in HeLa cells, independently of the USF-binding site sequences in the core-NRE
In order to test the functional importance of the USF-binding site in the NRE, a 12 bp deletion, which included the USF site, was introduced into the NRE of the LTR sequences from subtype B (see Fig. 6b
). The wt (SF2:1B) or mutant (mSF2:1B) LTR clones were then transferred into pNLCATXSXB or pNL4-3 plasmids (see Methods) and tested in transient transfections in the absence or presence of the viral protein Tat or/and USF in HeLa cells. The levels of CAT and p24gag are indicated in Figs 3
and 4
, respectively. The core-NRE mutant clone showed a higher CAT activity (1·2- to 1·4-fold) than the wt clone in both the absence (Fig. 3a
) and presence (Fig. 3b
) of Tat, confirming a negative effect of the core-NRE region on HIV-1 LTR transcription in epithelial cells (Rosen et al., 1985
; Garcia et al., 1987
; Giacca et al., 1992
). Notably, the fold inhibition of USF was similar for the wt and mutant clones both in the absence (Fig. 3a
) and in the presence (Fig. 3b
) of Tat (2·2- to 2·5-fold and 1·4- to 1·6-fold, respectively). Importantly, this indicates that the core-NRE site is not of functional importance for the inhibitory effect of USF. The levels of hGH activity produced from pCMVHGH, which is driven by the CMV promoter, were similar both in the absence or in the presence of USF (Fig. 3c
), demonstrating that USF had no effect on the CMV promoter.
|
|
USF in HeLa cells (Fig. 4e
7 µg of the pCMVUSF plasmid as observed in the CAT assay (Fig. 4f
USF activates LTR-mediated transcription in Jurkat cells, independently of the subtype from which the LTR was derived
To investigate whether USF also functions as a down regulator of LTR-mediated transcription in T-cells, six of the previously described CAT clones containing LTR sequences from subtypes A to E and G (UG5218:1A, pNLCATB:B, GM6439:1C, UG6357:1D, TH6098:1E and GM6139:1G, respectively) (Naghavi et al., 1999b
) were analysed in transient transfections in T-cells. Jurkat cells were cotransfected in triplicate with or without USF in the presence of Tat as described for HeLa cells (Naghavi et al., 1999b
). Surprisingly, USF caused an upregulation of transcription from the HIV-1 LTR in Jurkat cells (Fig. 5a
). The USF activation in Jurkat cells was between 1·7- and 3·2-fold. The stimulatory effect of USF was dose-dependent, with a maximum stimulation obtained with pCMVUSF at 2 µg and above (Fig. 5c
). A similar pattern of CAT activity was observed in the absence or presence of USF in HUT-78 cells (data not shown). Thus, USF activates LTR-directed transcription in T-cells, independently of the subtype from which the LTR was derived.
|
USF in Jurkat cells (Fig. 5d
USF interacts in vitro with the core-NRE USF-binding sites from only a subset of HIV subtypes
As shown in Fig. 6(a
), two complexes form between proteins in HeLa nuclear extracts and a radiolabelled double-stranded oligonucleotide comprising sequences from the USF core-NRE site of the HIV-1 LTR subtype B consensus (lane 2) that contains a perfect USF E-box site (CACRTG). Whereas the lower band was shown to be non-specific by using an unrelated probe (results not shown), the upper complex (labelled USF) was specific to the core-NRE USF site B, since it is abolished with 100-fold competition with unlabelled core-NRE USF site B (lane 4) or C (lane 5), but not with core-NRE USF sites from the other subtypes (lanes 3, 69). That this band represents USF interaction is strongly suggested by the sequences encompassed within the sites that did not compete, since they do not conform to the consensus USF target sequence, CACRTG. Further evidence that the major band represented USF interaction could be deduced from EMSAs with rUSF43 (lanes 1015), where a single band at the same position as the band from HeLa nuclear extract behaves in an identical manner when competed with the various subtype core-NRE consensus sequences. Furthermore, a complex between rUSF43 and radiolabelled core-NRE consensus sequences was not detected for any subtype other than B and C (Fig. 7
). Lanes 38 demonstrate that rUSF43 could only interact with the core-NRE from subtype B and to a lesser extent with that from subtype C and both were specific (lanes 9 and 10). Since we observed differences in HeLa and T-cells in transient transfections, we also tested nuclear extracts from the T-cell line HUT-78 (Fig. 7
, lane 2). The same pattern of shifting was also observed for core-NRE from subtypes tested using nuclear extract from HeLa or HUT-78 cells (Fig. 8
). In summary, USF interacts with core-NRE from subtypes B and C but not with the core-NRE from subtypes A, D, E or G.
