|
|
||||||||
Animal: RNA Viruses |
Institute for Animal Health, Pirbright Laboratory, Ash Road, Pirbright, Woking, Surrey GU24 0NF, UK1
Author for correspondence: Soren Alexandersen. Fax +44 1483 232 448. e-mail soren.alexandersen{at}bbsrc.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The objectives of the present study were to determine the early pathogenesis of FMD in pigs by a time-course study using a quantitative TaqMan assay (Oleksiewicz et al., 2001
) and to correlate these findings with results obtained using virus isolation in cell culture and histopathological examination of selected tissues.
| Methods |
|---|
|
|
|---|
Animals.
Virus.
A stock preparation of FMDV strain O1 Lausanne Sw/65 was obtained from the International Vaccine Bank, IAH, Pirbright, UK. It had been passaged once in cattle and then grown in porcine IB-RS-2 cells (De Castro, 1964
). For the experiments, a pig-adapted inoculum (S. Alexandersen, I. Brotherhood & A. I. Donaldson, unpublished) was made by passaging the original stock virus sequentially through a series of three pigs. The first passage was by intradermal inoculation in the heel pads, the second by experimental aerosol transmission and the third by intradermal/subdermal heel-pad inoculation of an epithelial suspension prepared from foot lesions. The experimental inoculum was a 10% (w/v) suspension of epithelial tissue from a single pig with multiple vesicular lesions (S. Alexandersen, I. Brotherhood & A. I. Donaldson, unpublished). The inoculum was stored at -70 °C. It had a titre of 108·7 TCID50/ml when assayed by end-point dilution in primary bovine thyroid (BTY) cells (Snowdon, 1966
) and 107·2 TCID50/ml when assayed in IB-RS-2 cells.
Infection of donor pigs and contact exposure of recipients.
The virus suspension used to infect the donor pigs was the pig-adapted inoculum diluted 1:10 immediately before use in Eagles minimal essential medium (MEM) with 20 mM HEPES buffer and 2x antibiotics. Each of four donor pigs received approximately 0·5 ml of the suspension (i.e. approximately 107 BTY TCID50) by the intradermal/subdermal route in the heel bulbs (Burrows, 1966
) of the left fore foot. Two pigs were inoculated on day 3 and two more on day 2 before being used as donors. The eight recipient pigs were exposed to virus by moving them into the isolation room containing the four donor pigs for a 2 h period, i.e. direct contact exposure. The donor pigs had severe, generalized lesions of FMD at this time and remained recumbent. The isolation room was within a biosecure isolation compound. After exposure, the recipient pigs were returned to their respective isolation rooms, where they were housed in individual cubicles, two animals per room, to prevent direct contact between room-mates. A detailed description of the cubicles and the isolation rooms has been submitted for publication and is available from the corresponding author.
The donor pigs were killed immediately after the 2 h exposure period. The personnel then thoroughly cleansed and disinfected their protective clothing and all other materials that had been in contact with the pigs. In order to avoid cross-infection, the recipient pigs (except pigs UD 94 and UD95, from which blood was sampled daily) were not handled until they were killed for necropsy.
Air sampling.
During exposure of the recipient pigs, air samples were collected by passive sedimentation into 18 2 ml tubes with a diameter of 9 mm containing 1 ml Trizol and 0·1 ml Eagles MEM with 20 mM HEPES and antibiotics, which were held in a rack placed at a height of about 1 m from the floor directly above the recumbent pigs. The caps were removed from the tubes during the 2 h exposure period.
Assay for virus.
Tissue suspensions were made as 10% (w/v) suspensions in maintenance medium by careful grinding with sterile sand in a mortar followed by low-speed centrifugation. Tissue suspensions and serum samples were assayed for virus in monolayer cell cultures of primary BTY cells in roller tubes after making a 10-fold dilution series of each sample and inoculating each dilution into five tubes (Donaldson et al., 1987
; Gibson & Donaldson, 1986
; Snowdon, 1966
). Infectivity titres were calculated according to Karber (as described by Lennette, 1964
). The specificity of CPE was confirmed by antigen-detection ELISA (Ferris et al., 1988
; Ferris & Dawson, 1988
; Hamblin et al., 1984
; Roeder & Le Blanc Smith, 1987
).
Assay for antibodies.
Serum samples were assayed for antibodies to FMDV by liquid-phase blocking ELISA as described previously (Hamblin et al., 1986a
, b
).