|
|
| Discussion |
|---|
|
|
|---|
B site and an alternative core-NRE (Naghavi et al., 1999b
Our data indicate that USF functions as a repressor of HIV-1 LTR-directed transcription in HeLa cells. This result agrees with previous findings that suggested an inhibitory effect of USF in HeLa as well as in COS-1 cells (Giacca et al., 1992
). However, two in vitro transcription studies performed with nuclear extract from HeLa cells suggest that USF is a positive regulator of LTR-mediated transcription (Maekawa et al., 1991
; di Fagagna et al., 1995
). The apparent discrepancy is likely to be a result of the inherent differences when examining transcription in vivo versus in vitro, e.g. nuclear extracts may not necessarily re-capitulate the in vivo conditions. One possibility would be that the in vitro system lacks a partner for USF that is present in vivo and this confers repression when partnered with USF. Another explanation for the discrepant results would be the usage of shorter LTR regions in these studies, e.g. lacking the initiator element and the TAR sequences (di Fagagna et al., 1995
) or AP1- and NFAT-binding sites (Maekawa et al., 1991
). The ability of USF to repress LTR-directed transcription was independent of subtype and, more so, independent of the core-NRE USF-binding site. This suggested that USF is acting through a site other than the core-NRE E-box. Our in vitro EMSA data further substantiate this conclusion, since only subtype B and C consensus sequences interacted with USF. Importantly, the repressive effects of USF were evident in the presence of Tat and more pronounced in the context of whole virus. The important distinction is that Tat is expressed either under the control of the CMV promoter (transient transfections) or under the control of the respective HIV-1 LTRs (whole genome context). USF would lengthen the time for the first Tat to be made and the effects appear more pronounced in the context of whole virus, just as we have observed.
We have shown that USF activates LTR-directed transcription in T-cells, in contrast to the repression in HeLa cells. This finding confirms earlier studies that indicate a positive effect of USF in T-cells (Sieweke et al., 1998
) and macrophages (Moses et al., 1994
). Here we extend these previous findings to show that this activation, as is the case for the repression in HeLa cells, is subtype-independent. As was the case for the repressive effects in HeLa cells, we have further shown by mutagenesis of the core-NRE and through in vitro EMSAs that these effects are not mediated by the core-NRE USF-binding site and occur in the presence or absence of Tat. Additional experiments for demonstrating how USF is recruited to the LTR as well as the role of overexpressed USF in primary cells are under investigation.
The apparent dual, tissue-specific, repressor/activator role for USF that we detect takes on physiological importance because it is subtype-independent. Unfortunately, a subtype-independent role for most transcription factors binding to putative elements within the prototypical HIV-1 LTR has not been investigated. However, sequence analysis of variants indicates that very few elements within the HIV-1 LTRs naturally occurring in patients adhere to the prototypical sequence (Estable et al., 1996
). USF may therefore play a role in the control of HIV-1 latency versus activation of all HIV-1 variants. Although we have not determined the mechanism by which USF could achieve this role, the interaction of USF with another cellular transcription factor is possible since USF is a protein capable of dimerization. Direct interaction between USF and Ets-1 has recently been suggested to be required for full transcriptional activity of the HIV-1 LTR in T-cells (Sieweke et al., 1998
). It has been speculated that LEF, Ets-1 and USF function together in a complex that maintains the promoter in an open configuration (Jones & Peterlin, 1994
). In addition, the activation of the LTR by NF-IL6 has been suggested to be mediated through a direct interaction of NF-IL6 with other LTR-binding proteins rather than an interaction of NF-IL6 with its binding site present also in the HIV-1 core-NRE (Tesmer et al., 1993
). Importantly, USF may bind to another unrelated binding site in the initiator element (Inr) in the HIV-1 LTR (Du et al., 1993
). Cooperative interaction of transcription initiation factor TFII-I and USF at both Inr and E-box sites has been suggested (Meisterernst et al., 1991
; Roy et al., 1991
, 1997
; Chiang & Roeder, 1995
). An additional consideration is that USF may affect HIV-1 LTR-directed transcription through interactions with E-boxes present in cellular genes. In this regard, sequence similarity between core-NREs of HIV-1, IFN
and IL-2R
has been reported (Nourbakhsh et al., 1993
; Smith & Greene, 1989
).
More recently, USF has been suggested to be involved in the pathogenesis of AIDS (Simm et al., 1996
; Rousseau et al., 1997
; Moriuchi et al., 1999
). It has also been suggested that USF plays an important role both in virus expression and in virus entry through upregulation of the promoter activity of CXCR4 (Moriuchi et al., 1999
). On the basis of both these findings and our data, USF appears to have at least the potential to affect HIV-1 replication both positively and negatively.
Data about HIV-1 biological activity, transmission and pathogenicity are predominantly based on subtype B virus analysis. Although these viruses are prevalent in Western countries, Asia and Africa, they account for only a small number of HIV-1 infections worldwide. However, subtype C accounts for approximately half of all HIV-1 infections in the world (WHO, 1998
). Next to subtype C, subtype E is the most prevalent in the world (Burke, 1996
). This faster expansion and the global dominance of subtype C and E viruses have been correlated with a higher transcriptional activity of these subtypes (Montano et al., 1997
, 1998
). However, the faster spread of these viruses may just be a consequence of the virus epidemiology in highly populated areas such as India, sub-Saharan Africa (HIV-1 subtype C) and Thailand (HIV-1 subtype E). We have also observed a higher transcriptional activity of subtype C viruses (Naghavi et al., 1999b
). In addition, inter-subtype recombination within the 5'LTR of subtypes A, C and D has been suggested to lead to increased fitness of viruses (Blackard et al., 1999
). A recent study suggests that although minor sequence alterations in the LTR of subtype E viruses result in subtle differences in LTR function, they can have a significant impact on virus replication (Jeeninga et al., 2000
). Therefore, further investigation of the divergent transcriptional regulation in relation to pathogenesis and transmission of non-subtype B viruses is important. Further understanding of such diversity may provide us with preventive and therapeutic strategies against AIDS.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bell, B. & Sadowski, I.(1996). Ras-responsiveness of the HIV-1 LTR requires RBF-1 and RBF-2 binding sites. Oncogene 13, 2687-2697.[Medline]
Bjorndal, A., Sonnerborg, A., Tsherning, C. & Fenyo, E. M.(1999). Phenotypic characteristics of human immunodeficiency virus type 1 subtype C isolates of Ethiopian AIDS patients. AIDS Research and Human Retroviruses 15, 647-653.[Medline]
Blackard, J. T., Renjifo, B. R., Mwakagile, D., Montano, M. A., Fawzi, W. W. & Essex, M.(1999). Transmission of human immunodeficiency type 1 viruses with intersubtype recombinant long terminal repeat sequences. Virology 254, 220-225.[Medline]
Burke, D. S.(1996). Joseph-Alexandre Auzias-Turenne, Louis Pasteur, and early concepts of virulence, attenuation, and vaccination. Perspectives in Biology and Medicine 39, 171-186.[Medline]
Carthew, R. W., Chodosh, L. A. & Sharp, P. A.(1985). An RNA polymerase II transcription factor binds to an upstream element in the adenovirus major late promoter. Cell 43, 439-448.[Medline]
Chiang, C. M. & Roeder, R. G.(1993). Expression and purification of general transcription factors by FLAG epitope-tagging and peptide elution. Peptide Research 6, 62-64.[Medline]
Chiang, C. M. & Roeder, R. G.(1995). Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science 267, 531-536.
Chodosh, L. A., Carthew, R. W. & Sharp, P. A.(1986). A single polypeptide possesses the binding and transcription activities of the adenovirus major late transcription factor. Molecular and Cellular Biology 6, 4723-4733.
di Fagagna, F. D., Marzio, G., Gutierrez, M. I., Kang, L. Y., Falaschi, A. & Giacca, M.(1995). Molecular and functional interactions of transcription factor USF with the long terminal repeat of human immunodeficiency virus type 1. Journal of Virology 69, 2765-2775.[Abstract]
Dignam, J. D., Lebovitz, R. M. & Roeder, R. G.(1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Research 11, 1475-1489.
Du, H., Roy, A. L. & Roeder, R. G.(1993). Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the Ad-ML promoters. EMBO Journal 12, 501-511.[Medline]
Estable, M. C., Bell, B., Merzouki, A., Montaner, J. S., OShaughnessy, M. V. & Sadowski, I. J.(1996). Human immunodeficiency virus type 1 long terminal repeat variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity. Journal of Virology 70, 4053-4062.[Abstract]
Estable, M. C., Bell, B., Hirst, M. & Sadowski, I.(1998a). Naturally occurring human immunodeficiency virus type 1 long terminal repeats have a frequently observed duplication that binds RBF-2 and represses transcription. Journal of Virology 72, 6465-6474.