Quantitative RTPCR.
A quantitative RTPCR method was used to determine the amount of FMDV RNA in extracts of RNA from blood and tissue samples (Oleksiewicz et al., 2001
). We decided to use an assay employing primers located in the internal ribosome entry site (IRES) (Belsham, 1993
) because (i) the best primer set available in the World Reference Laboratory for Foot-and-Mouth Disease (WRL) for diagnosis of many isolates of FMDV is in the IRES region (see Reid et al., 2000
) and (ii) we have recently developed a hybridization-based RTPCR ELISA capable of detecting nearly all isolates of FMDV by using primers and oligonucleotide probes based in the IRES region (see Alexandersen et al., 2000
). All tissue samples were subjected to RNA extraction and cDNA preparation after 13 days in RNAlater. Four 4-fold RNA dilutions (3200 ng RNA) and the minimal Ct method (the
method scoring the lowest Ct value, i.e. highest virus RNA content, obtained in the four dilutions) were used in combination with specific primers (SAIR 89F, 5' CTGTCTCGTAGCGGAGCATG 3', and SAIR 151R, 5' GCCCCGTGGGTCCTTG 3') and a TaqMan fluorogenic probe (SA-P-IR 110-131F: 5' TGGCCGTGGGAACACCTCCTTG 3') designed specifically for the O1 Kaufbeuren/O1 Lausanne strains of FMDV, as detailed previously (Oleksiewicz et al., 2001
). The
method was developed specifically to overcome the problems of large variation in RNA yields and tissue-specific RTPCR inhibitors experienced when extracting RNA from solid tissue. On serum and impinger samples, we used a simplified version of the protocol, essentially omitting the absorbance measurement and RNA dilution steps and using RNase-free oyster glycogen as co-precipitant. RNA was extracted from 100 µl aliquots of the samples using the Trizol procedure. All estimations, included standard reactions using tissue samples with a known content of FMDV (as determined by virus titration in cell culture), and furthermore all quantifications were based on a comparison of the minimal Ct of samples with standard curves based on: (i) a dilution series of cell culture supernatant harvested by vigorous shaking of the flasks at 40 h after infection with FMDV (infectious titre determined by virus titration); (ii) comparison with pig sera (infectious titre determined by virus titration); and (iii) comparison with the infectivity titre of selected tissue suspensions assayed on BTY cells. The method is influenced minimally by tissue type and has a sensitivity (still in the quantitative range) of approximately 0·1 TCID50/ml of either serum or cell culture or 110 TCID50/g tissue suspension for quantitative estimation. Although they were outside the range of quantification, tissue suspensions containing as little as 1 TCID50 equivalent/g could consistently be detected as weak positives in comparison with non-infected tissues and cell cultures. One additional advantage of real-time PCR is that potential contamination with PCR product is greatly diminished, because the PCRs are never opened after cycling. Also, the dUTP/UNG contamination prevention system was used in TaqMan PCRs (PE Applied Biosystems). However, even in the absence of contamination with PCR product, unavoidable formation of unspecific PCR product and primer dimers will invariably cause an increase in TaqMan signal at very high cycle numbers (not shown). Thus, we have observed that, at high cycle numbers, negative TaqMan PCRs will, in a very small number of reactions, produce false-positive fluorescence (around 1·5% false-positive TaqMan PCRs in the Ct 4050 region when tested on a large number of negative controls). Nevertheless, detection and quantification of very low levels of virus is still possible, because no false-positive reactions were seen in the Ct 3040 range. Moreover, we observed that true weak-positive cDNAs that yielded Ct values in the range 40 to 50 did so reproducibly in repeated PCRs. By contrast, negative cDNAs that yielded false-positive Ct values in the range 40 to 50 were negative on repeated PCR (not shown). We believe that such unrepeatable false-positive TaqMan PCRs may not be due to contamination, but might relate to evaporation of PCRs or non-specific hydrolysis of TaqMan probe at very high cycle numbers. In effect, the very low level (1·5%) and non-reproducibility of false-positives makes it possible to use the Ct 4050 range for detection as well as quantification of very low levels of FMDV by TaqMan PCR, provided that several replicate PCRs are made from each cDNA. Consequently, it is considered that, since two pigs were examined at each time-point and data were obtained for days 14 p.e., the results shown in Figs 15![]()
![]()
![]()
![]()
are valid, with samples being positive at a cut-off point at or above 0·1 TCID50 equivalents/ml serum or 1 TCID50 equivalent/g tissue.