Estable, M. C., Merzouki, A., Arella, M. & Sadowski, I. J.(1998b). Distinct clustering of HIV type 1 sequences derived from injection versus noninjection drug users in Vancouver, Canada. AIDS Research and Human Retroviruses 14, 917-919.[Medline]
Estable, M. C., Hirst, M., Bell, B., OShaughnessy, M. V. & Sadowski, I.(1999). Purification of RBF-2, a transcription factor with specificity for the most conserved cis-element of naturally occurring HIV-1 LTRs. Journal of Biomedical Science 6, 320-332.[Medline]
Gao, F., Robertson, D. L., Morrison, S. G., Hui, H., Craig, S., Decker, J., Fultz, P. N., Girard, M., Shaw, G. M., Hahn, B. H. & Sharp, P. M.(1996). The heterosexual human immunodeficiency virus type 1 epidemic in Thailand is caused by an intersubtype (A/E) recombinant of African origin. Journal of Virology 70, 7013-7029.
Garcia, J. A., Wu, F. K., Mitsuyasu, R. & Gaynor, R. B.(1987). Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus. EMBO Journal 6, 3761-3770.[Medline]
Gaynor, R.(1992). Cellular transcription factors involved in the regulation of HIV-1 gene expression. AIDS 6, 347-363.[Medline]
Giacca, M., Gutierrez, M. I., Menzo, S., Di Fagagna, F. D. & Falaschi, A.(1992). A human binding site for transcription factor USF/MLTF mimics the negative regulatory element of human immunodeficiency virus type 1. Virology 186, 133-147.[Medline]
Gregor, P. D., Sawadogo, M. & Roeder, R. G.(1990). The adenovirus major late transcription factor USF is a member of the helix-loop-helix group of regulatory proteins and binds to DNA as a dimer. Genes & Development 4, 1730-1740.
Holzmeister, J., Ludewig, B., Pauli, G. & Simon, D.(1993). Sequence specific binding of the transcription factor c-Ets1 to the human immunodeficiency virus type I long terminal repeat. Biochemical and Biophysical Research Communications 197, 1229-1233.[Medline]
Janssens, W., Buve, A. & Nkengasong, J. N.(1997). The puzzle of HIV-1 subtypes in Africa. AIDS 11, 705-712.[Medline]
Jeeninga, R. E., Hoogenkamp, M., Armand-Ugon, M., de Baar, M., Verhoef, K. & Berkhout, B.(2000). Functional differences between the LTR transcriptional promoters of HIV-1 subtypes A through G. Journal of Virology 74, 3740-3751.
Jones, K. A. & Peterlin, B. M.(1994). Control of RNA initiation and elongation at the HIV-1 promoter. Annual Review of Biochemistry 63, 717-743.[Medline]
Kanki, P. J., Hamel, D. J., Sankale, J. L., Hsieh, C., Thior, I., Barin, F., Woodcock, S. A., Gueye-Ndiaye, A., Zhang, E., Montano, M., Siby, T., Marlink, R., NDoye, I., Essex, M. E. & MBoup, S.(1999). Human immunodeficiency virus type 1 subtypes differ in disease progression. Journal of Infectious Diseases 179, 68-73.[Medline]
Karn, J.(1999). Tackling Tat. Journal of Molecular Biology 293, 235-254.[Medline]
Kirschbaum, B. J., Pognonec, P. & Roeder, R. G.(1992). Definition of the transcriptional activation domain of recombinant 43-kilodalton USF. Molecular and Cellular Biology 12, 5094-5101.
Lu, Y., Stenzel, M., Sodroski, J. G. & Haseltine, W. A.(1989). Effects of long terminal repeat mutations on human immunodeficiency virus type 1 replication. Journal of Virology 63, 4115-4119.
Lu, Y. C., Touzjian, N., Stenzel, M., Dorfman, T., Sodroski, J. G. & Haseltine, W. A.(1990). Identification of cis-acting repressive sequences within the negative regulatory element of human immunodeficiency virus type 1. Journal of Virology 64, 5226-5229.
Maekawa, T., Sudo, T., Kurimoto, M. & Ishii, S.(1991). USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1. Nucleic Acids Research 19, 4689-4694.