|
|
|
|
|
| Results |
|---|
|
|
|---|
In addition, selected tissues were tested both by quantitative RTPCR and by virus titration and values were plotted (Fig. 3a
, b
). The correlation coefficient (r) was 0·91 for tissue samples tested on day 3 (pig UD93) and, moreover, the starting point of the curve was very close to zero (actually an overestimation by TaqMan calculation of around 0·1 log) and the slope of the curve was very close to 1 (1·04). The titrations were performed twice and gave almost identical results. The results shown are the means of two experiments. Tissues from a pig killed on day 4 (pig UD94) were also titrated and compared to TaqMan-calculated equivalents. Again, the linear correlation between infectious titre and the TaqMan estimate was strong (r=0·96). However, the TaqMan results on these day 4 tissues were apparently about 2 log units higher than those obtained by virus titration (Fig. 3b
). This is probably because the pigs examined at 4 days p.e. had already produced local antibodies (especially pig UD94; see later) that may have altered the correlation by partly neutralizing the virus. Thus, evaluation by t-test supported the null hypothesis, i.e. that the mean titres of 18 serum samples were the same in TaqMan as in infectivity assays for the day 3 tissue samples. The day 4 tissue samples, containing low levels of neutralizing antibodies, did not support the null hypothesis; instead, a t-test indicated that the TaqMan estimate was around 2 log units higher than the infectivity result (P<0·05). Thus, the data support the conclusion that the TaqMan assay is highly reliable for determining FMDV content, despite the reduction of virus infectivity, which was presumably due to neutralization by circulating antibodies. In order to get the best possible quantifications based on the data available, we used the curve from the UD93 samples (Fig. 3a
) to calculate the TCID50 equivalents from the TaqMan data from tissue samples.
Quantitative RTPCR results and calculation of equivalents to infectivity titres (TCID50 equivalents)
Based on the data above, we assayed all of the tissue samples in this pathogenesis study by quantitative RTPCR and converted the Ct values obtained to estimated TCID50 equivalents. The results are presented as scatter diagrams showing the content of each sample (Fig. 4
). In general, the results differed very little between individual pigs (usually less than 10-fold variation). The data are shown on a log10 scale to be comparable with the way infectivity data are usually depicted. The discriminating power of the assay is 5- to 10-fold and, therefore, a log10 representation of the data is considered appropriate.
Fig. 4
shows that significant amounts of virus could be detected in several tissues as early as 1 day p.e. However, the concentrations were usually low on days 1 and 2 p.e. and then rose on days 3 and 4 p.e. Some tissues, including liver, spleen, lung and bronchial lymph node, contained very low virus concentrations on days 1 and 2 p.e., which then increased on days 3 and 4 p.e. However, the levels did not exceed those found in the corresponding serum samples. Two sites in the lung were examined: the frontal lobe (lung 1) and the accessory lobe (lung 2). The virus contents of the two were found to be very similar. In a previous study, we had quantified the FMDV content in samples from five different areas of the lungs of two intradermally/subdermally inoculated pigs at days 2 and 3 p.e. and found the contents to be similar in all sites (data not shown; Oleksiewicz et al., 2001
). Respiratory tract (nasal mucosa and trachea) samples had slightly higher virus contents on days 1 and 2 p.e. which also increased at days 3 and 4 p.e. Tissues of the pharynx (ventral floor of pharynx, soft palate and tonsil) had consistently intermediate virus concentrations from day 1 and were probably the initial sites of virus deposition and replication. The concentration of virus in tongue epithelium and skin samples from the coronary band of the foot started at a low to medium level and then increased to very high levels on day 4 p.e. Sites with vesicular lesions had the highest concentrations of virus, but macroscopically normal tongue and skin samples also had relatively high levels. Thus, these epithelial tissues are thought to be major sites of virus replication.
Recovery of airborne virus in settling plates
The fluid in all 18 of the exposed tubes left open during the 2 h exposure period to test for the presence of sedimenting airborne virus particles was found to contain virus by the quantitative RTPCR assay, at approximately 10 TCID50 equivalents/ml.
Clinical signs, viraemia and seroconversion
At the time that the donor pigs were used for transmission of virus, they had typical FMD lesions on their feet and tongue. No clinical signs were evident in recipient pigs until days 3 and 4 p.e. At day 3 p.e., they had painful feet and small vesicles on the coronary bands of the feet and on the snout, which were more pronounced at day 4 p.e. None of the pigs showed any clinical signs of respiratory disease. At the time of necropsy of donor and recipient pigs, at days 3 and 4 p.e., vesicular lesions were evident on all four feet, the gingival mucosa, the tongue and the snout. No gross pathological lesions were observed in internal organs.
Histopathological examination of haematoxylin and eosin-stained sections confirmed the presence of vesicular lesions in the epithelia of the feet and tongue but not in normal skin and tongue epithelia. Lesions were not detected in the trachea, lungs, soft palate or tonsil. Therefore, histopathological examination did not indicate any significant cytopathogenic or inflammatory changes in any internal organs associated with the FMDV infection.
Tests on serum samples taken during the experiment revealed that one day-4 pig (UD94) had an ELISA antibody titre of 1:362 on day 4 while the other day-4 pig (UD95) had a titre of 1:128. This last pig (UD95) had a borderline positive titre of 1:45 (1:40 being the cut-off point; Donaldson et al., 1996
) on day 2. All other sera were negative for specific antibodies.
| Discussion |
|---|
|
|
|---|
The TaqMan RTPCR assay used had a quantitative range of more than eight orders of magnitude and the results correlated strongly with infectivity titres obtained from virus grown in cell culture preparations. We applied the method in the present work and obtained a strong correlation between the quantities of FMDV RNA and virus infectivity in serum and tissue samples. However, for certain tissue samples, estimates by RTPCR were approximately 2 log units higher than those determined by virus titration, depending on the actual sample. This is most likely due to the presence of low levels of FMDV-neutralizing antibodies in the day 4 p.e. tissue samples. Nevertheless, estimation of FMDV contents in tissue samples on the basis of TaqMan RTPCR and standard curves gave consistent results, irrespective of the presence of antibodies.
The time-course showed that the appearance of vesicular lesions was coincident with the peak of viraemia and high concentrations of virus in sites where there were clinical lesions. Histopathological abnormalities were found only in areas where there were macroscopic lesions. However, samples of tissue from histopathologically normal areas in the tongue and skin contained significant amounts of virus, albeit 12 log units less than similar sites with macroscopic lesions. The amount of virus was up to 109 TCID50 equivalents/g and 105106 TCID50 equivalents/g in normal skin and pharynx, respectively, during the period of the investigation (days 14 p.e.). Relatively high titres of FMDV have been described previously in macroscopically normal skin from cattle, although microscopic lesions, i.e. microvesicles, were observable in the sections (Gailiunas, 1968
; Gailiunas & Cottral, 1966
, 1967
). It is possible that there is a difference between the replication of FMDV in the skin of cattle and pigs, since in situ hybridization studies have previously identified FMDV RNA in the normal skin of pigs without associated lesions (Brown et al., 1995
).
In order to compare the pathogenesis of FMDV in pigs that had been infected with the same inoculum but by the intradermal/subdermal route of inoculation, data obtained in a previous study expressed as relative FMDV RNA content (Oleksiewicz et al., 2001
) were converted to TCID50 equivalents by reference to a standard curve (Fig. 5
). Interestingly, the contact-infected pigs in the present study took 12 days longer than those that were inoculated artificially (Oleksiewicz et al., 2001
) to reach peak levels of viraemia and tissue-localized virus and, moreover, the peak levels were approximately 12 log units lower, except for epithelial lesions, which had very high and comparable levels in both groups. This may indicate that, when a longer period is required for virus amplification, the host response may reduce virus replication more effectively. However, if host factors are responsible for this reduction, seen as early as 3 days p.e. in intradermally challenged pigs, these factors most likely include antibodies (circulating antibodies detectable from day 4) and possibly interferons or certain cytokines, perhaps TNF-
or IL-1. This is supported by the severe pyrexia seen in affected pigs. Nevertheless, a single pig, infected by exposure to airborne virus and included for comparison, had FMDV RNA levels in tissue samples at 5 days p.e. that were comparable to those in contact-infected animals at days 34 p.e., even though this pig had developed antibodies against the virus (ELISA titre of 1:64). This may indicate differences in virus replication and accumulation kinetics and perhaps in host reaction in pigs infected by a virus aerosol; however, this is speculative and more data are needed for confirmation.