Meisterernst, M., Roy, A. L., Lieu, H. M. & Roeder, R. G.(1991). Activation of class II gene transcription by regulatory factors is potentiated by a novel activity. Cell 66, 981-993.[Medline]
Miyamoto, N. G., Moncollin, V., Egly, J. M. & Chambon, P.(1985). Specific interaction between a transcription factor and the upstream element of the adenovirus-2 major late promoter. EMBO Journal 4, 3563-3570.[Medline]
Montano, M. A., Novitsky, V. A., Blackard, J. T., Cho, N. L., Katzenstein, D. A. & Essex, M.(1997). Divergent transcriptional regulation among expanding human immunodeficiency virus type 1 subtypes. Journal of Virology 71, 8657-8665.[Abstract]
Montano, M. A., Nixon, C. P. & Essex, M.(1998). Dysregulation through the NF-kappaB enhancer and TATA box of the human immunodeficiency virus type 1 subtype E promoter. Journal of Virology 72, 8446-8442.
Moriuchi, M., Moriuchi, H., Margolis, D. M. & Fauci, A. S.(1999). USF/c-Myc enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a coreceptor for HIV-1 entry. Journal of Immunology 162, 5986-5992.
Moses, A. V., Ibanez, C., Gaynor, R., Ghazal, P. & Nelson, J. A.(1994). Differential role of long terminal repeat control elements for the regulation of basal and Tat-mediated transcription of the human immunodeficiency virus in stimulated and unstimulated primary human macrophages. Journal of Virology 68, 298-307.
Myers, G., Korber, B., Wain-Hobson, S., Smith, R. & Pavlakis, G. N. (1995). A compilation and analysis of nucleic acid and amino acid sequences. In Human Retroviruses and AIDS. Los Alamos, New Mexico: Los Alamos National Laboratory.
Naghavi, M. H., Salminen, M. O., Sonnerborg, A. & Vahlne, A.(1999a). DNA sequence of the long terminal repeat of human immunodeficiency virus type 1 subtype A through G. AIDS Research and Human Retroviruses 15, 485-488.[Medline]
Naghavi, M. H., Schwartz, S., Sonnerborg, A. & Vahlne, A.(1999b). Long terminal repeat promoter/enhancer activity of different subtypes of HIV type 1. AIDS Research and Human Retroviruses 15, 1293-1303.[Medline]
Nourbakhsh, M., Hoffmann, K. & Hauser, H.(1993). Interferon-beta promoters contain a DNA element that acts as a position-independent silencer on the NF-kappaB site. EMBO Journal 12, 451-459.[Medline]
Ramirez-Solis, R., Resendez-Perez, D., Alvidrez-Quihui, L. E., Rincon-Limas, D. E., Varela-Martinez, R., Martinez-Rodriguez, H. G. & Barrera-Saldana, H. A.(1990). New vectors for the efficient expression of mammalian genes in cultured cells. Gene 87, 291-294.[Medline]
Robertson, D. L., Hahn, B. H. & Sharp, P. M.(1995a). Recombination in AIDS viruses. Journal of Molecular Evolution 40, 249-259.[Medline]
Robertson, D. L., Sharp, P. M., McCutchan, F. E. & Hahn, B. H.(1995b). Recombination in HIV-1. Nature 374, 124-126.[Medline]
Rosen, C. A., Sodroski, J. G. & Haseltine, W. A.(1985). The location of cis-acting regulatory sequences in the human T-cell lymphotropic virus type III (HTLV-III/LAV) long terminal repeat. Cell 41, 813-823.[Medline]
Rousseau, C., Abrams, E., Lee, M., Urbano, R. & King, M. C.(1997). Long terminal repeat and nef gene variants of human immunodeficiency virus type 1 in perinatally infected long-term survivors and rapid progressors. AIDS Research and Human Retroviruses 13, 1611-1623.[Medline]
Roy, A. L., Meisterernst, M., Pognonec, P. & Roeder, R. G.(1991). Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature 354, 245-248.[Medline]
Roy, A. L., Du, H., Gregor, P. D., Novina, C. D., Martinez, E. & Roeder, R. G.(1997). Cloning of an inr- and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1. EMBO Journal 16, 7091-7104.[Medline]
Sawadogo, M. & Roeder, R. G.(1985a). DNA-binding specificity of USF, a human gene-specific transcription factor required for maximum expression of the major late promoter of adenovirus. In DNA Tumor Viruses: Control of Gene Expression and Replication (Cancer Cells, 4) , pp. 147-154. Edited by M. Botchan, T. Grodzicker & P. A. Sharp. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory.
Sawadogo, M. & Roeder, R. G.(1985b). Factors involved in specific transcription by human RNA polymerase II: analysis by a rapid and quantitative in vitro assay. Proceedings of the National Academy of Sciences, USA 82, 4394-4398.
Sawadogo, M., Van Dyke, M. W., Gregor, P. D. & Roeder, R. G.(1988). Multiple forms of the human gene-specific transcription factor USF. I. Complete purification and identification of USF from HeLa cell nuclei. Journal of Biological Chemistry 263, 11985-11993.
Sieweke, M. H., Tekotte, H., Jarosch, U. & Graf, T.(1998). Cooperative interaction of ets-1 with USF-1 required for HIV-1 enhancer activity in T-cells. EMBO Journal 17, 1728-1739.[Medline]
Simm, M., Chao, W., Pekarskaya, O., Sova, P., Gupta, P., Balachandran, R. & Volsky, D. J.(1996). Genetic variability and function of the long terminal repeat from syncytium-inducing and non-syncytium-inducing human immunodeficiency virus type 1. AIDS Research and Human Retroviruses 12, 801-809.[Medline]
Smith, M. R. & Greene, W. C.(1989). The same 50 kDa cellular protein binds to the negative regulatory elements of the interleukin 2 receptor alpha-chain gene and the human immunodeficiency virus type 1 long terminal repeat. Proceedings of the National Academy of Sciences, USA 86, 8526-8530.
Sokolowski, M., Tan, W., Jellne, M. & Schwartz, S.(1998). mRNA instability elements in the human papillomavirus type 16 L2 coding region. Journal of Virology 72, 1504-1515.
Soto-Ramirez, L. E., Renjifo, B., McLane, M. F., Marlink, R., OHara, C., Sutthent, R., Wasi, C., Vithayasai, P., Vithayasai, V., Apichartpiyakul, C., Auewarakul, P., Pena Cruz, V., Chui, D. S., Osathanondh, R., Mayer, K., Lee, T. H. & Essex, M.(1996). HIV-1 Langerhans cell tropism associated with heterosexual transmission of HIV. Science 271, 1291-1293.[Abstract]
Tan, W., Felber, B. K., Zolotukhin, A. S., Pavlakis, G. N. & Schwartz, S.(1995). Efficient expression of the human papillomavirus type 16 L1 protein in epithelial cells by using Rev and the Rev-responsive element of human immunodeficiency virus or the cis-acting transactivation element of simian retrovirus type 1. Journal of Virology 69, 5607-5620.[Abstract]
Tesmer, V. M., Rajadhyaksha, A., Babin, J. & Bina, M.(1993). NF-IL6-mediated transcriptional activation of the long terminal repeat of the human immunodeficiency virus type 1. Proceedings of the National Academy of Sciences, USA 90, 7298-7302.
Triques, K., Bourgeois, A., Vidal, N., Mpoudi-Ngole, E., Mulanga-Kabeya, C., Nzilambi, N., Torimiro, N., Saman, E., Delaporte, E. & Peeters, M.(2000). Near-full-length genome sequencing of divergent African HIV type 1 subtype F viruses leads to the identification of a new HIV type 1 subtype designated K. AIDS Research and Human Retroviruses 16, 139-151.[Medline]
Tscherning, C., Alaeus, A., Fredriksson, R., Bjorndal, A., Deng, H., Littman, D. R., Fenyo, E. M. & Albert, J.(1998). Differences in chemokine coreceptor usage between genetic subtypes of HIV-1. Virology 241, 181-188.[Medline]
Verhoef, K., Sanders, R. W., Fontaine, V., Kitajima, S. & Berkhout, B.(1999). Evolution of the human immunodeficiency virus type 1 long terminal repeat promoter by conversion of an NF-kappaB enhancer element into a GABP binding site. Journal of Virology 73, 1331-1340.
WHO (1998). Report on the global HIV/AIDS epidemic. WHO Report. (June 1998).
Zeichner, S. L., Kim, J. Y. & Alwine, J. C.(1991). Linker-scanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat. Journal of Virology 65, 2436-2444.
Received 13 July 2000;
accepted 22 November 2000.
This article has been cited by other articles:
![]() |
X. Che, B. Berarducci, M. Sommer, W. T. Ruyechan, and A. M. Arvin The Ubiquitous Cellular Transcriptional Factor USF Targets the Varicella-Zoster Virus Open Reading Frame 10 Promoter and Determines Virulence in Human Skin Xenografts in SCIDhu Mice In Vivo J. Virol., April 1, 2007; 81(7): 3229 - 3239. [Abstract] [Full Text] [PDF] |
||||
![]() |
|