The dose that infected the recipient pigs exposed by contact was not determined but it can be presumed that it was high, since the donor pigs had severe generalized disease and were in close contact for 2 h. The airborne virus they excreted would have been associated with heterogeneously sized particles (Donaldson et al., 1981
; Sellers & Parker, 1969
). Therefore, all parts of the respiratory tract of the recipient pigs would have been exposed to infectivity (Hatch & Gross, 1964
). The presence of virus in the tubes placed above the floor during the exposure period confirms that airborne virus was present, but does not give an accurate indication of the exposure dose, since this sampling method would have selectively collected the more rapidly sedimenting particles. While the recipient pigs are most likely to have been infected by the aerogenous route, the possibility that additional routes were involved, e.g. the alimentary or conjunctival route, cannot be excluded. It is interesting, however, that, when the distribution of virus in pigs infected by different routes, i.e. contact and intradermal/subdermal heel pad inoculation (and selected samples from a single pig infected by airborne virus), were compared, similar patterns of tissue distribution were found. However, virus accumulation in the tonsil and perhaps the lung in late infection was unexpectedly high in the pig infected by the aerogenous route. This may suggest that the initial distribution of FMDV in pigs is determined in part by the predilection of virus for certain sites in the pig, as has been established for cattle (Burrows et al., 1981
).
Only tissues from the pharynx (ventral floor of pharynx, soft palate and tonsil) had intermediate concentrations of virus, fluctuating from 104 to 106 TCID50 equivalents/g, throughout the study period (days 14), i.e. 100-fold or more higher than the other tissues at days 1 and 2. By contrast, the virus concentrations in other tissues were low initially and, for certain tissues, increased sharply at days 3 and 4 p.e. Thus, our data are consistent with tissues of the pharynx being the most likely initial sites of virus replication or deposition. Whether FMDV replicates initially in the pharynx or reaches that site by the aerogenous or haematogenous route is currently unknown. However, our hypothesis, which would explain the differences observed in the kinetics of FMDV replication and accumulation between pigs infected by natural routes and those infected by artificial routes, is that natural FMDV infection in pigs is initiated by the deposition of inhaled virus in the pharynx, in particular the soft palate and the tonsil. After passage through local lymph nodes, the virus enters the bloodstream at a low, not yet measurable, level of infectivity. This initial viraemia results in the infection of a few cells in the stratified squamous epithelia, perhaps including Langerhans cells (David et al., 1995
), resulting in a significant amplification of virus, and higher viraemia then results in the infection of a larger number of epithelial cells. In susceptible hosts, this cycle continues until sufficient epithelial cells are infected in predilection sites to cause the development of vesicular lesions and signs typical of the disease or until controlled by the host response. Based on our data, we propose that a cycle of FMDV replication in pigs is of 1224 h duration, so heel pad-inoculated pigs take about 48 h to develop severe disease (and actually around 72 h if given a small dose), while pigs infected by contact require 7296 h to become severely ill. In contrast, pigs exposed to natural aerosol (receiving a minimal infectious dose) required about 120 h to develop severe disease. If the infective dose were to be reduced further, we would expect that even more time (more replication cycles) would be required to reach high virus levels and the development of clinical disease. However, at low doses, the host response (including antibodies) is likely to prevent the development of high levels of virus. Such a model of multiple cycles may help in the design of more effective FMD vaccines for pigs, since current vaccines are less efficient for pigs than for other livestock species (Salt et al., 1998
). This could be through the provocation of a more effective local immunity in the pharynx or, alternatively, by the production of a better circulating immune response to cause the sequestration of circulating virus into non-replicating compartments.
The lungs yielded only small amounts of virus, indicating that they probably play a minor role in FMDV replication. This is in agreement with earlier studies on the source of airborne FMDV excreted in the breath of infected pigs, which showed that, in the early stages of infection, most airborne virus originates from the upper part of the respiratory tract but, as infection proceeds, the lower respiratory tract becomes more involved (Donaldson & Ferris, 1980
).
Although the data presented here suggest that there was little or no replication of FMDV in the lungs during the 14 day period of investigation, the possibility that replication occurs in lung epithelia or macrophages later in infection cannot be excluded. Replication in the lungs has been suggested by others, based on in situ hybridization and virus isolation (Brown et al., 1995
; Terpstra, 1972
). However, the actual levels of replication and/or accumulation at those sites were not determined. In our experiment, the virus concentrations were near maximal and vesicular lesions were evident from day 3 p.e., making that time the most likely point of peak airborne virus excretion (Davidson, 1997
). This is consistent with our hypothesis that stratified squamous epithelia cells, especially those in the skin, the oral mucosa and the pharynx, are those primarily responsible for the amplification of virus. Thus, the airborne virus excreted most likely originated from stratified squamous epithelia cells, with subsequent release of particles into the lumen of the respiratory tract and then transport in breath through the trachea, larynx, pharynx, nasal cavities and mouth to the exterior. However, the respiratory epithelia as well as lungs may play an indirect role in this excretion, because the large surface area may release virus that has been produced elsewhere and transported to these sites by muco-ciliary movement or the bloodstream.
Lymph nodes and the spleen appeared to accumulate virus at days 3 and 4 p.e. This virus was most likely produced elsewhere and filtered from the lymph and blood. The liver contained virus at a level that could be explained by the concentration of virus in the bloodstream.
In conclusion, the present study increases knowledge of the early pathogenesis of FMDV infection and disease in pigs. We focused on the pharyngeal area, the nasal mucosa, trachea and lungs; however, in future studies we plan to examine excretion from the epithelia in more detail using sensitive molecular techniques combined with continued quantitative analysis of data.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Alexandersen, S., Forsyth, M. A., Reid, S. M. & Belsham, G. J. (2000). Development of reverse transcriptionPCR (oligonucleotide probing) enzyme-linked immunosorbent assays for diagnosis and preliminary typing of foot-and-mouth disease: a new system using simple and aqueous-phase hybridization. Journal of Clinical Microbiology 38, 4604-4613.
Anonymous (1969). Report of the Committee of Inquiry on Foot-and-Mouth Disease (1968), part 1. London: Ministry of Agriculture, Fisheries & Food, HMSO.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (editors) (1988). Current Protocols in Molecular Biology. New York: Wiley.
Belsham, G. J. (1993). Distinctive features of foot-and-mouth disease virus, a member of the picornavirus family; aspects of virus protein synthesis, protein processing and structure. Progress in Biophysics & Molecular Biology 60, 241-260.[Medline]
Brown, C. C., Olander, H. J. & Meyer, R. F. (1995). Pathogenesis of foot-and-mouth disease in swine, studied by in-situ hybridization. Journal of Comparative Pathology 113, 51-58.[Medline]
Burrows, R. (1966). The infectivity assay of foot-and-mouth disease virus in pigs. Journal of Hygiene 64, 419-429.
Burrows, R., Mann, J. A., Garland, A. J., Greig, A. & Goodridge, D. (1981). The pathogenesis of natural and simulated natural foot-and-mouth disease infection in cattle. Journal of Comparative Pathology 91, 599-609.[Medline]
David, D., Stram, Y., Yadin, H., Trainin, Z. & Becker, Y. (1995). Foot and mouth disease virus replication in bovine skin Langerhans cells under in vitro conditions detected by RTPCR. Virus Genes 10, 5-13.[Medline]
Davidson, F. L. (1997). Alternative strategies for foot-and-mouth disease control in pigs. PhD thesis, University of Hertfordshire, UK.
De Castro, M. P. (1964). Behaviour of the foot and mouth disease virus in cell cultures: susceptibility of the IB-RS-2 cell line. Arquivos do Instituto Biologico Sao Paulo 31, 63-78.
Donaldson, A. I. (1979). Airborne foot-and-mouth disease. Veterinary Bulletin 49, 653-659.
Donaldson, A. I. (1986). Aerobiology of foot-and-mouth disease (FMD): an outline and recent advances. Revue Scientifique et Technique Office International des Epizooties 5, 315-321.
Donaldson, A. I. (1987). Foot-and-mouth disease: the principal features. Irish Veterinary Journal 41, 325-327.
Donaldson, A. I. & Ferris, N. P. (1980). Sites of release of airborne foot-and-mouth disease virus from infected pigs. Research in Veterinary Science 29, 315-319.[Medline]
Donaldson, A. I., Herniman, K. A., Parker, J. & Sellers, R. F. (1970). Further investigations on the airborne excretion of foot-and-mouth disease virus. Journal of Hygiene 68, 557-564.
Donaldson, A. I., Garland, A. J., Ferris, N. P. & Collen, T. (1981). The 1975 foot-and-mouth disease epidemic in Malta. I: Experimental studies with the causal virus strain O1 Malta. British Veterinary Journal 137, 300-307.
Donaldson, A. I., Gloster, J., Harvey, L. D. & Deans, D. H. (1982). Use of prediction models to forecast and analyse airborne spread during the foot-and-mouth disease outbreaks in Brittany, Jersey and the Isle of Wight in 1981. Veterinary Record 110, 53-57.[Abstract]
Donaldson, A. I., Gibson, C. F., Oliver, R., Hamblin, C. & Kitching, R. P. (1987). Infection of cattle by airborne foot-and-mouth disease virus: minimal doses with O1 and SAT 2 strains. Research in Veterinary Science 43, 339-346.[Medline]
Donaldson, A. I., Kitching, P. & Barnett, I. T. (1996). Foot-and-mouth disease. In Manual of Standards for Diagnostic Tests and Vaccines, pp. 4756. Paris: Office International des Epizooties.
Ferris, N. P. & Dawson, M. (1988). Routine application of enzyme-linked immunosorbent assay in comparison with complement fixation for the diagnosis of foot-and-mouth and swine vesicular diseases. Veterinary Microbiology 16, 201-209.[Medline]
Ferris, N. P., Powell, H. & Donaldson, A. I. (1988). Use of pre-coated immunoplates and freeze-dried reagents for the diagnosis of foot-and-mouth disease and swine vesicular disease by enzyme-linked immunosorbent assay (ELISA). Journal of Virological Methods 19, 197-206.[Medline]
Gailiunas, P. (1968). Microscopic skin lesions in cattle with foot-and-mouth disease. Archiv für die Gesamte Virusforschung 25, 188-200.[Medline]
Gailiunas, P. & Cottral, G. E. (1966). Presence and persistence of foot-and-mouth disease virus in bovine skin. Journal of Bacteriology 91, 2333-2338.
Gailiunas, P. & Cottral, G. E. (1967). Survival of foot-and-mouth disease virus in bovine hides. American Journal of Veterinary Research 28, 1047-1053.[Medline]
Gibson, C. F. & Donaldson, A. I. (1986). Exposure of sheep to natural aerosols of foot-and-mouth disease virus. Research in Veterinary Science 41, 45-49.[Medline]
Gloster, J., Sellers, R. F. & Donaldson, A. I. (1982). Long distance transport of foot-and-mouth disease virus over the sea. Veterinary Record 110, 47-52.[Abstract]
Hamblin, C., Armstrong, R. M. & Hedger, R. S. (1984). A rapid enzyme-linked immunosorbent assay for the detection of foot-and-mouth disease virus in epithelial tissues. Veterinary Microbiology 9, 435-443.[Medline]
Hamblin, C., Barnett, I. T. & Hedger, R. S. (1986a). A new enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies against foot-and-mouth disease virus. I. Development and method of ELISA. Journal of Immunological Methods 93, 115-121.[Medline]
Hamblin, C., Barnett, I. T. & Crowther, J. R. (1986b). A new enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies against foot-and-mouth disease virus. II. Application. Journal of Immunological Methods 93, 123-129.[Medline]
Hatch, T. F. & Gross, P. (1964). Pulmonary Deposition and Retention of Inhaled Aerosols, pp. 4568. London: Academic Press.
Lennette, E. H. (1964). Diagnostic Procedures for Viral and Rickettsial Diseases, pp. 4851. New York: American Public Health Association.
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Oleksiewicz, M. B., Donaldson, A. I. & Alexandersen, S. (2001). Development of a real-time RTPCR assay for quantitation of foot-and-mouth disease virus in diverse porcine tissues. Journal of Virological Methods 92, 23-35.[Medline]
Reid, S. M., Ferris, N. P., Hutchings, G. H., Samuel, A. R. & Knowles, N. J. (2000). Primary diagnosis of foot-and-mouth disease by reverse transcription polymerase chain reaction. Journal of Virological Methods 89, 167-176.[Medline]
Roeder, P. L. & Le Blanc Smith, P. M. (1987). Detection and typing of foot-and-mouth disease virus by enzyme-linked immunosorbent assay: a sensitive, rapid and reliable technique for primary diagnosis. Research in Veterinary Science 43, 225-232.[Medline]
Salt, J. S., Barnett, P. V., Dani, P. & Williams, L. (1998). Emergency vaccination of pigs against foot-and-mouth disease: protection against disease and reduction in contact transmission. Vaccine 16, 746-754.[Medline]
Sellers, R. F. (1971). Quantitative aspects of the spread of foot and mouth disease. Veterinary Bulletin 41, 431-439.
Sellers, R. F. & Parker, J. (1969). Airborne excretion of foot-and-mouth disease virus. Journal of Hygiene 67, 671-677.
Snowdon, W. A. (1966). Growth of foot-and-mouth disease virus in monolayer cultures of calf thyroid cells. Nature 210, 1079-1080.[Medline]
Terpstra, C. (1972). Pathogenesis of foot-and-mouth disease in experimentally infected pigs. Bulletin de lOffice International des Epizooties 77, 859-874.
Received 23 October 2000;
accepted 4 January 2001.
This article has been cited by other articles:
![]() |
A. Adkin, T. England, S. Hall, H. Coburn, C. J. Marooney, M. Seaman, J. Cooper, and E. Hartnett Estimating the risk of exposure of British livestock to foot-and-mouth disease associated with the importation of ship and aircraft waste Vet Rec., August 23, 2008; 163(8): 235 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Monaghan, S. Gold, J. Simpson, Z. Zhang, P. H. Weinreb, S. M. Violette, S. Alexandersen, and T. Jackson The {alpha}v{beta}6 integrin receptor for Foot-and-mouth disease virus is expressed constitutively on the epithelial cells targeted in cattle J. Gen. Virol., October 1, 2005; 86(10): 2769 - 2780. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Monaghan, J. Simpson, C. Murphy, S. Durand, M. Quan, and S. Alexandersen Use of Confocal Immunofluorescence Microscopy To Localize Viral Nonstructural Proteins and Potential Sites of Replication in Pigs Experimentally Infected with Foot-and-Mouth Disease Virus J. Virol., May 15, 2005; 79(10): 6410 - 6418. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Inoue, S. Alexandersen, A. T. Clark, C. Murphy, M. Quan, S. M. Reid, Y. Sakoda, H. L. Johns, and G. J. Belsham Importance of Arginine 20 of the Swine Vesicular Disease Virus 2A Protease for Activity and Virulence J. Virol., January 1, 2005; 79(1): 428 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang and S. Alexandersen Quantitative analysis of foot-and-mouth disease virus RNA loads in bovine tissues: implications for the site of viral persistence J. Gen. Virol., September 1, 2004; 85(9): 2567 - 2575. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jackson, S. Clark, S. Berryman, A. Burman, S. Cambier, D. Mu, S. Nishimura, and A. M. Q. King Integrin {alpha}v{beta}8 Functions as a Receptor for Foot-and-Mouth Disease Virus: Role of the {beta}-Chain Cytodomain in Integrin-Mediated Infection J. Virol., May 1, 2004; 78(9): 4533 - 4540. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, C. Murphy, M. Quan, J. Knight, and S. Alexandersen Extent of reduction of foot-and-mouth disease virus RNA load in oesophageal-pharyngeal fluid after peak levels may be a critical determinant of virus persistence in infected cattle J. Gen. Virol., February 1, 2004; 85(2): 415 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Hughes, J. S. Smith, C. A. Hanlon, and C. E. Rupprecht Evaluation of a TaqMan PCR Assay To Detect Rabies Virus RNA: Influence of Sequence Variation and Application to Quantification of Viral Loads J. Clin. Microbiol., January 1, 2004; 42(1): 299 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Hughes, V. Mioulet, D. T. Haydon, R. P. Kitching, A. I. Donaldson, and M. E. J. Woolhouse Serial passage of foot-and-mouth disease virus in sheep reveals declining levels of viraemia over time J. Gen. Virol., August 1, 2002; 83(8): 1907 - 1914. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Alexandersen, Z. Zhang, S. M. Reid, G. H. Hutchings, and A. I. Donaldson Quantities of infectious virus and viral RNA recovered from sheep and cattle experimentally infected with foot-and-mouth disease virus O UK 2001 J. Gen. Virol., August 1, 2002; 83(8): 1915 - 1923. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Mackay, K. E. Arden, and A. Nitsche Real-time PCR in virology Nucleic Acids Res., March 15, 2002; 30(6): 1292 - 1305. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jackson, A. P. Mould, D. Sheppard, and A. M. Q. King Integrin {alpha}v{beta}1 Is a Receptor for Foot-and-Mouth Disease Virus J. Virol., February 1, 2002; 76(3): 935 - 941. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||